From 0cb52d6f867579abede6e5c6a067084518d19b1b Mon Sep 17 00:00:00 2001
From: tjc <tjc@ee4ac58c-ac51-4696-9907-e4b3aa274f04>
Date: Wed, 9 Jun 2004 09:48:01 +0000
Subject: [PATCH] Java2 version
git-svn-id: svn+ssh://svn.internal.sanger.ac.uk/repos/svn/pathsoft/artemis/trunk@1635 ee4ac58c-ac51-4696-9907-e4b3aa274f04
---
uk/ac/sanger/artemis/components/ActMain.java | 283 +
uk/ac/sanger/artemis/components/AddMenu.java | 1070 ++++
.../artemis/components/AlignMatchViewer.java | 366 ++
.../artemis/components/AlignmentEvent.java | 57 +
.../artemis/components/AlignmentListener.java | 43 +
.../artemis/components/AlignmentViewer.java | 1604 ++++++
.../components/ArtemisCheckboxMenuItem.java | 127 +
.../artemis/components/ArtemisMain.java | 634 +++
uk/ac/sanger/artemis/components/BasePlot.java | 627 +++
.../artemis/components/BasePlotGroup.java | 337 ++
.../components/BioJavaEntrySource.java | 223 +
.../artemis/components/CanvasPanel.java | 240 +
.../artemis/components/ChoiceFrame.java | 111 +
.../artemis/components/ComparatorDialog.java | 331 ++
.../artemis/components/ComparatorGlue.java | 464 ++
.../artemis/components/CorbaEntrySource.java | 90 +
.../components/DbfetchEntrySource.java | 253 +
.../components/DisplayAdjustmentEvent.java | 186 +
.../components/DisplayAdjustmentListener.java | 45 +
.../artemis/components/DisplayComponent.java | 52 +
.../components/EMBLCorbaEntrySource.java | 318 ++
uk/ac/sanger/artemis/components/EditMenu.java | 2447 +++++++++
.../components/EntryActionListener.java | 63 +
.../sanger/artemis/components/EntryEdit.java | 1434 +++++
.../artemis/components/EntryEditVector.java | 92 +
.../artemis/components/EntryFileDialog.java | 463 ++
.../artemis/components/EntryGroupDisplay.java | 240 +
.../components/EntryGroupInfoDisplay.java | 536 ++
.../artemis/components/EntryGroupMenu.java | 336 ++
.../artemis/components/EntryGroupPanel.java | 376 ++
.../artemis/components/EntryHeaderEdit.java | 209 +
.../components/ExternalProgramOptions.java | 66 +
.../components/FeatureAminoAcidViewer.java | 172 +
.../artemis/components/FeatureBaseViewer.java | 166 +
.../artemis/components/FeatureDisplay.java | 4699 +++++++++++++++++
.../artemis/components/FeatureEdit.java | 1276 +++++
.../artemis/components/FeatureInfo.java | 658 +++
.../artemis/components/FeatureList.java | 971 ++++
.../artemis/components/FeatureListFrame.java | 195 +
.../artemis/components/FeaturePlot.java | 389 ++
.../artemis/components/FeaturePlotGroup.java | 337 ++
.../artemis/components/FeaturePopup.java | 758 +++
.../artemis/components/FeatureViewer.java | 151 +
.../components/FileDialogEntrySource.java | 286 +
.../artemis/components/FileManager.java | 401 ++
uk/ac/sanger/artemis/components/FileNode.java | 159 +
uk/ac/sanger/artemis/components/FileTree.java | 941 ++++
.../sanger/artemis/components/FileViewer.java | 293 +
uk/ac/sanger/artemis/components/GotoMenu.java | 510 ++
.../sanger/artemis/components/GraphMenu.java | 403 ++
.../components/InputStreamProgressDialog.java | 126 +
.../sanger/artemis/components/KeyChoice.java | 203 +
.../sanger/artemis/components/KeyChooser.java | 118 +
.../sanger/artemis/components/ListDialog.java | 128 +
.../artemis/components/LogReadListener.java | 76 +
.../sanger/artemis/components/LogViewer.java | 102 +
.../components/MarkerRangeRequester.java | 106 +
.../components/MarkerRangeRequesterEvent.java | 199 +
.../MarkerRangeRequesterListener.java | 42 +
.../artemis/components/MessageDialog.java | 143 +
.../artemis/components/MessageFrame.java | 106 +
.../artemis/components/MultiComparator.java | 1091 ++++
.../sanger/artemis/components/Navigator.java | 933 ++++
uk/ac/sanger/artemis/components/Plot.java | 723 +++
.../artemis/components/PlotMouseListener.java | 64 +
.../artemis/components/ProcessWatcher.java | 194 +
.../components/ProcessWatcherEvent.java | 70 +
.../components/ProcessWatcherListener.java | 42 +
.../artemis/components/ProgressThread.java | 64 +
.../artemis/components/QualifierChoice.java | 181 +
.../artemis/components/QualifierEditor.java | 332 ++
.../artemis/components/QualifierTextArea.java | 96 +
uk/ac/sanger/artemis/components/RunMenu.java | 278 +
.../artemis/components/ScoreChangeEvent.java | 58 +
.../components/ScoreChangeListener.java | 40 +
.../artemis/components/ScoreChanger.java | 222 +
.../artemis/components/ScoreScrollbar.java | 120 +
.../components/SearchResultViewer.java | 108 +
.../sanger/artemis/components/SelectMenu.java | 827 +++
.../components/SelectionInfoDisplay.java | 435 ++
.../artemis/components/SelectionMenu.java | 294 ++
.../artemis/components/SelectionViewer.java | 352 ++
uk/ac/sanger/artemis/components/Selector.java | 885 ++++
.../artemis/components/SequenceViewer.java | 165 +
uk/ac/sanger/artemis/components/Splash.java | 526 ++
.../artemis/components/StickyFileChooser.java | 99 +
.../artemis/components/SwingWorker.java | 150 +
.../artemis/components/TaskViewerFrame.java | 88 +
.../sanger/artemis/components/TextDialog.java | 119 +
.../artemis/components/TextFieldSink.java | 142 +
.../artemis/components/TextRequester.java | 158 +
.../components/TextRequesterEvent.java | 87 +
.../components/TextRequesterListener.java | 44 +
.../sanger/artemis/components/Utilities.java | 144 +
uk/ac/sanger/artemis/components/ViewMenu.java | 1430 +++++
.../WritableEMBLCorbaEntrySource.java | 226 +
.../sanger/artemis/components/WriteMenu.java | 852 +++
.../artemis/components/YesNoDialog.java | 115 +
98 files changed, 39591 insertions(+)
create mode 100644 uk/ac/sanger/artemis/components/ActMain.java
create mode 100644 uk/ac/sanger/artemis/components/AddMenu.java
create mode 100644 uk/ac/sanger/artemis/components/AlignMatchViewer.java
create mode 100644 uk/ac/sanger/artemis/components/AlignmentEvent.java
create mode 100644 uk/ac/sanger/artemis/components/AlignmentListener.java
create mode 100644 uk/ac/sanger/artemis/components/AlignmentViewer.java
create mode 100644 uk/ac/sanger/artemis/components/ArtemisCheckboxMenuItem.java
create mode 100644 uk/ac/sanger/artemis/components/ArtemisMain.java
create mode 100644 uk/ac/sanger/artemis/components/BasePlot.java
create mode 100644 uk/ac/sanger/artemis/components/BasePlotGroup.java
create mode 100644 uk/ac/sanger/artemis/components/BioJavaEntrySource.java
create mode 100644 uk/ac/sanger/artemis/components/CanvasPanel.java
create mode 100644 uk/ac/sanger/artemis/components/ChoiceFrame.java
create mode 100644 uk/ac/sanger/artemis/components/ComparatorDialog.java
create mode 100644 uk/ac/sanger/artemis/components/ComparatorGlue.java
create mode 100644 uk/ac/sanger/artemis/components/CorbaEntrySource.java
create mode 100644 uk/ac/sanger/artemis/components/DbfetchEntrySource.java
create mode 100644 uk/ac/sanger/artemis/components/DisplayAdjustmentEvent.java
create mode 100644 uk/ac/sanger/artemis/components/DisplayAdjustmentListener.java
create mode 100644 uk/ac/sanger/artemis/components/DisplayComponent.java
create mode 100644 uk/ac/sanger/artemis/components/EMBLCorbaEntrySource.java
create mode 100644 uk/ac/sanger/artemis/components/EditMenu.java
create mode 100644 uk/ac/sanger/artemis/components/EntryActionListener.java
create mode 100644 uk/ac/sanger/artemis/components/EntryEdit.java
create mode 100644 uk/ac/sanger/artemis/components/EntryEditVector.java
create mode 100644 uk/ac/sanger/artemis/components/EntryFileDialog.java
create mode 100644 uk/ac/sanger/artemis/components/EntryGroupDisplay.java
create mode 100644 uk/ac/sanger/artemis/components/EntryGroupInfoDisplay.java
create mode 100644 uk/ac/sanger/artemis/components/EntryGroupMenu.java
create mode 100644 uk/ac/sanger/artemis/components/EntryGroupPanel.java
create mode 100644 uk/ac/sanger/artemis/components/EntryHeaderEdit.java
create mode 100644 uk/ac/sanger/artemis/components/ExternalProgramOptions.java
create mode 100644 uk/ac/sanger/artemis/components/FeatureAminoAcidViewer.java
create mode 100644 uk/ac/sanger/artemis/components/FeatureBaseViewer.java
create mode 100644 uk/ac/sanger/artemis/components/FeatureDisplay.java
create mode 100644 uk/ac/sanger/artemis/components/FeatureEdit.java
create mode 100644 uk/ac/sanger/artemis/components/FeatureInfo.java
create mode 100644 uk/ac/sanger/artemis/components/FeatureList.java
create mode 100644 uk/ac/sanger/artemis/components/FeatureListFrame.java
create mode 100644 uk/ac/sanger/artemis/components/FeaturePlot.java
create mode 100644 uk/ac/sanger/artemis/components/FeaturePlotGroup.java
create mode 100644 uk/ac/sanger/artemis/components/FeaturePopup.java
create mode 100644 uk/ac/sanger/artemis/components/FeatureViewer.java
create mode 100644 uk/ac/sanger/artemis/components/FileDialogEntrySource.java
create mode 100644 uk/ac/sanger/artemis/components/FileManager.java
create mode 100644 uk/ac/sanger/artemis/components/FileNode.java
create mode 100644 uk/ac/sanger/artemis/components/FileTree.java
create mode 100644 uk/ac/sanger/artemis/components/FileViewer.java
create mode 100644 uk/ac/sanger/artemis/components/GotoMenu.java
create mode 100644 uk/ac/sanger/artemis/components/GraphMenu.java
create mode 100644 uk/ac/sanger/artemis/components/InputStreamProgressDialog.java
create mode 100644 uk/ac/sanger/artemis/components/KeyChoice.java
create mode 100644 uk/ac/sanger/artemis/components/KeyChooser.java
create mode 100644 uk/ac/sanger/artemis/components/ListDialog.java
create mode 100644 uk/ac/sanger/artemis/components/LogReadListener.java
create mode 100644 uk/ac/sanger/artemis/components/LogViewer.java
create mode 100644 uk/ac/sanger/artemis/components/MarkerRangeRequester.java
create mode 100644 uk/ac/sanger/artemis/components/MarkerRangeRequesterEvent.java
create mode 100644 uk/ac/sanger/artemis/components/MarkerRangeRequesterListener.java
create mode 100644 uk/ac/sanger/artemis/components/MessageDialog.java
create mode 100644 uk/ac/sanger/artemis/components/MessageFrame.java
create mode 100644 uk/ac/sanger/artemis/components/MultiComparator.java
create mode 100644 uk/ac/sanger/artemis/components/Navigator.java
create mode 100644 uk/ac/sanger/artemis/components/Plot.java
create mode 100644 uk/ac/sanger/artemis/components/PlotMouseListener.java
create mode 100644 uk/ac/sanger/artemis/components/ProcessWatcher.java
create mode 100644 uk/ac/sanger/artemis/components/ProcessWatcherEvent.java
create mode 100644 uk/ac/sanger/artemis/components/ProcessWatcherListener.java
create mode 100644 uk/ac/sanger/artemis/components/ProgressThread.java
create mode 100644 uk/ac/sanger/artemis/components/QualifierChoice.java
create mode 100644 uk/ac/sanger/artemis/components/QualifierEditor.java
create mode 100644 uk/ac/sanger/artemis/components/QualifierTextArea.java
create mode 100644 uk/ac/sanger/artemis/components/RunMenu.java
create mode 100644 uk/ac/sanger/artemis/components/ScoreChangeEvent.java
create mode 100644 uk/ac/sanger/artemis/components/ScoreChangeListener.java
create mode 100644 uk/ac/sanger/artemis/components/ScoreChanger.java
create mode 100644 uk/ac/sanger/artemis/components/ScoreScrollbar.java
create mode 100644 uk/ac/sanger/artemis/components/SearchResultViewer.java
create mode 100644 uk/ac/sanger/artemis/components/SelectMenu.java
create mode 100644 uk/ac/sanger/artemis/components/SelectionInfoDisplay.java
create mode 100644 uk/ac/sanger/artemis/components/SelectionMenu.java
create mode 100644 uk/ac/sanger/artemis/components/SelectionViewer.java
create mode 100644 uk/ac/sanger/artemis/components/Selector.java
create mode 100644 uk/ac/sanger/artemis/components/SequenceViewer.java
create mode 100644 uk/ac/sanger/artemis/components/Splash.java
create mode 100644 uk/ac/sanger/artemis/components/StickyFileChooser.java
create mode 100644 uk/ac/sanger/artemis/components/SwingWorker.java
create mode 100644 uk/ac/sanger/artemis/components/TaskViewerFrame.java
create mode 100644 uk/ac/sanger/artemis/components/TextDialog.java
create mode 100644 uk/ac/sanger/artemis/components/TextFieldSink.java
create mode 100644 uk/ac/sanger/artemis/components/TextRequester.java
create mode 100644 uk/ac/sanger/artemis/components/TextRequesterEvent.java
create mode 100644 uk/ac/sanger/artemis/components/TextRequesterListener.java
create mode 100644 uk/ac/sanger/artemis/components/Utilities.java
create mode 100644 uk/ac/sanger/artemis/components/ViewMenu.java
create mode 100644 uk/ac/sanger/artemis/components/WritableEMBLCorbaEntrySource.java
create mode 100644 uk/ac/sanger/artemis/components/WriteMenu.java
create mode 100644 uk/ac/sanger/artemis/components/YesNoDialog.java
diff --git a/uk/ac/sanger/artemis/components/ActMain.java b/uk/ac/sanger/artemis/components/ActMain.java
new file mode 100644
index 000000000..486d2a4a6
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ActMain.java
@@ -0,0 +1,283 @@
+/* ActMain.java
+ *
+ * created: Wed May 10 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ActMain.java,v 1.1 2004-06-09 09:45:56 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.Bases;
+
+import uk.ac.sanger.artemis.util.*;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.SimpleEntryInformation;
+
+import java.awt.event.*;
+import java.io.IOException;
+import javax.swing.JFrame;
+
+/**
+ * The main window for the Artemis Comparison Tool.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: ActMain.java,v 1.1 2004-06-09 09:45:56 tjc Exp $
+ **/
+
+public class ActMain extends Splash
+{
+ /** Version String use for banner messages and title bars. */
+ public static final String version = "Release 2";
+ /** File manager */
+ protected static FileManager filemanager = null;
+
+ /**
+ * The constructor creates all the components for the main ACT window
+ * and sets up all the menu callbacks.
+ **/
+ public ActMain()
+ {
+ super("Artemis Comparison Tool", "ACT", version);
+
+ ActionListener open_listener = new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ makeOpenDialog();
+ }
+ };
+
+ makeMenuItem(file_menu, "Open ...", open_listener);
+
+ ActionListener quit_listener = new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ exit();
+ }
+ };
+
+ makeMenuItem(file_menu, "Quit", quit_listener);
+ }
+
+ /**
+ * Make a new Comparator component from the given files.
+ * @param frame The JFrame used when making a new MessageDialog.
+ * @param progress_listener The object to which InputStreamProgressEvents
+ * will be send while reading. Can be null.
+ * @param file_names Alternating sequence and comparison data file names.
+ * Must be >= 3. I there are an even number of file names the first
+ * file/sequence object will be added to the send of the display and the
+ * last comparison file will be assumed to be a a comparison between the
+ * last and first sequence files.
+ **/
+ public static boolean makeMultiComparator(final JFrame frame,
+ final InputStreamProgressListener progress_listener,
+ final String[] file_names)
+ {
+
+ final ProgressThread progress_thread = new ProgressThread(null,
+ "Loading Entry...");
+
+ SwingWorker entryWorker = new SwingWorker()
+ {
+ public Object construct()
+ {
+ progress_thread.start();
+ final EntryGroup[] entry_group_array =
+ new EntryGroup[file_names.length / 2 + 1];
+
+ final ComparisonData[] comparison_data_array =
+ new ComparisonData[file_names.length / 2];
+
+ for(int i = 0; i<file_names.length; i += 2)
+ {
+ final EntryInformation entry_information =
+ new SimpleEntryInformation(Options.getArtemisEntryInformation());
+
+ final String this_file_name = file_names[i];
+
+ final Document entry_document =
+ DocumentFactory.makeDocument(this_file_name);
+
+ if(progress_listener != null)
+ entry_document.addInputStreamProgressListener(progress_listener);
+
+ final uk.ac.sanger.artemis.io.Entry embl_entry =
+ EntryFileDialog.getEntryFromFile(frame, entry_document,
+ entry_information,
+ true);
+
+ // getEntryFromFile() has alerted the user so we just need to quit
+ if(embl_entry == null)
+ return null;
+
+ final uk.ac.sanger.artemis.io.Sequence sequence =
+ embl_entry.getSequence();
+
+ if(sequence == null)
+ {
+ new MessageDialog(frame, "This file contains no sequence: " +
+ this_file_name);
+ return null;
+ }
+
+ final Bases embl_bases = new Bases(sequence);
+ final EntryGroup entry_group = new SimpleEntryGroup(embl_bases);
+
+ try
+ {
+ final Entry entry = new Entry(entry_group.getBases(), embl_entry);
+ entry_group.add(entry);
+ entry_group_array[i / 2] = entry_group;
+ }
+ catch(OutOfRangeException e)
+ {
+ new MessageDialog(frame, "read failed: one of the features has an " +
+ "out of range location: " + e.getMessage());
+ return null;
+ }
+ }
+
+ // add the first entry at the end to make the MultiComparator
+ // circular(-ish)
+ if(file_names.length % 2 == 0)
+ entry_group_array[entry_group_array.length - 1] = entry_group_array[0];
+
+ try
+ {
+ for(int i = 1 ; i < file_names.length ; i += 2)
+ {
+ final String comparison_data_file_name = file_names[i];
+ final Document comparison_data_document =
+ DocumentFactory.makeDocument(comparison_data_file_name);
+
+ comparison_data_array[i / 2] =
+ ComparisonDataFactory.readComparisonData(comparison_data_document);
+
+ final Bases prev_bases = entry_group_array[i/2].getBases();
+ final Bases next_bases = entry_group_array[i/2 + 1].getBases();
+
+ final ComparisonData swapped_comparison_data =
+ comparison_data_array[i / 2].flipMatchesIfNeeded(prev_bases,
+ next_bases);
+
+ if(swapped_comparison_data != null)
+ comparison_data_array[i / 2] = swapped_comparison_data;
+
+ if(swapped_comparison_data != null)
+ {
+ final MessageFrame message_frame =
+ new MessageFrame("note: hits from " + comparison_data_file_name +
+ " have been flipped to match the " +
+ "sequences");
+
+ message_frame.setVisible(true);
+ }
+ }
+ }
+ catch(IOException e)
+ {
+ new MessageDialog(frame, "error while reading: " + e.getMessage());
+ return null;
+ }
+ catch(OutOfRangeException e)
+ {
+ new MessageDialog(frame, "comparison file read failed: " +
+ "out of range error: " + e.getMessage());
+ return null;
+ }
+
+ final MultiComparator comparator =
+ new MultiComparator(entry_group_array,
+ comparison_data_array,
+ progress_listener);
+
+ comparator.setVisible(true);
+ return null;
+ }
+
+ public void finished()
+ {
+ if(progress_thread !=null)
+ progress_thread.finished();
+ }
+
+ };
+ entryWorker.start();
+
+ return true;
+ }
+
+ /**
+ * Create a dialog that allow the user to the choose two files to compare
+ * and a file containing comparison data.
+ **/
+ private void makeOpenDialog()
+ {
+ if(filemanager == null)
+ filemanager = new FileManager(this,null);
+ else
+ filemanager.setVisible(true);
+ new ComparatorDialog(this).setVisible(true);
+ }
+
+ /**
+ * Exit from ACT.
+ **/
+ protected void exit()
+ {
+ System.exit(0);
+ }
+
+ /**
+ * Main entry point for ACT
+ **/
+ public static void main(final String [] args)
+ {
+ final ActMain main_window = new ActMain();
+ main_window.setVisible(true);
+
+ final InputStreamProgressListener progress_listener =
+ main_window.getInputStreamProgressListener();
+
+ if(args.length >= 3)
+ ActMain.makeMultiComparator(main_window, progress_listener,
+ args);
+ else
+ {
+ if(args.length != 0)
+ {
+ System.err.println("Error - this program needs either no " +
+ " arguments or an odd number\n" +
+ "(3 or more):");
+ System.err.println(" act sequence_1 comparison_data sequence_2");
+ System.err.println("or");
+ System.err.println(" act seq_1 comparison_data_2_v_1 seq_2 comparison_data_3_v_2 seq_3");
+ System.err.println("or");
+ System.err.println(" act");
+ System.exit(1);
+ }
+ }
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/AddMenu.java b/uk/ac/sanger/artemis/components/AddMenu.java
new file mode 100644
index 000000000..c432f8748
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/AddMenu.java
@@ -0,0 +1,1070 @@
+/* AddMenu.java
+ *
+ * created: Tue Dec 29 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000,2001,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/AddMenu.java,v 1.1 2004-06-09 09:45:57 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+import uk.ac.sanger.artemis.plot.CodonUsageAlgorithm;
+
+import uk.ac.sanger.artemis.util.*;
+import uk.ac.sanger.artemis.io.Key;
+import uk.ac.sanger.artemis.io.Range;
+import uk.ac.sanger.artemis.io.RangeVector;
+import uk.ac.sanger.artemis.io.Location;
+import uk.ac.sanger.artemis.io.QualifierVector;
+import uk.ac.sanger.artemis.io.Qualifier;
+import uk.ac.sanger.artemis.io.QualifierParseException;
+import uk.ac.sanger.artemis.io.InvalidQualifierException;
+import uk.ac.sanger.artemis.io.InvalidRelationException;
+import uk.ac.sanger.artemis.io.InvalidKeyException;
+import uk.ac.sanger.artemis.io.LocationParseException;
+import uk.ac.sanger.artemis.io.EntryInformationException;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * A Menu with commands that add new features/entries to an EntryGroup. This
+ * should have been called CreateMenu.
+ *
+ * @author Kim Rutherford
+ * @version $Id: AddMenu.java,v 1.1 2004-06-09 09:45:57 tjc Exp $
+ **/
+
+public class AddMenu extends SelectionMenu {
+ /**
+ * The shortcut for "Create From Base Range".
+ **/
+ final static KeyStroke CREATE_FROM_BASE_RANGE_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_C, InputEvent.CTRL_MASK);
+
+ final static public int CREATE_FROM_BASE_RANGE_KEY_CODE = KeyEvent.VK_C;
+
+ /**
+ * Create a new AddMenu object.
+ * @param frame The JFrame that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param entry_group The EntryGroup object where new features/entries will
+ * be added.
+ * @param goto_event_source The object the we will call makeBaseVisible ()
+ * on.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ * @param menu_name The name of the new menu.
+ **/
+ public AddMenu (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final GotoEventSource goto_event_source,
+ final BasePlotGroup base_plot_group,
+ final String menu_name) {
+ super (frame, menu_name, selection);
+
+ this.entry_group = entry_group;
+ this.base_plot_group = base_plot_group;
+
+ new_feature_item = new JMenuItem ("New Feature");
+ new_feature_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ makeNewFeature ();
+ }
+ });
+
+ add (new_feature_item);
+
+ create_feature_from_range_item =
+ new JMenuItem ("Create Feature From Base Range");
+ create_feature_from_range_item.setAccelerator (CREATE_FROM_BASE_RANGE_KEY);
+ create_feature_from_range_item.addActionListener(new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ createFeatureFromBaseRange (getParentFrame (), getSelection (),
+ entry_group, getGotoEventSource ());
+ }
+ });
+
+ add (create_feature_from_range_item);
+
+ create_intron_features_item =
+ new JMenuItem ("Create Intron Features");
+ create_intron_features_item.addActionListener(new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ createIntronFeatures (getParentFrame (), getSelection (),
+ entry_group);
+ }
+ });
+
+ add (create_intron_features_item);
+
+ create_exon_features_item =
+ new JMenuItem ("Create Exon Features");
+ create_exon_features_item.addActionListener(new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ createExonFeatures (getParentFrame (), getSelection (),
+ entry_group);
+ }
+ });
+
+ add (create_exon_features_item);
+
+ create_gene_features_item =
+ new JMenuItem ("Create Gene Features");
+ create_gene_features_item.addActionListener(new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ createGeneFeatures (getParentFrame (), getSelection (),
+ entry_group);
+ }
+ });
+
+ add (create_gene_features_item);
+
+ addSeparator ();
+
+ new_entry_item = new JMenuItem ("New Entry");
+ new_entry_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ makeNewEntry ();
+ }
+ });
+
+ add (new_entry_item);
+
+ addSeparator ();
+
+ mark_orfs_with_size_item = new JMenuItem ("Mark Open Reading Frames ...");
+
+ mark_orfs_with_size_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ markORFSWithSize (false);
+ }
+ });
+
+ add (mark_orfs_with_size_item);
+
+
+ mark_empty_orfs_with_size_item = new JMenuItem ("Mark Empty ORFs ...");
+
+ mark_empty_orfs_with_size_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ markORFSWithSize (true);
+ }
+ });
+
+ add (mark_empty_orfs_with_size_item);
+
+
+ mark_orfs_range_item = new JMenuItem ("Mark ORFs In Range ...");
+ mark_orfs_range_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ markOpenReadingFramesInRange ();
+ }
+ });
+
+ add (mark_orfs_range_item);
+
+
+ mark_pattern_item = new JMenuItem ("Mark From Pattern ...");
+ mark_pattern_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ makeFeaturesFromPattern ();
+ }
+ });
+
+ add (mark_pattern_item);
+
+ mark_ambiguities_item = new JMenuItem ("Mark Ambiguities");
+ mark_ambiguities_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ markAmbiguities ();
+ }
+ });
+
+ add (mark_ambiguities_item);
+ }
+
+ /**
+ * Create a new AddMenu object.
+ * @param frame The JFrame that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param entry_group The EntryGroup object where new features/entries will
+ * be added.
+ * @param goto_event_source The object the we will call makeBaseVisible ()
+ * on.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public AddMenu (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final GotoEventSource goto_event_source,
+ final BasePlotGroup base_plot_group) {
+ this (frame, selection, entry_group,
+ goto_event_source, base_plot_group, "Create");
+ }
+
+ /**
+ * Create a new feature in the default Entry of the entry group. See
+ * EntryGroup.createFeature () for details.
+ **/
+ private void makeNewFeature () {
+ if (entry_group.size () > 0) {
+ if (entry_group.getDefaultEntry () == null) {
+ new MessageDialog (getParentFrame (), "There is no default entry");
+ } else {
+
+ try {
+ entry_group.getActionController ().startAction ();
+
+ final Feature new_feature = entry_group.createFeature ();
+
+ final FeatureEdit feature_edit =
+ new FeatureEdit (new_feature, entry_group, getSelection (),
+ getGotoEventSource ());
+
+ final ActionListener cancel_listener =
+ new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ try {
+ new_feature.removeFromEntry ();
+ } catch (ReadOnlyException exception) {
+ throw new Error ("internal error - unexpected exception: " +
+ exception);
+ }
+ }
+ };
+
+ feature_edit.addCancelActionListener (cancel_listener);
+
+ feature_edit.addApplyActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ // after apply is pressed cancel should not remove the new
+ // feature
+ feature_edit.removeCancelActionListener (cancel_listener);
+ }
+ });
+
+ feature_edit.show ();
+ } catch (ReadOnlyException e) {
+ new MessageDialog (getParentFrame (), "feature not created: " +
+ "the default entry is read only");
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+ } else {
+ new MessageDialog (getParentFrame (),
+ "Cannot make a feature without an existing entry");
+ }
+ }
+
+ /**
+ * Create a new Entry in the first Entry of the entry group.
+ **/
+ private void makeNewEntry () {
+ entry_group.createEntry ();
+ }
+
+ /**
+ * Create a new Feature in entry_group from the selected range of bases and
+ * then display a FeatureEdit component for the new Feature.
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The Selection containing the sequence to create the
+ * feature from.
+ * @param entry_group The EntryGroup to create the feature in.
+ * @param goto_event_source Needed to create a FeatureEdit component.
+ **/
+ static void createFeatureFromBaseRange (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final GotoEventSource
+ goto_event_source) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ if (!checkForSelectionRange (frame, selection)) {
+ return;
+ }
+
+ final MarkerRange range = selection.getMarkerRange ();
+ final Entry default_entry = entry_group.getDefaultEntry ();
+
+ if (default_entry == null) {
+ new MessageDialog (frame, "There is no default entry");
+ return;
+ }
+
+ try {
+ final Location new_location = range.createLocation ();
+
+ /*final*/ Feature temp_feature;
+
+ try {
+ temp_feature = default_entry.createFeature (Key.CDS, new_location);
+ } catch (EntryInformationException e) {
+ // use the default key instead
+
+ final Key default_key =
+ default_entry.getEntryInformation ().getDefaultKey ();
+
+ try {
+ temp_feature =
+ default_entry.createFeature (default_key, new_location);
+ } catch (EntryInformationException ex) {
+ throw new Error ("internal error - unexpected exception: " + ex);
+ }
+ }
+
+ final Feature new_feature = temp_feature;
+
+ selection.setMarkerRange (null);
+ selection.set (new_feature);
+
+ final FeatureEdit feature_edit =
+ new FeatureEdit (new_feature, entry_group,
+ selection, goto_event_source);
+
+ final ActionListener cancel_listener =
+ new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ try {
+ new_feature.removeFromEntry ();
+ selection.setMarkerRange (range);
+ } catch (ReadOnlyException exception) {
+ throw new Error ("internal error - unexpected exception: " +
+ exception);
+ }
+ }
+ };
+
+ feature_edit.addCancelActionListener (cancel_listener);
+
+ feature_edit.addApplyActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ // after apply is pressed cancel should not remove the new
+ // feature
+ feature_edit.removeCancelActionListener (cancel_listener);
+ }
+ });
+
+ feature_edit.show ();
+ } catch (ReadOnlyException e) {
+ new MessageDialog (frame, "feature not created: " +
+ "the default entry is read only");
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Create a new intron between each pair of exons in the selected CDS
+ * features. The introns are created in the Entry that contains the CDSs.
+ * @param frame The Frame to use for MessageDialog components.
+ * @param selection The Selection containing the CDS features to create the
+ * introns for.
+ * @param entry_group The EntryGroup to create the features in.
+ **/
+ static void createIntronFeatures (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ if (!checkForSelectionFeatures (frame, selection)) {
+ return;
+ }
+
+ final FeatureVector selected_features = selection.getAllFeatures ();
+
+ for (int feature_index = 0 ;
+ feature_index < selected_features.size () ;
+ ++feature_index) {
+
+ final Feature selection_feature =
+ selected_features.elementAt (feature_index);
+
+ if (!selection_feature.isProteinFeature ()) {
+ continue;
+ }
+
+ final Location cds_location = selection_feature.getLocation ();
+
+ final RangeVector cds_ranges = cds_location.getRanges ();
+
+ if (cds_ranges.size () < 2) {
+ continue;
+ }
+
+ if (cds_location.isComplement ()) {
+ cds_ranges.reverse ();
+ }
+
+ for (int range_index = 0 ;
+ range_index < cds_ranges.size () - 1 ;
+ ++range_index) {
+ final int end_of_range_1 =
+ cds_ranges.elementAt (range_index).getEnd ();
+ final int start_of_range_2 =
+ cds_ranges.elementAt (range_index + 1).getStart ();
+
+ if (end_of_range_1 > start_of_range_2) {
+ // ignore - the exons overlap so there is no room for an intron
+ continue;
+ }
+
+ final Range new_range;
+
+ try {
+ new_range = new Range (end_of_range_1 + 1,
+ start_of_range_2 - 1);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+
+ final RangeVector intron_ranges = new RangeVector ();
+
+ intron_ranges.add (new_range);
+
+ final Key intron_key = new Key ("intron");
+ final Location intron_location =
+ new Location (intron_ranges, cds_location.isComplement ());
+ final QualifierVector qualifiers = new QualifierVector ();
+
+ try {
+ selection_feature.getEntry ().createFeature (intron_key,
+ intron_location,
+ qualifiers);
+ } catch (ReadOnlyException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (EntryInformationException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Create a new exon for each FeatureSegment in the selected CDS features.
+ * The exons are created in the Entry that contains the CDSs.
+ * @param frame The Frame to use for MessageDialog components.
+ * @param selection The Selection containing the CDS features to create the
+ * exons for.
+ * @param entry_group The EntryGroup to create the features in.
+ **/
+ static void createExonFeatures (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ if (!checkForSelectionFeatures (frame, selection)) {
+ return;
+ }
+
+ final FeatureVector selected_features = selection.getAllFeatures ();
+
+ for (int feature_index = 0 ;
+ feature_index < selected_features.size () ;
+ ++feature_index) {
+
+ final Feature selection_feature =
+ selected_features.elementAt (feature_index);
+
+ if (!selection_feature.isProteinFeature ()) {
+ continue;
+ }
+
+ final Location cds_location = selection_feature.getLocation ();
+
+ final RangeVector cds_ranges = cds_location.getRanges ();
+
+ for (int range_index = 0 ;
+ range_index < cds_ranges.size () ;
+ ++range_index) {
+ final Range this_range = cds_ranges.elementAt (range_index);
+
+ final RangeVector exon_ranges = new RangeVector ();
+
+ exon_ranges.add (this_range);
+
+ final Key exon_key = new Key ("exon");
+ final Location exon_location =
+ new Location (exon_ranges, cds_location.isComplement ());
+ final QualifierVector qualifiers = new QualifierVector ();
+
+ try {
+ selection_feature.getEntry ().createFeature (exon_key,
+ exon_location,
+ qualifiers);
+ } catch (ReadOnlyException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (EntryInformationException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Create a new gene for each of the selected CDS features.
+ * @param frame The Frame to use for MessageDialog components.
+ * @param selection The Selection containing the CDS features.
+ * @param entry_group The EntryGroup to create the features in.
+ **/
+ static void createGeneFeatures (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group) {
+ /*
+ * XXX - FIXME - include 5'UTR at the start and 3'UTR at the end and if
+ * two (or more) CDSs have the same primary name create one gene feature
+ * that covers them.
+ */
+ try {
+ entry_group.getActionController ().startAction ();
+
+ if (!checkForSelectionFeatures (frame, selection)) {
+ return;
+ }
+
+ final FeatureVector selected_features = selection.getAllFeatures ();
+
+ for (int feature_index = 0 ;
+ feature_index < selected_features.size () ;
+ ++feature_index) {
+
+ final Feature selection_feature =
+ selected_features.elementAt (feature_index);
+
+ if (!selection_feature.isProteinFeature ()) {
+ continue;
+ }
+
+ final Range max_range = selection_feature.getMaxRawRange ();
+ final boolean complement_flag =
+ selection_feature.getLocation ().isComplement ();
+
+ final RangeVector ranges = new RangeVector ();
+ ranges.add (max_range);
+
+ final Key gene_key = new Key ("gene");
+ final Location gene_location =
+ new Location (ranges, complement_flag);
+ final QualifierVector qualifiers = new QualifierVector ();
+
+ try {
+ selection_feature.getEntry ().createFeature (gene_key,
+ gene_location,
+ qualifiers);
+ } catch (ReadOnlyException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (EntryInformationException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Open a TextRequester to ask the user for the minimum ORF size then call
+ * markOpenReadingFrames ().
+ * @param empty_only If true only those ORFS that don't already contain a
+ * segment will be marked.
+ **/
+ private void markORFSWithSize (final boolean empty_only) {
+ final int default_minimum_orf_size =
+ Options.getOptions ().getMinimumORFSize ();
+
+ final TextRequester text_requester =
+ new TextRequester ("minimum open reading frame size?",
+ 18, String.valueOf (default_minimum_orf_size));
+
+ text_requester.addTextRequesterListener (new TextRequesterListener () {
+ public void actionPerformed (final TextRequesterEvent event) {
+ if (event.getType () == TextRequesterEvent.CANCEL) {
+ return;
+ }
+
+ final String requester_text = event.getRequesterText ().trim ();
+
+ if (requester_text.length () == 0) {
+ return;
+ }
+
+ try {
+ final int minimum_orf_size =
+ Integer.valueOf (requester_text).intValue ();
+
+ markOpenReadingFrames (minimum_orf_size, empty_only);
+ } catch (NumberFormatException e) {
+ new MessageDialog (getParentFrame (),
+ "this is not a number: " + requester_text);
+ }
+ }
+ });
+
+ text_requester.setVisible (true);
+ }
+
+ /**
+ * Create a new Feature for each open reading frame.
+ * @param minimum_orf_size All the returned ORFs will be at least this many
+ * amino acids long.
+ * @param empty_only If true only those ORFS that don't already contain a
+ * segment will be marked.
+ **/
+ private void markOpenReadingFrames (final int minimum_orf_size,
+ final boolean empty_only) {
+ try {
+ final Entry new_entry =
+ entry_group.createEntry ("ORFS_" + minimum_orf_size + '+');
+
+ final int sequence_length = entry_group.getSequenceLength ();
+
+ final Strand forward_strand =
+ entry_group.getBases ().getForwardStrand ();
+
+ final MarkerRange forward_range =
+ forward_strand.makeMarkerRangeFromPositions (1, sequence_length);
+
+ markOpenReadingFrames (new_entry, forward_range, minimum_orf_size,
+ empty_only);
+
+ final Strand backward_strand =
+ entry_group.getBases ().getReverseStrand ();
+
+ final MarkerRange backward_range =
+ backward_strand.makeMarkerRangeFromPositions (1, sequence_length);
+
+ markOpenReadingFrames (new_entry, backward_range, minimum_orf_size,
+ empty_only);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected OutOfRangeException");
+ }
+ }
+
+ /**
+ * Create a new Feature for each open reading frame. The minimum size of
+ * the ORFS is specified in the options file.
+ **/
+ private void markOpenReadingFramesInRange () {
+ if (!checkForSelectionRange (getParentFrame (), getSelection ())) {
+ return;
+ }
+
+ final int default_minimum_orf_size =
+ Options.getOptions ().getMinimumORFSize ();
+
+ final TextRequester text_requester =
+ new TextRequester ("minimum open reading frame size?",
+ 18, String.valueOf (default_minimum_orf_size));
+
+ text_requester.addTextRequesterListener (new TextRequesterListener () {
+ public void actionPerformed (final TextRequesterEvent event) {
+ if (event.getType () == TextRequesterEvent.CANCEL) {
+ return;
+ }
+
+ final String requester_text = event.getRequesterText ().trim ();
+
+ if (requester_text.length () == 0) {
+ return;
+ }
+
+ try {
+ final int minimum_orf_size =
+ Integer.valueOf (requester_text).intValue ();
+
+ final Entry new_entry =
+ entry_group.createEntry ("ORFS_" + minimum_orf_size + '+');
+
+ final MarkerRange selection_range =
+ getSelection ().getMarkerRange ();
+
+ markOpenReadingFrames (new_entry, selection_range, minimum_orf_size,
+ false);
+
+
+ } catch (NumberFormatException e) {
+ new MessageDialog (getParentFrame (),
+ "this is not a number: " + requester_text);
+ }
+ }
+ });
+
+ text_requester.setVisible (true);
+
+ }
+
+ /**
+ * Create a new Feature in the given Entry for each open reading frame that
+ * overlaps the given range. The minimum size of the ORFS is specified in
+ * the options file.
+ * @param entry The new features are created in this entry.
+ * @param search_range The range of bases to search for ORFs.
+ * @param minimum_orf_size All the returned ORFs will be at least this many
+ * amino acids long.
+ * @param empty_only If true only those ORFS that don't already contain a
+ * segment will be marked.
+ **/
+ private void markOpenReadingFrames (final Entry entry,
+ final MarkerRange search_range,
+ final int minimum_orf_size,
+ final boolean empty_only) {
+ final MarkerRange [] forward_orf_ranges =
+ Strand.getOpenReadingFrameRanges (search_range, minimum_orf_size);
+
+ for (int i = 0 ; i < forward_orf_ranges.length ; ++i) {
+ final MarkerRange this_range = forward_orf_ranges[i];
+
+ final Feature new_feature;
+
+ try {
+ new_feature = makeFeatureFromMarkerRange (entry, this_range, Key.CDS);
+ } catch (EntryInformationException e) {
+ new MessageDialog (getParentFrame (), "cannot continue: " +
+ "the default entry does not support CDS features");
+ return;
+ } catch (ReadOnlyException e) {
+ new MessageDialog (getParentFrame (), "cannot continue: " +
+ "the default entry is read only");
+ return;
+ }
+
+ if (empty_only && overlapsAnActiveSegment (new_feature)) {
+ try {
+ new_feature.removeFromEntry ();
+ } catch (ReadOnlyException exception) {
+ throw new Error ("internal error - unexpected exception: " +
+ exception);
+ }
+ }
+ }
+ }
+
+ /**
+ * Return true if and only if the given feature overlaps (and is in the
+ * same frame as) a segment in an active entry.
+ **/
+ private boolean overlapsAnActiveSegment (final Feature test_feature) {
+ final Range test_feature_range = test_feature.getMaxRawRange ();
+
+ FeatureVector overlapping_features;
+
+ try {
+ overlapping_features =
+ entry_group.getFeaturesInRange (test_feature_range);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+
+ for (int feature_index = 0 ;
+ feature_index < overlapping_features.size () ;
+ ++feature_index ) {
+
+ final Feature current_feature =
+ overlapping_features.elementAt (feature_index);
+
+ if (current_feature != test_feature && current_feature.isCDS ()) {
+ final FeatureSegmentVector segments = current_feature.getSegments ();
+
+ for (int segment_index = 0;
+ segment_index < segments.size () ;
+ ++segment_index) {
+ final FeatureSegment this_segment =
+ segments.elementAt (segment_index);
+
+ if (test_feature_range.overlaps (this_segment.getRawRange ())) {
+ final int test_feature_frame =
+ test_feature.getSegments ().elementAt (0).getFrameID ();
+ final int this_segment_frame = this_segment.getFrameID ();
+
+ if (test_feature_frame == this_segment_frame) {
+ return true;
+ }
+ }
+ }
+ }
+ }
+
+ return false;
+ }
+
+ /**
+ * Make a new Feature from the given MarkerRange in the given Entry. The
+ * new feature will be given the key 'CDS' and it's location will match the
+ * MarkerRange.
+ * @param entry The new feature is created in this entry.
+ * @param range The location of the new feature.
+ * @param key The key give the new feature
+ * @exception EntryInformationException Thrown if this Entry does not
+ * support features with the given key. Also thrown if any of these
+ * qualifiers aren't supported: note, label or gene.
+ **/
+ private Feature makeFeatureFromMarkerRange (final Entry entry,
+ final MarkerRange range,
+ final Key key)
+ throws EntryInformationException, ReadOnlyException {
+ try {
+ final Location new_location = range.createLocation ();
+
+ final QualifierVector qualifiers = new QualifierVector ();
+
+ qualifiers.setQualifier (new Qualifier ("note", "none"));
+
+ final Feature new_feature =
+ entry.createFeature (key, new_location, qualifiers);
+
+ final CodonUsageAlgorithm codon_usage_algorithm =
+ base_plot_group.getCodonUsageAlgorithm ();
+
+ if (codon_usage_algorithm != null) {
+ int score =
+ (int) (codon_usage_algorithm.getFeatureScore (new_feature) * 50);
+
+ if (score < 0) {
+ score = 0;
+ }
+
+ if (score > 100) {
+ score = 100;
+ }
+
+ final String score_string = String.valueOf (score);
+ new_feature.addQualifierValues (new Qualifier ("score",
+ score_string));
+
+ final int var_colour = 255 - score * 5 / 2;
+ final String colour_string = var_colour + " " + var_colour + " 255";
+ new_feature.addQualifierValues (new Qualifier ("colour",
+ colour_string));
+ }
+
+ return new_feature;
+
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+
+ /**
+ * This method will ask the user for a BasePattern (using a TextRequester
+ * component) then search the sequence for the given pattern and make a new
+ * feature from each match. The new features will created in an Entry
+ * called "matches: <pattern>".
+ **/
+ private void makeFeaturesFromPattern () {
+ final TextRequester text_requester =
+ new TextRequester ("create features from this pattern:", 18, "");
+
+ text_requester.addTextRequesterListener (new TextRequesterListener () {
+ public void actionPerformed (final TextRequesterEvent event) {
+ final String pattern_string = event.getRequesterText ().trim ();
+
+ try {
+ if (pattern_string.length () == 0) {
+ new MessageDialog (getParentFrame (), "the pattern is too short");
+ return;
+ }
+
+ final BasePattern pattern = new BasePattern (pattern_string);
+
+ makeFeaturesFromPattern (pattern);
+ } catch (BasePatternFormatException e) {
+ new MessageDialog (getParentFrame (),
+ "Illegal base pattern: " +
+ pattern_string);
+ }
+ }
+ });
+
+ text_requester.show ();
+ }
+
+ /**
+ * Search the sequence for the given pattern and make a new feature from
+ * each match. The new features will created in an Entry called "matches:
+ * <pattern>".
+ **/
+ private void makeFeaturesFromPattern (final BasePattern pattern) {
+ final MarkerRangeVector matches =
+ pattern.findMatches (entry_group.getBases (),
+ null, // search from start
+ entry_group.getSequenceLength ());
+
+ if (matches.size () == 0) {
+ new MessageDialog (getParentFrame (),
+ "no matches found for: " + pattern);
+ return;
+ }
+
+ final int TOO_MANY_MATCHES = 100;
+
+ if (matches.size () > TOO_MANY_MATCHES) {
+ final YesNoDialog dialog =
+ new YesNoDialog (getParentFrame (),
+ matches.size () + " matches, continue?");
+
+ if (dialog.getResult ()) {
+ // yes - continue
+ } else {
+ // no
+ return;
+ }
+ }
+
+ final Entry new_entry = entry_group.createEntry ("matches: " + pattern);
+
+ final Key key = new_entry.getEntryInformation ().getDefaultKey ();
+
+ for (int i = 0 ; i < matches.size () ; ++i) {
+ try {
+ final Feature new_feature =
+ makeFeatureFromMarkerRange (new_entry, matches.elementAt (i), key);
+ new_feature.setQualifier (new Qualifier ("note", pattern.toString ()));
+ } catch (EntryInformationException e) {
+ new MessageDialog (getParentFrame (), "cannot continue: " +
+ e.getMessage ());
+ return;
+ } catch (ReadOnlyException e) {
+ new MessageDialog (getParentFrame (), "cannot continue: " +
+ "the default entry is read only");
+ return;
+ }
+ }
+ }
+
+ /**
+ * Create a misc_feature for each block of ambiguous bases. The new
+ * features will created in an Entry called "ambiguous bases".
+ **/
+ private void markAmbiguities () {
+ Entry new_entry = null;
+
+ final Bases bases = entry_group.getBases ();
+
+ for (int i = 1 ; i <= bases.getLength () ; ++i) {
+ try {
+ if (! Bases.isLegalBase (bases.getBaseAt (i))) {
+ final int start_index = i;
+
+ while (i < bases.getLength () &&
+ ! Bases.isLegalBase (bases.getBaseAt (i + 1))) {
+ ++i;
+ }
+
+ final int end_index = i;
+
+ if (new_entry == null) {
+ new_entry = entry_group.createEntry ("ambiguous bases");
+ }
+
+ final Range range = new Range (start_index, end_index);
+
+ final String unsure_bases =
+ bases.getSubSequence (range, Bases.FORWARD);
+
+ final Location location = new Location (range);
+
+ final QualifierVector qualifiers = new QualifierVector ();
+
+ qualifiers.setQualifier (new Qualifier ("note", unsure_bases));
+
+ final Feature feature =
+ new_entry.createFeature (new Key ("unsure"), location, qualifiers);
+ }
+ } catch (ReadOnlyException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (EntryInformationException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+
+ if (new_entry == null) {
+ new MessageDialog (getParentFrame (), "No ambiguities found");
+ } else {
+ if (new_entry.getFeatureCount () == 1) {
+ new MessageDialog (getParentFrame (), "Created one feature");
+
+ } else {
+ new MessageDialog (getParentFrame (), "Created " +
+ new_entry.getFeatureCount () + " features");
+
+ }
+ }
+ }
+
+ /**
+ * Return the GotoEventSource object that was passed to the constructor.
+ **/
+ private GotoEventSource getGotoEventSource () {
+ return goto_event_source;
+ }
+
+ /**
+ * The GotoEventSource object that was passed to the constructor.
+ **/
+ private GotoEventSource goto_event_source = null;
+
+ /**
+ * The EntryGroup object that was passed to the constructor.
+ **/
+ private EntryGroup entry_group;
+
+ private JMenuItem new_feature_item = null;
+ private JMenuItem new_entry_item = null;
+ private JMenuItem create_feature_from_range_item = null;
+ private JMenuItem create_intron_features_item = null;
+ private JMenuItem create_exon_features_item = null;
+ private JMenuItem create_gene_features_item = null;
+ private JMenuItem mark_orfs_with_size_item = null;
+ private JMenuItem mark_empty_orfs_with_size_item = null;
+ private JMenuItem mark_orfs_range_item = null;
+ private JMenuItem mark_pattern_item = null;
+ private JMenuItem mark_ambiguities_item = null;
+
+ private BasePlotGroup base_plot_group;
+}
diff --git a/uk/ac/sanger/artemis/components/AlignMatchViewer.java b/uk/ac/sanger/artemis/components/AlignMatchViewer.java
new file mode 100644
index 000000000..12297cff6
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/AlignMatchViewer.java
@@ -0,0 +1,366 @@
+/* AlignMatchViewer.java
+ *
+ * created: Tue Feb 13 2001
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/AlignMatchViewer.java,v 1.1 2004-06-09 09:45:58 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+import java.util.Comparator;
+import java.util.Collections;
+
+/**
+ * A component for viewing AlignMatchVectors selected in an AlignmentViewer.
+ *
+ * @author Kim Rutherford
+ * @version $Id: AlignMatchViewer.java,v 1.1 2004-06-09 09:45:58 tjc Exp $
+ **/
+
+public class AlignMatchViewer extends JFrame {
+ /**
+ * Create a new AlignMatchViewer which shows the given matches.
+ * @param alignment_viewer The AlignmentViewer to call alignAt () and
+ * setSelection () on when the user clicks on a match.
+ * @param matches The Vector of AlignMatch objects to show.
+ **/
+ public AlignMatchViewer (final AlignmentViewer alignment_viewer,
+ final AlignMatchVector matches) {
+ this.alignment_viewer = alignment_viewer;
+ this.matches = matches;
+
+ final JMenuBar menu_bar = new JMenuBar ();
+
+ final JMenu file_menu = new JMenu ("File");
+
+ final JMenuItem close = new JMenuItem ("Close");
+ close.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ setVisible (false);
+ AlignMatchViewer.this.dispose ();
+ }
+ });
+
+ file_menu.add (close);
+
+ menu_bar.add (file_menu);
+
+ final JMenu sort_menu = new JMenu ("Sort");
+
+ sort_menu.add (sort_by_score_menu_item);
+
+ sort_by_score_menu_item.addItemListener (new ItemListener () {
+ public void itemStateChanged(ItemEvent e) {
+ if (sort_by_score_menu_item.getState ()) {
+ sort_by_percent_id_menu_item.setState (false);
+ sort_by_query_start.setState (false);
+ sort_by_subject_start.setState (false);
+ }
+
+ setList ();
+ }
+ });
+
+ sort_menu.add (sort_by_percent_id_menu_item);
+
+ sort_by_percent_id_menu_item.addItemListener (new ItemListener () {
+ public void itemStateChanged(ItemEvent e) {
+ if (sort_by_percent_id_menu_item.getState ()) {
+ sort_by_score_menu_item.setState (false);
+ sort_by_query_start.setState (false);
+ sort_by_subject_start.setState (false);
+ }
+
+ setList ();
+ }
+ });
+
+ sort_menu.add (sort_by_query_start);
+
+ sort_by_query_start.addItemListener (new ItemListener () {
+ public void itemStateChanged(ItemEvent e) {
+ if (sort_by_query_start.getState ()) {
+ sort_by_percent_id_menu_item.setState (false);
+ sort_by_score_menu_item.setState (false);
+ sort_by_subject_start.setState (false);
+ }
+
+ setList ();
+ }
+ });
+
+ sort_menu.add (sort_by_subject_start);
+
+ sort_by_subject_start.addItemListener (new ItemListener () {
+ public void itemStateChanged(ItemEvent e) {
+ if (sort_by_subject_start.getState ()) {
+ sort_by_percent_id_menu_item.setState (false);
+ sort_by_score_menu_item.setState (false);
+ sort_by_query_start.setState (false);
+ }
+
+ setList ();
+ }
+ });
+
+ menu_bar.add (sort_menu);
+
+ setJMenuBar (menu_bar);
+
+ list = new List ();
+
+ list.setBackground (Color.white);
+
+ getContentPane ().add (list, "Center");
+
+ final JPanel panel = new JPanel ();
+
+ final JButton close_button = new JButton ("Close");
+
+ panel.add (close_button);
+ close_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ AlignMatchViewer.this.dispose ();
+ }
+ });
+
+ close_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ AlignMatchViewer.this.dispose ();
+ }
+ });
+
+ getContentPane ().add (panel, "South");
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ AlignMatchViewer.this.dispose ();
+ }
+ });
+
+ pack ();
+
+ setList ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+
+ int screen_height = screen.height;
+ int screen_width = screen.width;
+
+ if (screen_height <= 600) {
+ setSize (350, screen_height * 9 / 10);
+ } else {
+ setSize (350, screen_height - 200);
+ }
+
+ setLocation (new Point (screen.width - getSize ().width - 5,
+ (screen.height - getSize ().height) / 2));
+ }
+
+ /**
+ * Sort the matches depending on the setting of sort_by_score_menu_item and
+ * sort_by_percent_id_menu_item.
+ **/
+ private AlignMatchVector getSortedMatches () {
+ final AlignMatchVector matches_copy = (AlignMatchVector) matches.clone ();
+
+ final Comparator comparator;
+
+ if (sort_by_score_menu_item.getState ()) {
+ comparator =
+ new Comparator () {
+ public int compare (Object fst, Object snd) {
+ final int fst_score = ((AlignMatch) fst).getScore ();
+ final int snd_score = ((AlignMatch) snd).getScore ();
+
+ if (fst_score < snd_score) {
+ return 1;
+ } else {
+ if (fst_score > snd_score) {
+ return -1;
+ } else {
+ return 0;
+ }
+ }
+ }
+ };
+ } else {
+ if (sort_by_percent_id_menu_item.getState ()) {
+ comparator =
+ new Comparator () {
+ public int compare (Object fst, Object snd) {
+ final int fst_value = ((AlignMatch) fst).getPercentID ();
+ final int snd_value = ((AlignMatch) snd).getPercentID ();
+
+ if (fst_value < snd_value) {
+ return 1;
+ } else {
+ if (fst_value > snd_value) {
+ return -1;
+ } else {
+ return 0;
+ }
+ }
+ }
+ };
+ } else {
+ if (sort_by_query_start.getState ()) {
+ comparator =
+ new Comparator () {
+ public int compare (Object fst, Object snd) {
+ final int fst_value =
+ ((AlignMatch) fst).getQuerySequenceStart ();
+ final int snd_value =
+ ((AlignMatch) snd).getQuerySequenceStart ();
+
+ if (fst_value > snd_value) {
+ return 1;
+ } else {
+ if (fst_value < snd_value) {
+ return -1;
+ } else {
+ return 0;
+ }
+ }
+ }
+ };
+ } else {
+ if (sort_by_subject_start.getState ()) {
+ comparator =
+ new Comparator () {
+ public int compare (Object fst, Object snd) {
+ final int fst_value =
+ ((AlignMatch) fst).getSubjectSequenceStart ();
+ final int snd_value =
+ ((AlignMatch) snd).getSubjectSequenceStart ();
+
+ if (fst_value > snd_value) {
+ return 1;
+ } else {
+ if (fst_value < snd_value) {
+ return -1;
+ } else {
+ return 0;
+ }
+ }
+ }
+ };
+ } else {
+ return matches;
+ }
+ }
+ }
+ }
+
+ matches_copy.sort (comparator);
+
+ return matches_copy;
+ }
+
+ /**
+ * Clear the List and then fill it with the matches in the order
+ **/
+ private void setList () {
+ final AlignMatchVector sorted_matches = getSortedMatches ();
+
+ list.setEnabled (false);
+ list.setVisible (false);
+ list.removeAll ();
+
+ for (int i = 0 ; i < sorted_matches.size () ; ++i) {
+ final AlignMatch this_align_match = sorted_matches.elementAt (i);
+
+ String match_string =
+ this_align_match.getQuerySequenceStart () + ".." +
+ this_align_match.getQuerySequenceEnd () + " -> " +
+ this_align_match.getSubjectSequenceStart () + ".." +
+ this_align_match.getSubjectSequenceEnd () + " " +
+ (this_align_match.isRevMatch () ? "rev " : "") +
+ this_align_match.getPercentID () + "% id score " +
+ this_align_match.getScore ();
+
+ list.add (match_string);
+ }
+
+ list.addItemListener (new ItemListener () {
+ public void itemStateChanged (final ItemEvent _) {
+ final int item_number = list.getSelectedIndex ();
+
+ final AlignMatch selected_match = matches.elementAt (item_number);
+
+ alignment_viewer.setSelection (selected_match);
+ alignment_viewer.alignAt (selected_match);
+ }
+ });
+
+ list.setEnabled (true);
+ list.setVisible (true);
+ }
+
+ /**
+ * The AlignmentViewer to call alignAt () and setSelection () on when the
+ * user clicks on a match.
+ **/
+ private AlignmentViewer alignment_viewer = null;
+
+ /**
+ * The Vector of AlignMatch objects that was passed to the constructor.
+ **/
+ private AlignMatchVector matches = null;
+
+ /**
+ * The list that contains the matches.
+ **/
+ private List list;
+
+ /**
+ * If selected the list items will be sorted by score.
+ **/
+ private JCheckBoxMenuItem sort_by_score_menu_item =
+ new JCheckBoxMenuItem ("Sort by Score");
+
+ /**
+ * If selected the list items will be sorted by percent identity.
+ **/
+ private JCheckBoxMenuItem sort_by_percent_id_menu_item =
+ new JCheckBoxMenuItem ("Sort by Percent Identity");
+
+ /**
+ * If selected the list items will be sorted by the start position of the
+ * query.
+ **/
+ private JCheckBoxMenuItem sort_by_query_start =
+ new JCheckBoxMenuItem ("Sort by Hit Query Start");
+
+ /**
+ * If selected the list items will be sorted by the start position of the
+ * subject.
+ **/
+ private JCheckBoxMenuItem sort_by_subject_start =
+ new JCheckBoxMenuItem ("Sort by Hit Subject start");
+}
diff --git a/uk/ac/sanger/artemis/components/AlignmentEvent.java b/uk/ac/sanger/artemis/components/AlignmentEvent.java
new file mode 100644
index 000000000..0cbf0e2f0
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/AlignmentEvent.java
@@ -0,0 +1,57 @@
+/* AlignmentEvent.java
+ *
+ * created: Mon Sep 10 2001
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/AlignmentEvent.java,v 1.1 2004-06-09 09:45:59 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+/**
+ * This event is generated when an AlignmentViewer centres on a particular
+ * AlignMatch.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: AlignmentEvent.java,v 1.1 2004-06-09 09:45:59 tjc Exp $
+ **/
+
+public class AlignmentEvent {
+ /**
+ * Create a new AlignmentEvent and store the given AlignMatch.
+ **/
+ public AlignmentEvent (AlignMatch match) {
+ this.match = match;
+ }
+
+ /**
+ * Return the AlignMatch that was passed to the constructor.
+ **/
+ public AlignMatch getMatch () {
+ return match;
+ }
+
+ /**
+ * The AlignMatch that was passed to the constructor.
+ **/
+ final private AlignMatch match;
+}
diff --git a/uk/ac/sanger/artemis/components/AlignmentListener.java b/uk/ac/sanger/artemis/components/AlignmentListener.java
new file mode 100644
index 000000000..30618170f
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/AlignmentListener.java
@@ -0,0 +1,43 @@
+/* AlignmentListener.java
+ *
+ * created: Mon Sep 10 2001
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/AlignmentListener.java,v 1.1 2004-06-09 09:46:00 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+/**
+ * This interface is implemented by those objects that wish to know when an
+ * AlignmentViewer centres on a particular AlignMatch
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: AlignmentListener.java,v 1.1 2004-06-09 09:46:00 tjc Exp $
+ **/
+
+public interface AlignmentListener {
+ /**
+ * Called when an AlignmentViewer centres on a particular AlignMatch. The
+ * Comparator component implements this so that it can scroll the
+ * FeatureDisplay components appropriately.
+ **/
+ public void alignMatchChosen (AlignmentEvent e);
+}
diff --git a/uk/ac/sanger/artemis/components/AlignmentViewer.java b/uk/ac/sanger/artemis/components/AlignmentViewer.java
new file mode 100644
index 000000000..b53ca88e1
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/AlignmentViewer.java
@@ -0,0 +1,1604 @@
+/* AlignmentViewer.java
+ *
+ * created: Mon Jul 12 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999,2000,2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/AlignmentViewer.java,v 1.1 2004-06-09 09:46:01 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import uk.ac.sanger.artemis.util.OutOfRangeException;
+import uk.ac.sanger.artemis.util.StringVector;
+import uk.ac.sanger.artemis.io.Range;
+import uk.ac.sanger.artemis.io.RangeVector;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * This component shows an alignment of two sequences using the data from a
+ * ComparisonData object.
+ *
+ * @author Kim Rutherford
+ * @version $Id: AlignmentViewer.java,v 1.1 2004-06-09 09:46:01 tjc Exp $
+ **/
+
+public class AlignmentViewer extends CanvasPanel
+ implements SequenceChangeListener {
+ /**
+ * Create a new AlignmentViewer for the given entries.
+ * @param subject_feature_display The FeatureDisplay that is above this
+ * component.
+ * @param query_feature_display The FeatureDisplay that is below this
+ * component.
+ * @param comparison_data Provides the AlignMatch objects that will be
+ * displayed.
+ **/
+ public AlignmentViewer (final FeatureDisplay subject_feature_display,
+ final FeatureDisplay query_feature_display,
+ final ComparisonData comparison_data) {
+ this.subject_feature_display = subject_feature_display;
+ this.query_feature_display = query_feature_display;
+ this.comparison_data = comparison_data;
+ this.all_matches = getComparisonData ().getMatches ();
+
+ subject_entry_group = getSubjectDisplay ().getEntryGroup ();
+ query_entry_group = getQueryDisplay ().getEntryGroup ();
+
+ final Bases subject_bases = getSubjectForwardStrand ().getBases ();
+ final Bases query_bases = getQueryForwardStrand ().getBases ();
+
+ final Selection subject_selection = getSubjectDisplay ().getSelection ();
+ final Selection query_selection = getQueryDisplay ().getSelection ();
+
+ final SelectionChangeListener subject_listener =
+ new SelectionChangeListener () {
+ public void selectionChanged (SelectionChangeEvent event) {
+ final RangeVector ranges = subject_selection.getSelectionRanges ();
+ selectFromSubjectRanges (ranges);
+ }
+ };
+
+ final SelectionChangeListener query_listener =
+ new SelectionChangeListener () {
+ public void selectionChanged (SelectionChangeEvent event) {
+ final RangeVector ranges = query_selection.getSelectionRanges ();
+ selectFromQueryRanges (ranges);
+ }
+ };
+
+ makeColours ();
+
+ subject_selection.addSelectionChangeListener (subject_listener);
+ query_selection.addSelectionChangeListener (query_listener);
+
+ subject_bases.addSequenceChangeListener (this, 0);
+ query_bases.addSequenceChangeListener (this, 0);
+
+ orig_subject_forward_strand = getSubjectForwardStrand ();
+ orig_query_forward_strand = getQueryForwardStrand ();
+
+ getCanvas ().addMouseListener (new MouseAdapter () {
+ public void mousePressed (final MouseEvent event) {
+ // on windows we have to check isPopupTrigger in mouseReleased(),
+ // but do it in mousePressed() on UNIX
+ if (isMenuTrigger (event)) {
+ popupMenu (event);
+ } else {
+ handleCanvasMousePress (event);
+ }
+ }
+ });
+
+ getCanvas ().addMouseMotionListener (new MouseMotionAdapter () {
+ public void mouseDragged (final MouseEvent event) {
+ if (!modifiersForLockToggle (event)) {
+ if (!event.isShiftDown ()) {
+ selected_matches = null;
+ toggleSelection (event.getPoint ());
+ }
+ repaintCanvas ();
+ }
+ }
+ });
+
+ scroll_bar = new JScrollBar (Scrollbar.VERTICAL);
+ scroll_bar.setValues (1, 1, 1, 1000);
+ scroll_bar.setBlockIncrement (10);
+
+ scroll_bar.addAdjustmentListener (new AdjustmentListener () {
+ public void adjustmentValueChanged(AdjustmentEvent e) {
+ repaintCanvas ();
+ }
+ });
+
+ maximum_score = getComparisonData ().getMaximumScore ();
+
+ add (scroll_bar, "East");
+ }
+
+ /**
+ * Returns true if and only if the given MouseEvent should toggle the lock
+ * displays toggle.
+ **/
+ private boolean modifiersForLockToggle (final MouseEvent event) {
+ return (event.getModifiers () & InputEvent.BUTTON2_MASK) != 0 ||
+ event.isAltDown ();
+ }
+
+ /**
+ * Select those matches that overlap the given range on the subject
+ * sequence.
+ **/
+ public void selectFromSubjectRanges (final RangeVector select_ranges) {
+ if (disable_selection_from_ranges) {
+ return;
+ }
+
+ selected_matches = null;
+
+ for (int range_index = 0 ;
+ range_index < select_ranges.size () ;
+ ++range_index) {
+
+ final Range select_range = select_ranges.elementAt (range_index);
+
+ for (int match_index = 0 ;
+ match_index < all_matches.length ;
+ ++match_index) {
+ final AlignMatch this_match = all_matches [match_index];
+
+ if (!isVisible (this_match)) {
+ // not visible
+ continue;
+ }
+
+ final Strand current_subject_forward_strand =
+ getSubjectForwardStrand ();
+
+ final int subject_length =
+ current_subject_forward_strand.getSequenceLength ();
+
+ int subject_sequence_start =
+ getRealSubjectSequenceStart (this_match,
+ subject_length,
+ (getOrigSubjectForwardStrand () !=
+ current_subject_forward_strand));
+ int subject_sequence_end =
+ getRealSubjectSequenceEnd (this_match,
+ subject_length,
+ (getOrigSubjectForwardStrand () !=
+ current_subject_forward_strand));
+
+ if (subject_sequence_end < subject_sequence_start) {
+ final int tmp = subject_sequence_start;
+ subject_sequence_start = subject_sequence_end;
+ subject_sequence_end = tmp;
+ }
+
+ if (select_range.getStart () < subject_sequence_start &&
+ select_range.getEnd () < subject_sequence_start) {
+ continue;
+ }
+
+ if (select_range.getStart () > subject_sequence_end &&
+ select_range.getEnd () > subject_sequence_end) {
+ continue;
+ }
+
+ if (selected_matches == null) {
+ selected_matches = new AlignMatchVector ();
+ }
+
+ if (!selected_matches.contains (this_match)) {
+ selected_matches.add (this_match);
+ }
+ }
+ }
+
+ selectionChanged ();
+ }
+
+ /**
+ * Select those matches that overlap the given range on the query sequence.
+ **/
+ public void selectFromQueryRanges (final RangeVector select_ranges) {
+ if (disable_selection_from_ranges) {
+ return;
+ }
+
+ selected_matches = null;
+
+ for (int range_index = 0 ;
+ range_index < select_ranges.size () ;
+ ++range_index) {
+
+ final Range select_range = select_ranges.elementAt (range_index);
+
+ for (int match_index = 0 ;
+ match_index < all_matches.length ;
+ ++match_index) {
+ final AlignMatch this_match = all_matches [match_index];
+
+ if (!isVisible (this_match)) {
+ // not visible
+ continue;
+ }
+
+ final Strand current_query_forward_strand = getQueryForwardStrand ();
+
+ final int query_length =
+ current_query_forward_strand.getSequenceLength ();
+
+ int query_sequence_start =
+ getRealQuerySequenceStart (this_match,
+ query_length,
+ (getOrigQueryForwardStrand () !=
+ current_query_forward_strand));
+ int query_sequence_end =
+ getRealQuerySequenceEnd (this_match,
+ query_length,
+ (getOrigQueryForwardStrand () !=
+ current_query_forward_strand));
+
+ if (query_sequence_end < query_sequence_start) {
+ final int tmp = query_sequence_start;
+ query_sequence_start = query_sequence_end;
+ query_sequence_end = tmp;
+ }
+
+ if (select_range.getStart () < query_sequence_start &&
+ select_range.getEnd () < query_sequence_start) {
+ continue;
+ }
+
+ if (select_range.getStart () > query_sequence_end &&
+ select_range.getEnd () > query_sequence_end) {
+ continue;
+ }
+
+ if (selected_matches == null) {
+ selected_matches = new AlignMatchVector ();
+ }
+
+ if (!selected_matches.contains (this_match)) {
+ selected_matches.add (this_match);
+ }
+ }
+ }
+
+ selectionChanged ();
+ }
+
+ /**
+ * Select the given match and move it to the top of the display.
+ **/
+ public void setSelection (final AlignMatch match) {
+ selected_matches = new AlignMatchVector ();
+
+ selected_matches.add (match);
+
+ selectionChanged ();
+ }
+
+ /**
+ * This method tells this AlignmentViewer component where the subject
+ * sequence is now.
+ **/
+ public void setSubjectSequencePosition (final DisplayAdjustmentEvent event) {
+ last_subject_event = event;
+ repaintCanvas ();
+ }
+
+ /**
+ * This method tells this AlignmentViewer component where the query
+ * sequence is now.
+ **/
+ public void setQuerySequencePosition (final DisplayAdjustmentEvent event) {
+ last_query_event = event;
+ repaintCanvas ();
+ }
+
+ /**
+ * Implementation of the SequenceChangeListener interface. The display is
+ * redrawn if there is an event.
+ **/
+ public void sequenceChanged (final SequenceChangeEvent event) {
+ repaintCanvas ();
+ }
+
+ /**
+ * Return true if and only if the given MouseEvent (a mouse press) should
+ * pop up a JPopupMenu.
+ **/
+ private boolean isMenuTrigger (final MouseEvent event) {
+ if (event.isPopupTrigger () ||
+ (event.getModifiers () & InputEvent.BUTTON3_MASK) != 0) {
+ return true;
+ } else {
+ return false;
+ }
+ }
+
+ /**
+ * Popup a menu.
+ **/
+ private void popupMenu (final MouseEvent event) {
+ final JPopupMenu popup = new JPopupMenu ();
+
+ final JMenuItem alignmatch_list_item =
+ new JMenuItem ("View Selected Matches");
+
+ popup.add (alignmatch_list_item);
+
+ alignmatch_list_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent _) {
+ if (selected_matches == null) {
+ new MessageFrame ("No matches selected").setVisible (true);
+ } else {
+ final AlignMatchVector matches =
+ (AlignMatchVector) selected_matches.clone ();
+
+ final AlignMatchViewer viewer =
+ new AlignMatchViewer (AlignmentViewer.this, matches);
+
+ viewer.setVisible (true);
+ }
+ }
+ });
+
+ final JMenuItem flip_subject_item =
+ new JMenuItem ("Flip Subject Sequence");
+
+ popup.add (flip_subject_item);
+
+ flip_subject_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent _) {
+ if (getSubjectDisplay ().isRevCompDisplay ()) {
+ getSubjectDisplay ().setRevCompDisplay (false);
+ } else {
+ getSubjectDisplay ().setRevCompDisplay (true);
+ }
+ }
+ });
+
+ final JMenuItem flip_query_item =
+ new JMenuItem ("Flip Query Sequence");
+
+ popup.add (flip_query_item);
+
+ flip_query_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent _) {
+ if (getQueryDisplay ().isRevCompDisplay ()) {
+ getQueryDisplay ().setRevCompDisplay (false);
+ } else {
+ getQueryDisplay ().setRevCompDisplay (true);
+ }
+ }
+ });
+
+ final JMenuItem lock_item = new JMenuItem ("Lock Sequences");
+
+ popup.add (lock_item);
+
+ lock_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent _) {
+ lockDisplays ();
+ }
+ });
+
+ final JMenuItem unlock_item = new JMenuItem ("Unlock Sequences");
+
+ popup.add (unlock_item);
+
+ unlock_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent _) {
+ unlockDisplays ();
+ }
+ });
+
+ final JMenuItem cutoffs_item = new JMenuItem ("Set Score Cutoffs ...");
+
+ popup.add (cutoffs_item);
+
+ cutoffs_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent _) {
+ final ScoreChangeListener minimum_listener =
+ new ScoreChangeListener () {
+ public void scoreChanged (final ScoreChangeEvent event) {
+ minimum_score = event.getValue ();
+ repaintCanvas ();
+ }
+ };
+
+ final ScoreChangeListener maximum_listener =
+ new ScoreChangeListener () {
+ public void scoreChanged (final ScoreChangeEvent event) {
+ maximum_score = event.getValue ();
+ repaintCanvas ();
+ }
+ };
+
+ final ScoreChanger score_changer =
+ new ScoreChanger ("Score Cutoffs",
+ minimum_listener, maximum_listener,
+ getComparisonData ().getMinimumScore (),
+ getComparisonData ().getMaximumScore ());
+
+ score_changer.setVisible (true);
+ }
+ });
+
+ final JMenuItem percent_id_cutoffs_item =
+ new JMenuItem ("Set Percent ID Cutoffs ...");
+
+ popup.add (percent_id_cutoffs_item);
+
+ percent_id_cutoffs_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent _) {
+ final ScoreChangeListener minimum_listener =
+ new ScoreChangeListener () {
+ public void scoreChanged (final ScoreChangeEvent event) {
+ minimum_percent_id = event.getValue ();
+ repaintCanvas ();
+ }
+ };
+
+ final ScoreChangeListener maximum_listener =
+ new ScoreChangeListener () {
+ public void scoreChanged (final ScoreChangeEvent event) {
+ maximum_percent_id = event.getValue ();
+ repaintCanvas ();
+ }
+ };
+
+ final ScoreChanger score_changer =
+ new ScoreChanger ("Percent Identity Cutoffs",
+ minimum_listener, maximum_listener,
+ 0, 100);
+
+ score_changer.setVisible (true);
+ }
+ });
+
+ popup.addSeparator ();
+
+ final JCheckBoxMenuItem offer_to_flip_item =
+ new JCheckBoxMenuItem ("Offer To RevComp", offer_to_flip_flag);
+
+ offer_to_flip_item.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent e) {
+ offer_to_flip_flag = !offer_to_flip_flag;
+ }
+ });
+
+ popup.add (offer_to_flip_item);
+
+ final JCheckBoxMenuItem ignore_self_match_item =
+ new JCheckBoxMenuItem ("Ignore Self Matches");
+
+ ignore_self_match_item.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent event) {
+ ignore_self_match_flag = ignore_self_match_item.getState ();
+ repaintCanvas ();
+ }
+ });
+
+ ignore_self_match_item.setState (ignore_self_match_flag);
+
+ popup.add (ignore_self_match_item);
+
+ getCanvas ().add (popup);
+ popup.show (getCanvas (), event.getX (), event.getY ());
+ }
+
+
+ /**
+ * Handle a mouse press event on the drawing canvas - select on click,
+ * select and broadcast it on double click.
+ **/
+ private void handleCanvasMousePress (final MouseEvent event) {
+ if (event.getID() != MouseEvent.MOUSE_PRESSED) {
+ return;
+ }
+
+ if (event.getClickCount () == 2) {
+ handleCanvasDoubleClick (event);
+ } else {
+ handleCanvasSingleClick (event);
+ }
+
+ repaintCanvas ();
+ }
+
+ /**
+ * Handle a double click on the canvas.
+ **/
+ private void handleCanvasDoubleClick (final MouseEvent event) {
+ if (selected_matches != null) {
+ // there should be only one match in the array because
+ // handleCanvasSingleClick () has been called
+ alignAt (selected_matches.elementAt (0));
+ }
+ }
+
+ /**
+ * Send an AlignmentEvent to all the AlignmentListeners.
+ * @param align_match The AlignMatch that we have just centred on.
+ **/
+ public void alignAt (final AlignMatch align_match) {
+ final java.util.Vector targets;
+ // copied from a book - synchronizing the whole method might cause a
+ // deadlock
+ synchronized (this) {
+ targets = (java.util.Vector) alignment_event_listeners.clone ();
+ }
+
+ for (int i = 0 ; i < targets.size () ; ++i) {
+ final AlignmentListener listener =
+ (AlignmentListener) targets.elementAt (i);
+
+ listener.alignMatchChosen (new AlignmentEvent (align_match));
+ }
+ }
+
+ /**
+ * Handle a single click on the canvas.
+ **/
+ private void handleCanvasSingleClick (final MouseEvent event) {
+ if (modifiersForLockToggle (event)) {
+ toggleDisplayLock ();
+ } else {
+ if (!event.isShiftDown ()) {
+ selected_matches = null;
+ }
+ toggleSelection (event.getPoint ());
+ }
+ }
+
+ /**
+ * Add or remove the match at the given mouse position to the selection.
+ **/
+ private void toggleSelection (final Point point) {
+ final AlignMatch clicked_align_match =
+ getAlignMatchFromPosition (point);
+
+ if (clicked_align_match != null) {
+ if (selected_matches == null) {
+ selected_matches = new AlignMatchVector ();
+ selected_matches.add (clicked_align_match);
+ } else {
+ if (selected_matches.contains (clicked_align_match)) {
+ selected_matches.remove (clicked_align_match);
+ if (selected_matches.size () == 0) {
+ selected_matches = null;
+ }
+ } else {
+ selected_matches.add (clicked_align_match);
+ }
+ }
+
+ }
+
+ selectionChanged ();
+ }
+
+ /**
+ * Return the AlignMatch at the given Point on screen or null if there is
+ * no match at that point. The alignment_data_array is searched in reverse
+ * order.
+ **/
+ private AlignMatch getAlignMatchFromPosition (final Point click_point) {
+ final int canvas_height = getCanvas ().getSize ().height;
+ final int canvas_width = getCanvas ().getSize ().width;
+
+ for (int i = all_matches.length - 1 ; i >= 0 ; --i) {
+ final AlignMatch this_match = all_matches [i];
+
+ final int [] match_x_positions =
+ getMatchCoords (canvas_width, this_match);
+
+ if (match_x_positions == null) {
+ continue;
+ }
+
+ if (!isVisible (this_match)) {
+ continue;
+ }
+
+ final int subject_start_x = match_x_positions[0];
+ final int subject_end_x = match_x_positions[1];
+ final int query_start_x = match_x_positions[2];
+ final int query_end_x = match_x_positions[3];
+
+ // this is the x coordinate of the point where the line y = click_point
+ // hits the left edge of the match box
+ final double match_left_x =
+ subject_start_x +
+ (1.0 * (query_start_x - subject_start_x)) *
+ (1.0 * click_point.y / canvas_height);
+
+ // this is the x coordinate of the point where the line y = click_point
+ // hits the right edge of the match box
+ final double match_right_x =
+ subject_end_x +
+ (1.0 * (query_end_x - subject_end_x)) *
+ (1.0 * click_point.y / canvas_height);
+
+ if (click_point.x >= match_left_x - 1 &&
+ click_point.x <= match_right_x + 1 ||
+ click_point.x <= match_left_x + 1 &&
+ click_point.x >= match_right_x - 1) {
+ return this_match;
+ }
+ }
+
+ return null;
+ }
+
+ /**
+ * This method is called by setSelection () and others whenever the list of
+ * selected/highlighted hits changes. Calls alignmentSelectionChanged ()
+ * on all interested AlignmentSelectionChangeListener objects, moves the
+ * selected matches to the top of the display and then calls
+ * repaintCanvas ().
+ **/
+ private void selectionChanged () {
+ for (int i = 0 ; i < selection_change_listeners.size () ; ++i) {
+ final AlignMatchVector matches =
+ (AlignMatchVector) selected_matches.clone ();
+
+ final AlignmentSelectionChangeEvent ev =
+ new AlignmentSelectionChangeEvent (this, matches);
+
+ final AlignmentSelectionChangeListener listener =
+ (AlignmentSelectionChangeListener) selection_change_listeners.elementAt (i);
+
+ listener.alignmentSelectionChanged (ev);
+ }
+
+ if (selected_matches != null && selected_matches.size () > 0) {
+ // a count of the number of selected matches seen so far
+ int seen_and_selected_count = 0;
+
+ for (int i = 0 ; i < all_matches.length ; ++i) {
+ final AlignMatch this_match = all_matches[i];
+
+ if (selected_matches.contains (this_match)) {
+ ++seen_and_selected_count;
+ } else {
+ if (seen_and_selected_count > 0) {
+ // move the matches down to fill the gap
+ all_matches[i-seen_and_selected_count] = all_matches[i];
+ }
+ }
+ }
+
+ // put the selected_matches at the end of all_matches
+ for (int i = 0 ; i < selected_matches.size () ; ++i) {
+ all_matches[all_matches.length - selected_matches.size () + i] =
+ selected_matches.elementAt (i);
+ }
+ }
+
+ repaintCanvas ();
+ }
+
+ /**
+ * Add the AlignmentSelectionChangeListener to the list of objects
+ * listening for AlignmentSelectionChangeEvents.
+ **/
+ public void
+ addAlignmentSelectionChangeListener (final AlignmentSelectionChangeListener l) {
+ selection_change_listeners.addElement (l);
+ }
+
+ /**
+ * Remove the AlignmentSelectionChangeListener from the list of objects
+ * listening for AlignmentSelectionChangeEvents.
+ **/
+ public void
+ removeAlignmentSelectionChangeListener (final AlignmentSelectionChangeListener l) {
+ selection_change_listeners.removeElement (l);
+ }
+
+ /**
+ * Adds the specified AlignmentEvent listener to receive events from this
+ * object.
+ * @param l the listener.
+ **/
+ public void addAlignmentListener (AlignmentListener l) {
+ alignment_event_listeners.addElement (l);
+ }
+
+ /**
+ * Removes the specified AlignmentEvent listener so that it no longer
+ * receives events from this object.
+ * @param l the listener.
+ **/
+ public void removeAlignmentListener (AlignmentListener l) {
+ alignment_event_listeners.removeElement (l);
+ }
+
+ /**
+ * Returns true if and only if we should offer to flip the query
+ * sequence when the user double clicks on a flipped match.
+ **/
+ public boolean offerToFlip () {
+ return offer_to_flip_flag;
+ }
+
+ /**
+ * The main paint function for the canvas. An off screen image used for
+ * double buffering when drawing the canvas.
+ * @param g The Graphics object of the canvas.
+ **/
+ protected void paintCanvas (final Graphics g) {
+ fillBackground (g);
+
+ if (last_subject_event != null && last_query_event != null) {
+ drawAlignments (g);
+ drawLabels (g);
+ }
+ }
+
+ /**
+ * Draw the background colour of the frames.
+ **/
+ private void fillBackground (final Graphics g) {
+ g.setColor (Color.white);
+
+ g.fillRect (0, 0, getCanvas ().getSize ().width,
+ getCanvas ().getSize ().height);
+ }
+
+ /**
+ * Draw the labels into the given Graphics object. There is a label at the
+ * top left showing info about the current AlignMatch object,
+ *
+ * XXX
+ * a label at
+ * the bottom left showing whether or not the query sequence is reverse
+ * complemented
+ * XXX
+ *
+ * and a label beside the Scrollbar showing the current score
+ * cutoff.
+ **/
+ private void drawLabels (final Graphics g) {
+ final FontMetrics fm = g.getFontMetrics ();
+ final int canvas_width = getCanvas ().getSize ().width;
+ final int canvas_height = getCanvas ().getSize ().height;
+
+ final String cutoff_label =
+ Integer.toString (scroll_bar.getValue ());
+
+ final int cutoff_label_width = fm.stringWidth (cutoff_label);
+
+ int cutoff_label_position =
+ (int)((scroll_bar.getValue () -
+ scroll_bar.getMinimum ()) / (1.0 *
+ (scroll_bar.getMaximum () -
+ scroll_bar.getMinimum ())) * canvas_height);
+
+ if (cutoff_label_position < getFontAscent ()) {
+ cutoff_label_position = getFontAscent ();
+ }
+
+
+ final int [] cutoff_x_points = {
+ canvas_width - cutoff_label_width,
+ canvas_width - 2,
+ canvas_width - 2,
+ canvas_width - cutoff_label_width,
+ };
+
+ final int [] cutoff_y_points = {
+ cutoff_label_position + 1,
+ cutoff_label_position + 1,
+ cutoff_label_position - getFontAscent (),
+ cutoff_label_position - getFontAscent (),
+ };
+
+ g.setColor (Color.white);
+ g.fillPolygon (cutoff_x_points, cutoff_y_points, 4);
+
+ g.setColor (Color.black);
+
+ g.drawString (cutoff_label, canvas_width - cutoff_label_width,
+ cutoff_label_position);
+
+ final int font_height = getFontAscent () + getFontDescent ();
+
+ if (selected_matches != null) {
+ final String match_string_1;
+
+ if (selected_matches.size () > 1) {
+ match_string_1 = selected_matches.size () + " matches selected";
+ } else {
+ final AlignMatch selected_align_match = selected_matches.elementAt (0);
+
+ match_string_1 =
+ selected_align_match.getQuerySequenceStart () + ".." +
+ selected_align_match.getQuerySequenceEnd () + " -> " +
+ selected_align_match.getSubjectSequenceStart () + ".." +
+ selected_align_match.getSubjectSequenceEnd ();
+ }
+
+ final int match_string_1_width = fm.stringWidth (match_string_1);
+
+ final int [] match_1_x_points = {
+ 0, 0, match_string_1_width, match_string_1_width
+ };
+
+ final int [] match_1_y_points = {
+ 0, font_height, font_height, 0
+ };
+
+ g.setColor (Color.white);
+ g.fillPolygon (match_1_x_points, match_1_y_points, 4);
+
+ g.setColor (Color.black);
+ g.drawString (match_string_1, 0, getFontAscent ());
+
+ if (selected_matches.size () == 1) {
+ final AlignMatch selected_align_match = selected_matches.elementAt (0);
+
+ final String match_string_2 = "score: " +
+ selected_align_match.getScore () + " percent id: " +
+ selected_align_match.getPercentID () + "%";
+
+ final int match_string_2_width = fm.stringWidth (match_string_2);
+
+ final int [] match_2_x_points = {
+ 0, 0, match_string_2_width, match_string_2_width
+ };
+
+ final int [] match_2_y_points = {
+ font_height, font_height * 2, font_height * 2, font_height
+ };
+
+ g.setColor (Color.white);
+ g.fillPolygon (match_2_x_points, match_2_y_points, 4);
+
+ g.setColor (Color.black);
+ g.drawString (match_string_2, 0, getFontAscent () + font_height);
+ }
+ }
+
+ final StringVector status_strings = new StringVector ();
+
+ if (displaysAreLocked ()) {
+ status_strings.add ("LOCKED");
+ }
+
+ if (getSubjectDisplay ().isRevCompDisplay ()) {
+ status_strings.add ("Subject: Flipped");
+ }
+
+ if (getQueryDisplay ().isRevCompDisplay ()) {
+ status_strings.add ("Query: Flipped");
+ }
+
+ if (getOrigSubjectForwardStrand () != getSubjectForwardStrand ()) {
+ status_strings.add ("Subject: Reverse Complemented");
+ }
+
+ if (getOrigQueryForwardStrand () != getQueryForwardStrand ()) {
+ status_strings.add ("Query: Reverse Complemented");
+ }
+
+ g.setColor (Color.white);
+
+ for (int i = 0 ; i < status_strings.size () ; ++i) {
+ final String status_string = status_strings.elementAt (i);
+
+ final int status_string_width = fm.stringWidth (status_string);
+
+ final int [] x_points = {
+ 0, 0, status_string_width, status_string_width
+ };
+
+ final int string_offset = font_height * (status_strings.size () - i - 1);
+
+ final int [] y_points = {
+ canvas_height - string_offset,
+ canvas_height - font_height - string_offset,
+ canvas_height - font_height - string_offset,
+ canvas_height - string_offset
+ };
+
+ g.fillPolygon (x_points, y_points, 4);
+ }
+
+ g.setColor (Color.black);
+
+ for (int i = 0 ; i < status_strings.size () ; ++i) {
+ final String status_string = status_strings.elementAt (i);
+
+ final int string_offset = font_height * (status_strings.size () - i - 1);
+
+ g.drawString (status_string, 0,
+ canvas_height - string_offset - getFontDescent ());
+ }
+ }
+
+ /**
+ * Draw the alignments into the given Graphics object.
+ **/
+ private void drawAlignments (final Graphics g) {
+ final int canvas_height = getCanvas ().getSize ().height;
+ final int canvas_width = getCanvas ().getSize ().width;
+
+ for (int i = 0 ; i < all_matches.length ; ++i) {
+ final AlignMatch this_match = all_matches [i];
+
+ final int [] match_x_positions =
+ getMatchCoords (canvas_width, this_match);
+
+ if (match_x_positions == null) {
+ continue;
+ }
+
+ if (!isVisible (this_match)) {
+ // not visible
+ continue;
+ }
+
+ final int subject_start_x = match_x_positions[0];
+ final int subject_end_x = match_x_positions[1];
+ final int query_start_x = match_x_positions[2];
+ final int query_end_x = match_x_positions[3];
+
+ final int [] x_coords = new int [4];
+ final int [] y_coords = new int [4];
+
+ x_coords[0] = subject_start_x;
+ y_coords[0] = 0;
+ x_coords[1] = query_start_x;
+ y_coords[1] = canvas_height;
+ x_coords[2] = query_end_x;
+ y_coords[2] = canvas_height;
+ x_coords[3] = subject_end_x;
+ y_coords[3] = 0;
+
+ final boolean highlight_this_match;
+
+ if (selected_matches != null &&
+ selected_matches.contains (this_match)) {
+ highlight_this_match = true;
+ } else {
+ highlight_this_match = false;
+ }
+
+ final int OFFSCREEN = 3000;
+
+ final int percent_id = this_match.getPercentID ();
+
+ if (highlight_this_match) {
+ g.setColor (Color.yellow);
+ } else {
+ if (percent_id == -1) {
+ if (this_match.isRevMatch ()) {
+ g.setColor (Color.blue);
+ } else {
+ g.setColor (Color.red);
+ }
+ } else {
+ int colour_index = red_percent_id_colours.length - 1;
+
+ if (maximum_percent_id > minimum_percent_id) {
+ colour_index =
+ (int)(red_percent_id_colours.length * 0.999 *
+ (percent_id - minimum_percent_id) /
+ (maximum_percent_id - minimum_percent_id));
+ }
+
+ if (this_match.isRevMatch ()) {
+ g.setColor (blue_percent_id_colours[colour_index]);
+ } else {
+ g.setColor (red_percent_id_colours[colour_index]);
+ }
+ }
+ }
+
+ g.fillPolygon (x_coords, y_coords, x_coords.length);
+
+ if (subject_end_x - subject_start_x < 5 &&
+ subject_end_x - subject_start_x > -5 ||
+ subject_start_x < -OFFSCREEN ||
+ subject_end_x > OFFSCREEN ||
+ query_start_x < -OFFSCREEN ||
+ query_end_x > OFFSCREEN) {
+
+ // match is (probably) narrow so draw the border to the same colour as
+ // the polygon
+ } else {
+
+ // draw a black outline the make the match stand out
+ g.setColor (Color.black);
+ }
+
+ g.drawLine (subject_start_x, 0, query_start_x, canvas_height);
+ g.drawLine (subject_end_x, 0, query_end_x, canvas_height);
+ }
+ }
+
+ /**
+ * Return true if and only if the given match is currently visible.
+ **/
+ private boolean isVisible (final AlignMatch match) {
+ if (ignore_self_match_flag && match.isSelfMatch ()) {
+ return false;
+ }
+
+ final int score = match.getScore ();
+ final int percent_id = match.getPercentID ();
+
+ if (score > -1) {
+ if (score < minimum_score || score > maximum_score) {
+ return false;
+ }
+ }
+
+ if (percent_id > -1) {
+ if (percent_id < minimum_percent_id || percent_id > maximum_percent_id) {
+ return false;
+ }
+ }
+
+ final int match_length =
+ Math.abs (match.getSubjectSequenceStart () -
+ match.getSubjectSequenceEnd ());
+
+ if (match_length < scroll_bar.getValue ()) {
+ return false;
+ }
+
+ return true;
+ }
+
+ /**
+ * Return the start position in the subject sequence of the given
+ * AlignMatch, taking into account the current orientation of the
+ * sequences. If the reverse_position argument is true reverse the
+ * complemented match coordinates will be returned.
+ **/
+ static int getRealSubjectSequenceStart (final AlignMatch match,
+ final int sequence_length,
+ final boolean reverse_position) {
+ if (reverse_position) {
+ return sequence_length - match.getSubjectSequenceStart () + 1;
+ } else {
+ return match.getSubjectSequenceStart ();
+ }
+ }
+
+ /**
+ * Return the end position in the subject sequence of the given AlignMatch,
+ * taking into account the current orientation of the sequences. If the
+ * reverse_position argument is true reverse the complemented match
+ * coordinates will be returned.
+ **/
+ static int getRealSubjectSequenceEnd (final AlignMatch match,
+ final int sequence_length,
+ final boolean reverse_position) {
+ if (reverse_position) {
+ return sequence_length - match.getSubjectSequenceEnd () + 1;
+ } else {
+ return match.getSubjectSequenceEnd ();
+ }
+ }
+
+ /**
+ * Return the start position in the query sequence of the given AlignMatch,
+ * taking into account the current orientation of the sequences. If the
+ * reverse_position argument is true reverse the complemented match
+ * coordinates will be returned.
+ **/
+ static int getRealQuerySequenceStart (final AlignMatch match,
+ final int sequence_length,
+ final boolean reverse_position) {
+ if (reverse_position) {
+ return sequence_length - match.getQuerySequenceStart () + 1;
+ } else {
+ return match.getQuerySequenceStart ();
+ }
+ }
+
+ /**
+ * Return the end position in the query sequence of the given AlignMatch,
+ * taking into account the current orientation of the sequences. If the
+ * reverse_position argument is true reverse the complemented match
+ * coordinates will be returned.
+ **/
+ static int getRealQuerySequenceEnd (final AlignMatch match,
+ final int sequence_length,
+ final boolean reverse_position) {
+ if (reverse_position) {
+ return sequence_length - match.getQuerySequenceEnd () + 1;
+ } else {
+ return match.getQuerySequenceEnd ();
+ }
+ }
+
+ /**
+ * Return the screen x positions of the corners of the given match. The
+ * order is Top Left, Top Right, Bottom Left, Bottom Right, unless the
+ * match is an inversion, in which case it will be TL,TR,BR,BL. Returns
+ * null if and only if the match is not currently visible.
+ **/
+ private int [] getMatchCoords (final int canvas_width,
+ final AlignMatch this_match) {
+ final int subject_length = getSubjectForwardStrand ().getSequenceLength ();
+ final int query_length = getQueryForwardStrand ().getSequenceLength ();
+
+ int subject_sequence_start =
+ getRealSubjectSequenceStart (this_match,
+ subject_length,
+ subjectIsRevComp ());
+ int subject_sequence_end =
+ getRealSubjectSequenceEnd (this_match,
+ subject_length,
+ subjectIsRevComp ());
+ int query_sequence_start =
+ getRealQuerySequenceStart (this_match,
+ query_length,
+ queryIsRevComp ());
+ int query_sequence_end =
+ getRealQuerySequenceEnd (this_match,
+ query_length,
+ queryIsRevComp ());
+
+ // add one base because we want to draw to the end of the base
+ if (subjectIsRevComp ()) {
+ subject_sequence_start += 1;
+ } else {
+ subject_sequence_end += 1;
+ }
+
+ if (this_match.isRevMatch () && !queryIsRevComp () ||
+ !this_match.isRevMatch () && queryIsRevComp ()) {
+ query_sequence_start += 1;
+ } else {
+ query_sequence_end += 1;
+ }
+
+ final int subject_start_x =
+ getScreenPosition (canvas_width, last_subject_event,
+ subject_sequence_start);
+ final int subject_end_x =
+ getScreenPosition (canvas_width, last_subject_event,
+ subject_sequence_end);
+
+ final int query_start_x =
+ getScreenPosition (canvas_width, last_query_event,
+ query_sequence_start);
+ final int query_end_x =
+ getScreenPosition (canvas_width, last_query_event,
+ query_sequence_end);
+
+ boolean subject_off_left = false;
+ boolean subject_off_right = false;
+ boolean query_off_left = false;
+ boolean query_off_right = false;
+
+ if (subject_start_x < 0 && subject_end_x < 0) {
+ subject_off_left = true;
+ }
+
+ if (subject_start_x >= canvas_width && subject_end_x >= canvas_width) {
+ subject_off_right = true;
+ }
+
+ if (query_start_x < 0 && query_end_x < 0) {
+ query_off_left = true;
+ }
+
+ if (query_start_x >= canvas_width && query_end_x >= canvas_width) {
+ query_off_right = true;
+ }
+
+ if ((subject_off_left ? 1 : 0) +
+ (query_off_left ? 1 : 0) +
+ (subject_off_right ? 1 : 0) +
+ (query_off_right ? 1 : 0) == 2) {
+ return null;
+ } else {
+ final int [] return_values = new int [4];
+
+ return_values[0] = subject_start_x;
+ return_values[1] = subject_end_x;
+ return_values[2] = query_start_x;
+ return_values[3] = query_end_x;
+
+ return return_values;
+ }
+ }
+
+ /**
+ * Return the current forward Strand of the subject EntryGroup.
+ **/
+ private Strand getSubjectForwardStrand () {
+ return getSubjectEntryGroup ().getBases ().getForwardStrand ();
+ }
+
+ /**
+ * Return the current forward Strand of the query EntryGroup.
+ **/
+ private Strand getQueryForwardStrand () {
+ return getQueryEntryGroup ().getBases ().getForwardStrand ();
+ }
+
+ /**
+ * Return the current reverse Strand of the subject EntryGroup.
+ **/
+ private Strand getSubjectReverseStrand () {
+ return getSubjectEntryGroup ().getBases ().getReverseStrand ();
+ }
+
+ /**
+ * Return the current reverse Strand of the query EntryGroup.
+ **/
+ private Strand getQueryReverseStrand () {
+ return getQueryEntryGroup ().getBases ().getReverseStrand ();
+ }
+
+ /**
+ * Return the subject EntryGroup that was passed to the constructor.
+ **/
+ private EntryGroup getSubjectEntryGroup () {
+ return subject_entry_group;
+ }
+
+ /**
+ * Return the subject EntryGroup that was passed to the constructor.
+ **/
+ private EntryGroup getQueryEntryGroup () {
+ return query_entry_group;
+ }
+
+ /**
+ * Return the reference of the subject FeatureDisplay.
+ **/
+ public FeatureDisplay getSubjectDisplay () {
+ return subject_feature_display;
+ }
+
+ /**
+ * Return the reference of the query FeatureDisplay.
+ **/
+ public FeatureDisplay getQueryDisplay () {
+ return query_feature_display;
+ }
+
+ /**
+ * Returns true if and only if the subject sequence has been flipped since
+ * this object was created.
+ **/
+ boolean subjectIsRevComp () {
+ final Strand current_subject_forward_strand = getSubjectForwardStrand ();
+
+ if (getOrigSubjectForwardStrand () == current_subject_forward_strand ^
+ getSubjectDisplay ().isRevCompDisplay ()) {
+ return false;
+ } else {
+ return true;
+ }
+ }
+
+ /**
+ * Returns true if and only if the query sequence has been flipped since
+ * this object was created.
+ **/
+ boolean queryIsRevComp () {
+ final Strand current_query_forward_strand = getQueryForwardStrand ();
+
+ if (getOrigQueryForwardStrand () == current_query_forward_strand ^
+ getQueryDisplay ().isRevCompDisplay ()) {
+ return false;
+ } else {
+ return true;
+ }
+ }
+
+ /**
+ * Return the forward Strand of the subject EntryGroup from when the
+ * Comparator was created.
+ **/
+ public Strand getOrigSubjectForwardStrand () {
+ return orig_subject_forward_strand;
+ }
+
+ /**
+ * Return the forward Strand of the query EntryGroup from when the
+ * Comparator was created.
+ **/
+ public Strand getOrigQueryForwardStrand () {
+ return orig_query_forward_strand;
+ }
+
+ /**
+ * Return the reverse Strand of the subject EntryGroup from when the
+ * Comparator was created.
+ **/
+ public Strand getOrigSubjectReverseStrand () {
+ return orig_subject_reverse_strand;
+ }
+
+ /**
+ * Return the reverse Strand of the query EntryGroup from when the
+ * Comparator was created.
+ **/
+ public Strand getOrigQueryReverseStrand () {
+ return orig_query_reverse_strand;
+ }
+
+ /**
+ * Arrange for the two FeatureDisplay objects to scroll in parallel.
+ **/
+ public void lockDisplays () {
+ displays_are_locked = true;
+ repaintCanvas ();
+ }
+
+ /**
+ * Arrange for the two FeatureDisplay objects to scroll independently.
+ **/
+ public void unlockDisplays () {
+ displays_are_locked = false;
+ repaintCanvas ();
+ }
+
+ /**
+ * Return true if and only if the displays are currently locked.
+ **/
+ public boolean displaysAreLocked () {
+ return displays_are_locked;
+ }
+
+ /**
+ * Toggle whether the two displays are locked.
+ **/
+ public void toggleDisplayLock () {
+ displays_are_locked = !displays_are_locked;
+ repaintCanvas ();
+ }
+
+ /**
+ * Calling this method will temporarily disable selectFromQueryRange() and
+ * selectFromSubjectRange() until enableSelection(). This is need to allow
+ * the selections of the top and bottom FeatureDisplays to be set without
+ * changing which AlignMatches are selected.
+ **/
+ public void disableSelection () {
+ disable_selection_from_ranges = true;
+ }
+
+ /**
+ * Enable selectFromQueryRange() and selectFromSubjectRange().
+ **/
+ public void enableSelection () {
+ disable_selection_from_ranges = false;
+ }
+
+ /**
+ * Convert a base position into a screen x coordinate.
+ **/
+ private int getScreenPosition (final int canvas_width,
+ final DisplayAdjustmentEvent event,
+ final int base_position) {
+ // this is the base that is at the left of the screen
+ final int screen_start_base = event.getStart ();
+
+ final double base_pos_float =
+ event.getBaseWidth () * (base_position - screen_start_base);
+
+ if (base_pos_float > 30000) {
+ return 30000;
+ } else {
+ if (base_pos_float < -30000) {
+ return -30000;
+ } else {
+ return (int) base_pos_float;
+ }
+ }
+ }
+
+ /**
+ * Return an array of colours that will be used for colouring the matches
+ * (depending on score).
+ **/
+ private void makeColours () {
+ red_percent_id_colours = new Color [NUMBER_OF_SHADES];
+ blue_percent_id_colours = new Color [NUMBER_OF_SHADES];
+
+ for (int i = 0 ; i < blue_percent_id_colours.length ; ++i) {
+ final int shade_value = 255 - (int) (256 * 1.0 * i / NUMBER_OF_SHADES);
+ red_percent_id_colours[i] = new Color (255, shade_value, shade_value);
+ blue_percent_id_colours[i] = new Color (shade_value, shade_value, 255);
+ }
+ }
+
+ /**
+ * Return the ComparisonData object that was passed to the constructor.
+ **/
+ private ComparisonData getComparisonData () {
+ return comparison_data;
+ }
+
+ /**
+ * The comparison data that will be displayed in this component.
+ **/
+ final private ComparisonData comparison_data;
+
+ /**
+ * All the AlignMatch objects from comparison_data (possibly in a
+ * different order.
+ **/
+ private AlignMatch [] all_matches = null;
+
+ /**
+ * This is the last DisplayAdjustmentEvent reference that was passed to
+ * setSubjectSeqeuencePosition ().
+ **/
+ private DisplayAdjustmentEvent last_subject_event;
+
+ /**
+ * This is the last DisplayAdjustmentEvent reference that was passed to
+ * setQuerySeqeuencePosition ().
+ **/
+ private DisplayAdjustmentEvent last_query_event;
+
+ /**
+ * The FeatureDisplay that is above this component. (From the constructor).
+ **/
+ private FeatureDisplay subject_feature_display;
+
+ /**
+ * The FeatureDisplay that is below this component. (From the constructor).
+ **/
+ private FeatureDisplay query_feature_display;
+
+ /**
+ * Set by the constructor to be the original forward strand for the subject
+ * sequence. This is use to determine whether to subject sequence has been
+ * reverse-complemented or not.
+ **/
+ private Strand orig_subject_forward_strand;
+
+ /**
+ * Set by the constructor to be the original forward strand for the query
+ * sequence. This is use to determine whether to query sequence has been
+ * reverse-complemented or not.
+ **/
+ private Strand orig_query_forward_strand;
+
+ /**
+ * Set by the constructor to be the original reverse strand for the subject
+ * sequence.
+ **/
+ private Strand orig_subject_reverse_strand;
+
+ /**
+ * Set by the constructor to be the original reverse strand for the query
+ * sequence.
+ **/
+ private Strand orig_query_reverse_strand;
+
+ /**
+ * One of the two Entry objects that we are comparing.
+ **/
+ final private EntryGroup subject_entry_group;
+
+ /**
+ * One of the two Entry objects that we are comparing.
+ **/
+ final private EntryGroup query_entry_group;
+
+ /**
+ * The selected matches. null means no matches are selected.
+ **/
+ private AlignMatchVector selected_matches = null;
+
+ /**
+ * The objects that are listening for AlignmentSelectionChangeEvents.
+ **/
+ private java.util.Vector selection_change_listeners =
+ new java.util.Vector ();
+
+ /**
+ * The number of shades of red and blue to use for percentage ID colouring.
+ **/
+ private static int NUMBER_OF_SHADES = 13;
+
+ /**
+ * The Reds used to display the percent identity of matches.
+ **/
+ private Color [] red_percent_id_colours;
+
+ /**
+ * The Blues used to display the percent identity of matches.
+ **/
+ private Color [] blue_percent_id_colours;
+
+ /**
+ * The scroll bar used to set the minimum length of the visible matches.
+ **/
+ private JScrollBar scroll_bar = null;
+
+ /**
+ * Matches with scores below this value will not be shown.
+ **/
+ private int minimum_score = 0;
+
+ /**
+ * Matches with scores above this value will not be shown.
+ **/
+ private int maximum_score = 99999999;
+
+ /**
+ * Matches with percent identity values below this number will not be shown.
+ **/
+ private int minimum_percent_id = 0;
+
+ /**
+ * Matches with percent identity values above this number will not be shown.
+ **/
+ private int maximum_percent_id = 100;
+
+ /**
+ * True if we should offer to flip the query sequence when the user
+ * double clicks on a flipped match.
+ **/
+ private boolean offer_to_flip_flag = false;
+
+ /**
+ * If true ignore self matches (ie query start == subject start && query
+ * end == subject end)
+ **/
+ private boolean ignore_self_match_flag = false;
+
+ /**
+ * A Vector of those objects that are listening for AlignmentEvents
+ **/
+ private java.util.Vector alignment_event_listeners =
+ new java.util.Vector ();
+
+ /**
+ * If true then the FeatureDisplays above and below this AlignmentViewer
+ * should scroll together.
+ **/
+ private boolean displays_are_locked = true;
+
+ /**
+ * Setting this to true will temporarily disable selectFromQueryRange() and
+ * selectFromSubjectRange() until enableSelection(). This is need to allow
+ * the selections of the top and bottom FeatureDisplays to be set without
+ * changing which AlignMatches are selected.
+ **/
+ private boolean disable_selection_from_ranges = false;
+}
diff --git a/uk/ac/sanger/artemis/components/ArtemisCheckboxMenuItem.java b/uk/ac/sanger/artemis/components/ArtemisCheckboxMenuItem.java
new file mode 100644
index 000000000..fd3bf5357
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ArtemisCheckboxMenuItem.java
@@ -0,0 +1,127 @@
+/* CheckboxMenuItem.java
+ *
+ * created: Mon Aug 19 2002
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2001,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ArtemisCheckboxMenuItem.java,v 1.1 2004-06-09 09:46:02 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import java.util.Vector;
+
+/**
+ * This component is a replacement for the CheckboxMenuItem component. It is
+ * needed on GNU/Linux with versions 1.2, 1.3 and 1.4 or the VM. See this
+ * bug for more:
+ * http://developer.java.sun.com/developer/bugParade/bugs/4533641.html
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: ArtemisCheckboxMenuItem.java,v 1.1 2004-06-09 09:46:02 tjc Exp $
+ **/
+
+public class ArtemisCheckboxMenuItem
+ extends MenuItem
+ implements ActionListener, ItemSelectable {
+ /**
+ * Make a new ArtemisCheckboxMenuItem with the given label.
+ **/
+ public ArtemisCheckboxMenuItem (final String label) {
+ super (label);
+
+ this.orig_label = label;
+
+ addActionListener (this);
+ }
+
+ /**
+ * Implementation of ActionListener.
+ **/
+ public void actionPerformed (ActionEvent _) {
+ final ItemEvent e;
+
+ if (getState ()) {
+ setState (false);
+ e = new ItemEvent (this, ItemEvent.ITEM_STATE_CHANGED,
+ this, ItemEvent.DESELECTED);
+ } else {
+ setState (true);
+ e = new ItemEvent (this, ItemEvent.ITEM_STATE_CHANGED,
+ this, ItemEvent.SELECTED);
+ }
+
+ for (int i = 0 ; i < listeners.size () ; ++i) {
+ ((ItemListener) listeners.elementAt (i)).itemStateChanged (e) ;
+ }
+ }
+
+ /**
+ * Returns null (implementation of ItemSelectable).
+ **/
+ public Object[] getSelectedObjects() {
+ return null;
+ }
+
+ /**
+ * Sets this check box menu item to the specifed state. The boolean value
+ * true indicates "on" while false indicates "off."
+ * @param state true if the check box menu item is on, otherwise false
+ **/
+ public void setState (final boolean state) {
+ this.state = state;
+ if (state) {
+ setLabel ("Disable " + orig_label + " (current on)");
+ } else {
+ setLabel ("Enable " + orig_label + " (current off)");
+ }
+ }
+
+ /**
+ * Determines whether the state of this check box menu item is "on" or
+ * "off."
+ * @return the state of this check box menu item, where true indicates "on"
+ * and false indicates "off"
+ **/
+ public boolean getState () {
+ return state;
+ }
+
+ /**
+ * Add the given listener.
+ **/
+ public void addItemListener (final ItemListener listener) {
+ listeners.addElement (listener);
+ }
+
+ /**
+ * remove the given listener.
+ **/
+ public void removeItemListener (final ItemListener listener) {
+ listeners.removeElement (listener);
+ }
+
+ private String orig_label;
+ private boolean state = false;
+
+ private Vector listeners = new Vector ();
+}
diff --git a/uk/ac/sanger/artemis/components/ArtemisMain.java b/uk/ac/sanger/artemis/components/ArtemisMain.java
new file mode 100644
index 000000000..c51696133
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ArtemisMain.java
@@ -0,0 +1,634 @@
+/* ArtemisMain.java
+ *
+ * created: Wed Feb 23 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ArtemisMain.java,v 1.1 2004-06-09 09:46:03 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.NoSequenceException;
+import uk.ac.sanger.artemis.sequence.Bases;
+import uk.ac.sanger.artemis.util.Document;
+import uk.ac.sanger.artemis.util.DocumentFactory;
+import uk.ac.sanger.artemis.util.OutOfRangeException;
+import uk.ac.sanger.artemis.util.InputStreamProgressListener;
+import uk.ac.sanger.artemis.io.EntryInformation;
+
+import org.biojava.bio.seq.io.SequenceFormat;
+
+import java.awt.event.ActionListener;
+import java.awt.event.ActionEvent;
+import java.io.*;
+
+/**
+ * The main window for the Artemis sequence editor.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: ArtemisMain.java,v 1.1 2004-06-09 09:46:03 tjc Exp $
+ **/
+
+public class ArtemisMain extends Splash
+{
+ /** Version String use for banner messages and title bars. */
+ public static final String version = "Swing 1";
+
+ /** A vector containing all EntryEdit object we have created. */
+ private EntryEditVector entry_edit_objects = new EntryEditVector();
+
+ protected static FileManager filemanager = null;
+ /**
+ * The constructor creates all the components for the main Artemis
+ * window and sets up all the menu callbacks.
+ **/
+ public ArtemisMain()
+ {
+ super("Artemis", "Artemis", version);
+
+ ActionListener menu_listener = new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ if(filemanager == null)
+ filemanager = new FileManager(ArtemisMain.this);
+ else
+ filemanager.setVisible(true);
+ }
+ };
+ makeMenuItem(file_menu, "Open File Manager ...", menu_listener);
+
+ final EntrySourceVector entry_sources = getEntrySources(this);
+
+ for(int source_index=0; source_index<entry_sources.size();
+ ++source_index)
+ {
+ final EntrySource this_entry_source =
+ entry_sources.elementAt(source_index);
+
+ String entry_source_name = this_entry_source.getSourceName();
+ String menu_name = null;
+
+ if(entry_source_name.equals("Filesystem"))
+ menu_name = "Open ...";
+ else
+ menu_name = "Open from " + entry_source_name + " ...";
+
+ menu_listener = new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ getEntryEditFromEntrySource(this_entry_source);
+ }
+ };
+ makeMenuItem(file_menu, menu_name, menu_listener);
+ }
+
+ menu_listener = new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ exit();
+ }
+ };
+ makeMenuItem(file_menu, "Quit", menu_listener);
+
+// getCanvas().addMouseListener(new MouseAdapter() {
+// /**
+// * Listen for mouse press events so that we can do popup menus and
+// * selection.
+// **/
+// public void mousePressed(MouseEvent event) {
+// handleCanvasMousePress(event);
+// }
+// });
+
+// java.util.Properties props = System.getProperties();
+// java.util.Enumeration en = props.propertyNames();
+// while(en.hasMoreElements())
+// {
+// String prop = (String)en.nextElement();
+// System.out.println(prop+":: "+props.getProperty(prop));
+// }
+
+ }
+
+
+// XXX add pasteClipboard() one day
+
+// /**
+// * Handle a mouse press event on the drawing canvas - select on click,
+// * select and broadcast it on double click.
+// **/
+// private void handleCanvasMousePress(MouseEvent event) {
+// if(event.getID() != MouseEvent.MOUSE_PRESSED) {
+// return;
+// }
+
+// if((event.getModifiers() & InputEvent.BUTTON2_MASK) != 0) {
+// pasteClipboard();
+// }
+// }
+
+ /**
+ * Read the entries named in args and in the diana.ini file.
+ **/
+ public void readArgsAndOptions(final String [] args,
+ ProgressThread progress_thread)
+ {
+ if(args.length == 0)
+ {
+ // open the entries given in the options file(diana.ini)
+ readDefaultEntries();
+ return;
+ }
+
+ if(args[0].equals("-biojava"))
+ {
+ handleBioJava(args);
+ return;
+ }
+
+ final EntryInformation artemis_entry_information =
+ Options.getArtemisEntryInformation();
+
+ EntryEdit last_entry_edit = null;
+ boolean seen_plus = false;
+
+ if(progress_thread != null)
+ progress_thread.start();
+
+ for(int i = 0 ; i<args.length ; ++i)
+ {
+ String new_entry_name = args[i];
+
+ if(new_entry_name.length() == 0)
+ continue;
+
+ if(new_entry_name.equals("+"))
+ {
+ seen_plus = true;
+ continue;
+ }
+
+
+ if(new_entry_name.startsWith("+") && last_entry_edit != null ||
+ seen_plus)
+ {
+ // new feature file
+
+ final Document entry_document;
+
+ if(seen_plus)
+ entry_document = DocumentFactory.makeDocument(new_entry_name);
+ else
+ entry_document =
+ DocumentFactory.makeDocument(new_entry_name.substring(1));
+
+ final InputStreamProgressListener progress_listener =
+ getInputStreamProgressListener();
+
+ entry_document.addInputStreamProgressListener(progress_listener);
+
+ final uk.ac.sanger.artemis.io.Entry new_embl_entry =
+ EntryFileDialog.getEntryFromFile(this, entry_document,
+ artemis_entry_information,
+ false);
+
+ if(new_embl_entry == null) // the read failed
+ break;
+
+ try
+ {
+ final Entry new_entry =
+ new Entry(last_entry_edit.getEntryGroup().getBases(),
+ new_embl_entry);
+
+ last_entry_edit.getEntryGroup().add(new_entry);
+ }
+ catch(OutOfRangeException e)
+ {
+ new MessageDialog(this, "read failed: one of the features in " +
+ new_entry_name + " has an out of range " +
+ "location: " + e.getMessage());
+ }
+ }
+ else
+ {
+ // new sequence file
+
+ if(last_entry_edit != null)
+ {
+ last_entry_edit.setVisible(true);
+ last_entry_edit = null;
+ }
+
+ final Document entry_document =
+ DocumentFactory.makeDocument(new_entry_name);
+
+ entry_document.addInputStreamProgressListener(getInputStreamProgressListener());
+
+ final uk.ac.sanger.artemis.io.Entry new_embl_entry =
+ EntryFileDialog.getEntryFromFile(this, entry_document,
+ artemis_entry_information,
+ false);
+
+ if(new_embl_entry == null) // the read failed
+ break;
+
+ try
+ {
+ final Entry entry = new Entry(new_embl_entry);
+ last_entry_edit = makeEntryEdit(entry);
+ addEntryEdit(last_entry_edit);
+ getStatusLabel().setText("");
+ }
+ catch(OutOfRangeException e)
+ {
+ new MessageDialog(this, "read failed: one of the features in " +
+ new_entry_name + " has an out of range " +
+ "location: " + e.getMessage());
+ break;
+ }
+ catch(NoSequenceException e)
+ {
+ new MessageDialog(this, "read failed: " +
+ new_entry_name + " contains no sequence");
+ break;
+ }
+ }
+ }
+
+ for(int entry_index=0; entry_index<entry_edit_objects.size();
+ ++entry_index)
+ entry_edit_objects.elementAt(entry_index).show();
+ }
+
+ /**
+ * Handle the -biojava option
+ **/
+ private void handleBioJava(final String [] args)
+ {
+ if(args.length == 3)
+ {
+ final String class_name = args[1];
+ final String location = args[2];
+
+ final Document location_document =
+ DocumentFactory.makeDocument(location);
+
+ try
+ {
+ final Object biojava_object =
+ Class.forName(class_name).newInstance();
+
+ final EntryInformation entry_information =
+ Options.getArtemisEntryInformation();
+
+ final uk.ac.sanger.artemis.io.BioJavaEntry emblEntry;
+
+ if(biojava_object instanceof SequenceFormat)
+ {
+ final SequenceFormat sequence_format =
+ (SequenceFormat) biojava_object;
+
+ emblEntry =
+ new uk.ac.sanger.artemis.io.BioJavaEntry(entry_information,
+ location_document,
+ sequence_format);
+
+ final Entry new_entry = new Entry(emblEntry);
+
+ final EntryEdit new_entry_edit = makeEntryEdit(new_entry);
+
+ new_entry_edit.setVisible(true);
+ }
+ else
+ new MessageDialog(this, "not a SequenceFormat: " + class_name);
+ }
+ catch(IllegalAccessException e)
+ {
+ new MessageDialog(this, "cannot create class: " + class_name +
+ " - IllegalAccessException");
+ }
+ catch(ClassNotFoundException e)
+ {
+ new MessageDialog(this, "cannot find class: " + class_name);
+ }
+ catch(ClassCastException e)
+ {
+ new MessageDialog(this, class_name + " is not a sub-class of " +
+ "SequenceFormat");
+ }
+ catch(IOException e)
+ {
+ new MessageDialog(this, "I/O error while reading from " +
+ location + ": " + e.getMessage());
+ }
+ catch(NoSequenceException e)
+ {
+ new MessageDialog(this, location + " contained no sequence");
+ }
+ catch(InstantiationException e)
+ {
+ new MessageDialog(this, "cannot instantiate " + class_name);
+ }
+ catch(OutOfRangeException e)
+ {
+ new MessageDialog(this, "read failed: one of the features in " +
+ location +
+ " has an out of range location: " +
+ e.getMessage());
+ }
+ }
+ else
+ new MessageDialog(this, "the -biojava option needs two arguments");
+ }
+
+ /**
+ * Read the entries given in the uk.ac.sanger.artemis.ini file.
+ **/
+ private void readDefaultEntries()
+ {
+ final EntryInformation artemis_entry_information =
+ Options.getArtemisEntryInformation();
+
+ final String default_sequence_file_name =
+ Options.getOptions().getDefaultSequenceFileName();
+
+ final String default_feature_file_name =
+ Options.getOptions().getDefaultFeatureFileName();
+
+ if(default_sequence_file_name != null)
+ {
+ final String default_sequence_file_name_embl =
+ default_sequence_file_name + "_embl";
+
+ uk.ac.sanger.artemis.io.Entry new_embl_entry = null;
+
+ // try opening the default sequence file with "_embl" added to the name
+ // if that fails try the plain sequence file name
+
+ final Document entry_document =
+ DocumentFactory.makeDocument(default_sequence_file_name_embl);
+
+ final InputStreamProgressListener progress_listener =
+ getInputStreamProgressListener();
+
+ entry_document.addInputStreamProgressListener(progress_listener);
+
+ if(entry_document.readable())
+ {
+ new_embl_entry =
+ EntryFileDialog.getEntryFromFile(this,
+ entry_document,
+ artemis_entry_information,
+ false);
+ }
+
+ if(new_embl_entry == null || new_embl_entry.getSequence() == null ||
+ new_embl_entry.getSequence().length() == 0)
+ {
+ final File entry_file = new File(default_sequence_file_name);
+
+ if(entry_file.exists())
+ {
+ new_embl_entry =
+ EntryFileDialog.getEntryFromFile(this,
+ entry_document,
+ artemis_entry_information,
+ false);
+ }
+ else
+ {
+ // read failed
+ System.err.println("file does not exist: " +
+ default_sequence_file_name +
+ "(given in options files)");
+ return;
+ }
+ }
+
+ if(new_embl_entry == null || new_embl_entry.getSequence() == null ||
+ new_embl_entry.getSequence().length() == 0)
+ {
+ // read failed
+ System.err.println("failed to read " + default_sequence_file_name +
+ "(given in options files)");
+ return;
+ }
+
+ getStatusLabel().setText("");
+
+ try
+ {
+ final Entry entry = new Entry(new_embl_entry);
+
+ final EntryEdit new_entry_edit = makeEntryEdit(entry);
+
+ new_entry_edit.setVisible(true);
+
+ if(default_feature_file_name != null)
+ {
+ final Document feature_document =
+ DocumentFactory.makeDocument(default_feature_file_name);
+
+ final uk.ac.sanger.artemis.io.Entry new_embl_table_entry =
+ EntryFileDialog.getEntryFromFile(this,
+ feature_document,
+ artemis_entry_information,
+ false);
+
+ if(new_embl_table_entry == null) // open failed
+ return;
+
+ final EntryGroup entry_group = new_entry_edit.getEntryGroup();
+
+ final Entry new_table_entry =
+ new Entry(entry.getBases(), new_embl_table_entry);
+
+ entry_group.add(new_table_entry);
+ }
+ } catch(OutOfRangeException e) {
+ new MessageDialog(this, "read failed: one of the features in " +
+ default_feature_file_name +
+ " has an out of range location: " +
+ e.getMessage());
+ } catch(NoSequenceException e) {
+ new MessageDialog(this, "read failed: " +
+ new_embl_entry.getName() +
+ " contains no sequence");
+ }
+ }
+ }
+
+ /**
+ * Make an EntryEdit component from the given Entry.
+ **/
+ private EntryEdit makeEntryEdit(final Entry entry)
+ {
+ final Bases bases = entry.getBases();
+ final EntryGroup entry_group = new SimpleEntryGroup(bases);
+ entry_group.add(entry);
+ final EntryEdit entry_edit = new EntryEdit(entry_group);
+
+ return entry_edit;
+ }
+
+ /**
+ * This method gets rid of an EntryEdit object and it's frame. Each object
+ * removed with this method must have been added previously with
+ * addEntryEdit().
+ * @param entry_edit The object to get rid of.
+ **/
+ public void entryEditFinished(EntryEdit entry_edit)
+ {
+ if(null == entry_edit)
+ throw new Error("entryEditFinished() was passed a null object");
+
+ if(!entry_edit_objects.removeElement(entry_edit))
+ throw new Error("entryEditFinished() - could not remove a " +
+ "object from an empty vector");
+
+ entry_edit.setVisible(false);
+ entry_edit.dispose();
+ }
+
+ /**
+ * Add an EntryEdit object to our list of objects.
+ * @param entry_edit The object to add.
+ **/
+ public synchronized void addEntryEdit(EntryEdit entry_edit)
+ {
+ entry_edit_objects.addElement(entry_edit);
+ }
+
+ /**
+ * Read an Entry from the given EntrySource and make a new EntryEdit
+ * component for the Entry.
+ **/
+ private void getEntryEditFromEntrySource(final EntrySource entry_source)
+ {
+ final ProgressThread progress_thread = new ProgressThread(null,
+ "Loading Entry...");
+
+ SwingWorker entryWorker = new SwingWorker()
+ {
+ EntryEdit entry_edit;
+ public Object construct()
+ {
+ try
+ {
+ final Entry entry = entry_source.getEntry(true,progress_thread);
+ if(entry == null)
+ return null;
+
+ final EntryGroup entry_group =
+ new SimpleEntryGroup(entry.getBases());
+
+ entry_group.add(entry);
+ entry_edit = new EntryEdit(entry_group);
+ }
+ catch(OutOfRangeException e)
+ {
+ new MessageDialog(ArtemisMain.this, "read failed: one of the features in " +
+ " the entry has an out of range " +
+ "location: " + e.getMessage());
+ }
+ catch(NoSequenceException e)
+ {
+ new MessageDialog(ArtemisMain.this, "read failed: entry contains no sequence");
+ }
+ catch(IOException e)
+ {
+ new MessageDialog(ArtemisMain.this, "read failed due to IO error: " + e);
+ }
+ return null;
+ }
+
+ public void finished()
+ {
+ if(entry_edit != null)
+ entry_edit.setVisible(true);
+ if(progress_thread !=null)
+ progress_thread.finished();
+ }
+ };
+ entryWorker.start();
+ }
+
+ /**
+ * Force all the EntryEdit components to be redisplayed.
+ **/
+ private void redisplayAll()
+ {
+ for(int i=0 ; i<entry_edit_objects.size() ; ++i)
+ entry_edit_objects.elementAt(i).redisplay();
+ }
+
+ /**
+ * Close the main frame and all EntryEdit frames and then this frame,
+ * then exit.
+ **/
+ protected void exit()
+ {
+// for(int i=0 ; i<entry_edit_objects.size() ;++i)
+// entryEditFinished(entry_edit_objects.elementAt(i));
+
+// if(filemanager != null)
+// filemanager.setVisible(false);
+
+// setVisible(false);
+// dispose();
+// System.gc();
+ System.exit(0);
+ }
+
+ /**
+ * Main entry point for the stand-alone version of Artemis.
+ **/
+ public static void main(final String [] args)
+ {
+ final ArtemisMain main_window = new ArtemisMain();
+ main_window.setVisible(true);
+
+ final ProgressThread progress_thread = new ProgressThread(null,
+ "Loading Entry...");
+
+ SwingWorker entryWorker = new SwingWorker()
+ {
+ public Object construct()
+ {
+ // read the entries given on the command line and in the diana.ini file
+ main_window.readArgsAndOptions(args,progress_thread);
+ return null;
+ }
+
+ public void finished()
+ {
+ if(progress_thread !=null)
+ progress_thread.finished();
+ }
+ };
+ entryWorker.start();
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/BasePlot.java b/uk/ac/sanger/artemis/components/BasePlot.java
new file mode 100644
index 000000000..e71ccb918
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/BasePlot.java
@@ -0,0 +1,627 @@
+/* BasePlot.java
+ *
+ * created: Tue Dec 15 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000,2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/BasePlot.java,v 1.1 2004-06-09 09:46:04 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+import uk.ac.sanger.artemis.plot.*;
+import uk.ac.sanger.artemis.util.OutOfRangeException;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * A component for plotting functions over the base sequence. Scrolling and
+ * scale is tied to a FeatureDisplay component.
+ *
+ * @author Kim Rutherford
+ * @version $Id: BasePlot.java,v 1.1 2004-06-09 09:46:04 tjc Exp $
+ **/
+
+public class BasePlot extends Plot
+ implements DisplayAdjustmentListener, SelectionChangeListener {
+ /**
+ * Create a new FeatureDisplay object.
+ * @param algorithm The object that will generate the value we plot in
+ * this component.
+ * @param selection Used to set and display the current selection in the
+ * BasePlot.
+ * @param goto_event_source The object the we will call gotoBase () on.
+ * This allows the user to double click on a base in a BasePlot and have
+ * the FeatureDisplay follow.
+ **/
+ public BasePlot (final BaseAlgorithm algorithm,
+ final Selection selection,
+ final GotoEventSource goto_event_source) {
+ super (algorithm, false); // false means don't draw the scale line
+
+ this.selection = selection;
+ this.goto_event_source = goto_event_source;
+ this.bases = getBaseAlgorithm ().getBases ();
+
+ getSelection ().addSelectionChangeListener (this);
+
+ addPlotMouseListener (new PlotMouseListener () {
+ /**
+ * Set the selection to be a range from start_base to end_base.
+ **/
+ private void setSelectionRange (final int start_base,
+ final int end_base) {
+ final Strand strand = bases.getForwardStrand ();
+
+ try {
+ final MarkerRange marker_range =
+ strand.makeMarkerRangeFromPositions (start_base, end_base);
+ getSelection ().setMarkerRange (marker_range);
+ } catch (uk.ac.sanger.artemis.util.OutOfRangeException e) {
+ getSelection ().clear ();
+ }
+ }
+
+ /**
+ * Called when the user clicks somewhere on the plot canvas.
+ * @param position the base/amino acid position of the click. This is
+ * -1 if and only if the click was outside the graph (eg. in the
+ * label at the top)
+ **/
+ public void mouseClick (final int position) {
+
+ }
+
+ /**
+ * Called when the user drags the mouse over the plot.
+ * @param drag_start_position The base/amnino acid position where the
+ * drag started or -1 if the drag was started outside the graph.
+ * @param current_position the base/amino acid position of the click.
+ * This is -1 if and only if the user has dragged the mouse out of
+ * the graph (eg. in the label at the top)
+ **/
+ public void mouseDrag (int drag_start_position,
+ int current_position) {
+ if (rev_comp_display) {
+ drag_start_position =
+ bases.getComplementPosition (drag_start_position);
+ current_position =
+ bases.getComplementPosition (current_position);
+ }
+ setSelectionRange (drag_start_position,
+ current_position);
+ }
+
+ /**
+ * Called when the user double-clicks somewhere on the plot.
+ * @param position the base/amino acid position of the click. This is
+ * -1 if and only if the click was outside the graph (eg. in the
+ * label at the top)
+ **/
+ public void mouseDoubleClick (int position) {
+ if (rev_comp_display) {
+ position = bases.getComplementPosition (position);
+ }
+ setSelectionRange (position, position);
+ getGotoEventSource ().gotoBase (position);
+ }
+ });
+ }
+
+ /**
+ * Used by getPreferredSize () and getMinimumSize ();
+ **/
+ private final static int HEIGHT;
+
+ static {
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+
+ final Integer base_plot_height =
+ Options.getOptions ().getIntegerProperty ("base_plot_height");
+
+ if (base_plot_height == null) {
+ if (screen.height <= 600) {
+ HEIGHT = 100;
+ } else {
+ HEIGHT = 150;
+ }
+ } else {
+ HEIGHT = base_plot_height.intValue ();
+ }
+ }
+
+ /**
+ * Overridden to set the component height to 150.
+ **/
+ public Dimension getPreferredSize() {
+ return (new Dimension(getSize ().width, HEIGHT));
+ }
+
+ /**
+ * Overridden to set the component height to 150.
+ **/
+ public Dimension getMinimumSize() {
+ return (new Dimension(getSize ().width, HEIGHT));
+ }
+
+ /**
+ * Implementation of the DisplayAdjustmentListener interface. Invoked when
+ * a component or changes the scale.
+ **/
+ public void displayAdjustmentValueChanged (DisplayAdjustmentEvent event) {
+ start_base = event.getStart ();
+ end_base = event.getEnd ();
+ width_in_bases = event.getWidthInBases ();
+ rev_comp_display = event.isRevCompDisplay ();
+ recalculate_flag = true;
+
+ if (event.getType () == DisplayAdjustmentEvent.ALL_CHANGE_ADJUST_EVENT) {
+ selection_start_marker = null;
+ selection_end_marker = null;
+ }
+
+ repaintCanvas ();
+ }
+
+ /**
+ * We listen for SelectionChange events so that we can update the
+ * crosshairs.
+ **/
+ public void selectionChanged (SelectionChangeEvent event) {
+ selection_start_marker = null;
+ selection_end_marker = null;
+ repaintCanvas ();
+ }
+
+ /**
+ * Return the algorithm that was passed to the constructor.
+ **/
+ public BaseAlgorithm getBaseAlgorithm () {
+ return (BaseAlgorithm) super.getAlgorithm ();
+ }
+
+ /**
+ * Return the new start base to display, from the last event.
+ **/
+ private int getStart () {
+ return start_base;
+ }
+
+ /**
+ * Return the new end base to display, from the last event.
+ **/
+ private int getEnd () {
+ return end_base;
+ }
+
+ /**
+ * Return the width in bases of the display, from the last event.
+ **/
+ private int getWidthInBases () {
+ return width_in_bases;
+ }
+
+ /**
+ * This array is used by drawMultiValueGraph (). It is reallocated when
+ * the scale changes.
+ **/
+ private float [][] value_array_array = null;
+
+ /**
+ * The number of bases to step before each evaluation of the algorithm.
+ * (Set by recalculateValues ()).
+ **/
+ private int step_size = 0;
+
+ /**
+ * The maximum of the values in value_array_array.
+ **/
+ private float min_value = Float.MAX_VALUE;
+
+ /**
+ * The minimum of the values in value_array_array.
+ **/
+ private float max_value = Float.MIN_VALUE;
+
+ /**
+ * Recalculate the values in value_array_array, step_size, min_value and
+ * max_value.
+ **/
+ protected void recalculateValues () {
+ final Float algorithm_minimum = getAlgorithm ().getMinimum ();
+ final Float algorithm_maximum = getAlgorithm ().getMaximum ();
+
+ // use the Algorithm specified maximum if there is one - otherwise
+ // calculate it
+ if (algorithm_maximum == null) {
+ max_value = Float.MIN_VALUE;
+ } else {
+ max_value = algorithm_maximum.floatValue ();
+ }
+
+ // use the Algorithm specified minimum if there is one - otherwise
+ // calculate it
+ if (algorithm_minimum == null) {
+ min_value = Float.MAX_VALUE;
+ } else {
+ min_value = algorithm_minimum.floatValue ();
+ }
+
+ final int window_size = getWindowSize ();
+
+ final Integer default_step_size =
+ getAlgorithm ().getDefaultStepSize (window_size);
+
+ if (default_step_size == null) {
+ step_size = 1;
+ } else {
+ if (default_step_size.intValue () < window_size) {
+ step_size = default_step_size.intValue ();
+ } else {
+ step_size = window_size;
+ }
+ }
+
+ int real_start = getStart ();
+
+ if (real_start < 1) {
+ real_start = 1;
+ }
+
+ final int unit_count = getEnd () - real_start;
+
+ // the number of plot points in the graph
+ final int number_of_values =
+ (unit_count - (window_size - step_size)) / step_size;
+
+ if (number_of_values < 2) {
+ // there is nothing to plot
+ value_array_array = null;
+ return;
+ }
+
+ getBaseAlgorithm ().setRevCompDisplay (rev_comp_display);
+
+ // the number of values that getValues () will return
+ final int get_values_return_count =
+ getBaseAlgorithm ().getValueCount ();
+
+ if (value_array_array == null) {
+ value_array_array = new float [get_values_return_count][];
+ }
+
+ if (value_array_array[0] == null ||
+ value_array_array[0].length != number_of_values) {
+ for (int i = 0 ; i < value_array_array.length ; ++i) {
+ value_array_array[i] = new float [number_of_values];
+ }
+ } else {
+ // reuse the previous arrays
+ }
+
+ float [] temp_values = new float [get_values_return_count];
+
+ for (int i = 0 ; i < number_of_values ; ++i) {
+ getBaseAlgorithm ().getValues (real_start + i * step_size,
+ real_start + i * step_size +
+ window_size - 1,
+ temp_values);
+
+ for (int value_index = 0 ;
+ value_index < get_values_return_count ;
+ ++value_index) {
+ final float current_value = temp_values[value_index];
+
+ value_array_array[value_index][i] = current_value;
+
+ // use the Algorithm specified maximum if there is one - otherwise
+ // calculate it
+ if (algorithm_maximum == null) {
+ if (current_value > max_value) {
+ max_value = current_value;
+ }
+ }
+
+ // use the Algorithm specified minimum if there is one - otherwise
+ // calculate it
+ if (algorithm_minimum == null) {
+ if (current_value < min_value) {
+ min_value = current_value;
+ }
+ }
+ }
+ }
+
+ recalculate_flag = false;
+ }
+
+ /**
+ * Redraw the graph on the canvas using the algorithm, start_base and
+ * end_base. This method plots BaseWindowAlgorithm objects only.
+ * @param g The object to draw into.
+ **/
+ public void drawMultiValueGraph (Graphics g) {
+ if (recalculate_flag) {
+ recalculateValues ();
+ }
+
+ if (value_array_array == null) {
+ // there is nothing to draw - probably because the sequence is too short
+ drawMinMax (g, 0, 1);
+
+ return;
+ }
+
+ final int window_size = getWindowSize ();
+
+ // the number of values to plot at each x position
+ final int get_values_return_count =
+ getBaseAlgorithm ().getValueCount ();
+
+ final int number_of_values = value_array_array[0].length;
+
+ if (number_of_values > 1) {
+ drawGlobalAverage (g, min_value, max_value);
+ }
+
+ for (int value_index = 0 ;
+ value_index < get_values_return_count ;
+ ++value_index) {
+ if (get_values_return_count == 1) {
+ g.setColor (Color.black);
+ } else {
+ switch (value_index) {
+ case 0:
+ g.setColor (new Color (255, 0, 0));
+ break;
+ case 1:
+ g.setColor (new Color (0, 200, 0));
+ break;
+ case 2:
+ g.setColor (new Color (0, 0, 255));
+ break;
+ default:
+ g.setColor (Color.black);
+ }
+ }
+
+ final int offset;
+
+ if (getStart () < 1) {
+ offset = 1 - getStart ();
+ } else {
+ offset = 0;
+ }
+
+ drawPoints (g, min_value, max_value, step_size, window_size,
+ getWidthInBases (),
+ offset,
+ value_array_array[value_index]);
+ }
+
+ drawMinMax (g, min_value, max_value);
+
+ if (getCrossHairPosition () >= 0) {
+ final int cross_hair_position = getCrossHairPosition ();
+
+ final int selection_base = getPointPosition (cross_hair_position);
+
+ if (selection_base >= 1) {
+ if (selection_base > end_base) {
+ cancelCrossHairs ();
+ } else {
+ final String label_string;
+
+ if (rev_comp_display) {
+ label_string =
+ String.valueOf (bases.getLength () - selection_base + 1);
+ } else {
+ label_string = String.valueOf (selection_base);
+ }
+
+ drawCrossHair (g, cross_hair_position, label_string, 0);
+ }
+ }
+ }
+
+ if (getCrossHairPosition () >= 0 && getSelectionStartMarker () != null) {
+ final int selection_first_base =
+ getSelectionStartMarker ().getRawPosition ();
+
+ final String label_string;
+
+ if (rev_comp_display) {
+ label_string =
+ String.valueOf (bases.getLength () - selection_first_base + 1);
+ } else {
+ label_string = String.valueOf (selection_first_base);
+ }
+
+ if (Math.abs (selection_first_base -
+ getPointPosition (getCrossHairPosition ())) > 3) {
+ drawCrossHair (g, getCanvasPosition (selection_first_base),
+ label_string, 1);
+ } else {
+ // don't draw - too close to main cross hair
+ }
+ }
+
+ if (getCrossHairPosition () >= 0 && getSelectionEndMarker () != null) {
+ if (getSelectionStartMarker () != null &&
+ Math.abs ((getSelectionEndMarker ().getRawPosition () -
+ getSelectionStartMarker ().getRawPosition ())) >= 3) {
+ final int selection_last_base =
+ getSelectionEndMarker ().getRawPosition ();
+
+ final String label_string;
+
+ if (rev_comp_display) {
+ label_string =
+ String.valueOf (bases.getLength () - selection_last_base + 1);
+ } else {
+ label_string = String.valueOf (selection_last_base);
+ }
+
+ if (Math.abs (selection_last_base -
+ getPointPosition (getCrossHairPosition ())) > 3) {
+ drawCrossHair (g, getCanvasPosition (selection_last_base),
+ label_string, 2);
+ } else {
+ // don't draw - too close to main cross hair
+ }
+ }
+ }
+ }
+
+ /**
+ * Get the position in the Feature of the given canvas x position. This
+ * base position is the label used when the user clicks the mouse in on the
+ * canvas (see drawCrossHair ()).
+ **/
+ protected int getPointPosition (final int canvas_x_position) {
+ return (int) ((1.0 * canvas_x_position / getCanvas ().getSize ().width) *
+ getWidthInBases ()) + getStart ();
+ }
+
+ /**
+ * Return the canvas position of the given base,
+ **/
+ private int getCanvasPosition (final int base) {
+ return (int) ((1.0 * base - getStart ()) / getWidthInBases () *
+ getCanvas ().getSize ().width);
+ }
+
+ /**
+ * Return the Marker of the start base of the Selection or null if there is
+ * nothing selected.
+ **/
+ private Marker getSelectionStartMarker () {
+ if (selection_start_marker == null) {
+ selection_start_marker = getSelection ().getLowestBaseOfSelection ();
+
+ if (selection_start_marker != null &&
+ rev_comp_display) {
+ final Strand strand = bases.getReverseStrand ();
+ final int orig_position = selection_start_marker.getRawPosition ();
+ final int rev_comp_position =
+ bases.getComplementPosition (orig_position);
+ try {
+ selection_start_marker = strand.makeMarker (orig_position);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+ }
+
+ return selection_start_marker;
+ }
+
+ /**
+ * Return the Marker of the end base of the Selection or null if there is
+ * nothing selected.
+ **/
+ private Marker getSelectionEndMarker () {
+ if (selection_end_marker == null) {
+ selection_end_marker = getSelection ().getHighestBaseOfSelection ();
+
+ if (selection_end_marker != null &&
+ rev_comp_display) {
+ final Strand strand = bases.getReverseStrand ();
+ final int orig_position = selection_end_marker.getRawPosition ();
+ final int rev_comp_position =
+ bases.getComplementPosition (orig_position);
+ try {
+ selection_end_marker = strand.makeMarker (orig_position);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+ }
+
+ return selection_end_marker;
+ }
+
+ /**
+ * Return the Selection object that was passed to the constructor.
+ **/
+ private Selection getSelection () {
+ return selection;
+ }
+
+ /**
+ * Return the GotoEventSource object that was passed to the constructor.
+ **/
+ private GotoEventSource getGotoEventSource () {
+ return goto_event_source;
+ }
+
+ /**
+ * The start base to plot, as obtained from the DisplayAdjustmentEvent.
+ **/
+ private int start_base;
+
+ /**
+ * The end base to plot, as obtained from the DisplayAdjustmentEvent.
+ **/
+ private int end_base;
+
+ /**
+ * The width in bases of the display, as obtained from the
+ * DisplayAdjustmentEvent.
+ **/
+ private int width_in_bases;
+
+ /**
+ * True if and only if the FeatureDisplay is drawing in reverse complement
+ * mode.
+ **/
+ private boolean rev_comp_display;
+
+ /**
+ * The Bases that this BasePlot is graphing.
+ **/
+ private Bases bases;
+
+ /**
+ * The Marker of the start of the selection. This is a cache used by
+ * getSelectionStartMarker ().
+ **/
+ private Marker selection_start_marker = null;
+
+ /**
+ * The Marker of the end of the selection. This is a cache used by
+ * getSelectionEndMarker ()
+ **/
+ private Marker selection_end_marker = null;
+
+ /**
+ * The Selection that was passed to the constructor.
+ **/
+ private Selection selection;
+
+ /**
+ * The GotoEventSource that was passed to the constructor.
+ **/
+ private GotoEventSource goto_event_source;
+}
diff --git a/uk/ac/sanger/artemis/components/BasePlotGroup.java b/uk/ac/sanger/artemis/components/BasePlotGroup.java
new file mode 100644
index 000000000..09a5bbaaf
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/BasePlotGroup.java
@@ -0,0 +1,337 @@
+/* BasePlotGroup.java
+ *
+ * created: Tue Dec 15 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/BasePlotGroup.java,v 1.1 2004-06-09 09:46:05 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+import uk.ac.sanger.artemis.plot.*;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.io.IOException;
+import java.io.File;
+import java.util.Vector;
+
+import javax.swing.*;
+
+/**
+ * This is a super-component containing several BasePlot components, each of
+ * which can toggled off and on.
+ *
+ * @author Kim Rutherford
+ * @version $Id: BasePlotGroup.java,v 1.1 2004-06-09 09:46:05 tjc Exp $
+ **/
+
+public class BasePlotGroup extends JPanel
+ implements DisplayAdjustmentListener {
+ /**
+ * Create a new BasePlotGroup component for the given EntryGroup.
+ * @param selection Used to set and display the current selection in the
+ * BasePlot.
+ * @param goto_event_source The object the we will call gotoBase () on.
+ * This allows the user to double click on a base in a BasePlot and have
+ * the FeatureDisplay follow.
+ **/
+ public BasePlotGroup (final EntryGroup entry_group,
+ final Component owning_component,
+ final Selection selection,
+ final GotoEventSource goto_event_source) {
+ this.owning_component = owning_component;
+ this.entry_group = entry_group;
+ this.selection = selection;
+ this.goto_event_source = goto_event_source;
+
+ final Strand forward_strand =
+ entry_group.getBases ().getForwardStrand ();
+
+ final Strand reverse_strand =
+ entry_group.getBases ().getReverseStrand ();
+
+ // the following arrays are from failed tests
+ final float [] [] test_weights = {
+ {1, 0,39,99,11}, // a
+ {76,8,15,1,45}, // c
+ {2,0,42,0,6}, // g
+ {21,91,4,0,38} // t
+ };
+
+ final float [] [] test_weights2 = {
+ {11,11,10, 8,11,10,11,11, 7, 8,25, 3,100, 0,27},
+ {29,33,30,30,32,34,37,38,39,36,26,75, 0, 0,14},
+ {14,12,10,10, 9,11,10, 9, 7, 6,26, 1, 0,100,49},
+ {46,44,50,52,48,45,42,43,47,51,23,21, 0, 0,10}
+ };
+
+ final float [] [] test_weights3 = {
+ {0,0,1,0,0,0},
+ {0,0,0,1,0,0},
+ {1,0,0,0,1,0},
+ {0,1,0,0,0,1},
+ };
+
+ final float [] cai_test = {
+ 0.113F, 1.0F, 0.117F, 1.0F,
+ 1.0F, 0.693F, 0.036F, 0.005F,
+ 0.071F, 1.0F, 0.0F, 0.0F,
+ 1.0F, 0.077F, 0.0F, 1.0F,
+
+ 0.006F, 0.003F, 0.039F, 0.003F,
+ 0.047F, 0.009F, 1.0F, 0.002F,
+ 0.245F, 1.0F, 1.0F, 0.007F,
+ 0.137F, 0.002F, 0.002F, 0.002F,
+
+ 0.823F, 1.0F, 0.003F, 1.0F,
+ 0.921F, 1.0F, 0.012F, 0.006F,
+ 0.053F, 1.0F, 0.135F, 1.0F,
+ 0.021F, 0.031F, 1.0F, 0.003F,
+
+ 1.0F, 0.831F, 0.002F, 0.018F,
+ 1.0F, 0.316F, 0.015F, 0.001F,
+ 0.554F, 1.0F, 1.0F, 0.016F,
+ 1.0F, 0.02F, 0.002F, 0.004F
+ };
+
+// plot_algorithms_temp.add (new CAIWindowAlgorithm (forward_strand, cai_test));
+// plot_algorithms_temp.add (new UserBaseAlgorithm (forward_strand, "test", test_weights));
+// plot_algorithms_temp.add (new UserBaseAlgorithm (forward_strand, "test2", test_weights2));
+// plot_algorithms_temp.add (new UserBaseAlgorithm (forward_strand, "test3", test_weights3));
+
+ setLayout (gridbag);
+
+ c.fill = GridBagConstraints.HORIZONTAL;
+ c.anchor = GridBagConstraints.NORTH;
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ c.gridheight = 1;
+ c.weightx = 1;
+ c.weighty = 0;
+
+ c.insets = new Insets (0,0,5,0);
+
+ addAlgorithm (new GCWindowAlgorithm (forward_strand));
+ addAlgorithm (new GCSDWindowAlgorithm (forward_strand));
+ addAlgorithm (new AGWindowAlgorithm (forward_strand));
+ addAlgorithm (new GCFrameAlgorithm (forward_strand));
+ addAlgorithm (new GCFrameAlgorithm (reverse_strand));
+ addAlgorithm (new Codon12CorrelationAlgorithm(forward_strand));
+ addAlgorithm (new Codon12CorrelationAlgorithm(reverse_strand));
+ addAlgorithm (new GCDeviationAlgorithm (forward_strand));
+ addAlgorithm (new ATDeviationAlgorithm (forward_strand));
+ addAlgorithm (new KarlinSigAlgorithm (forward_strand));
+ }
+
+ /**
+ * Implementation of the DisplayAdjustmentListener interface. Invoked when
+ * a component (FeatureDisplay) scrolls or changes the scale. Sends the
+ * event to all the BasePlot components in this BasePlotGroup.
+ **/
+ public void displayAdjustmentValueChanged (DisplayAdjustmentEvent event) {
+ final Component [] children = getComponents ();
+
+ for (int i = 0 ; i < children.length ; ++i) {
+ if (children[i] instanceof BasePlot) {
+ ((BasePlot)children[i]).displayAdjustmentValueChanged (event);
+ }
+ }
+ }
+
+ /**
+ * Add a new BasePlot component for the given algorithm.
+ * @return The new BasePlot
+ **/
+ public BasePlot addAlgorithm (final BaseAlgorithm algorithm) {
+ plot_value_producers.addElement (algorithm);
+
+ return makePlot (algorithm, gridbag, c);
+ }
+
+ /**
+ * Return the first CodonUsageAlgorithm or null if there isn't one in the
+ * group.
+ **/
+ public CodonUsageAlgorithm getCodonUsageAlgorithm () {
+ for (int i = 0 ; i < plot_value_producers.size () ; ++i) {
+ final BaseAlgorithm this_algorithm =
+ (BaseAlgorithm) plot_value_producers.elementAt (i);
+
+ if (this_algorithm instanceof CodonUsageAlgorithm) {
+ return (CodonUsageAlgorithm) this_algorithm;
+ }
+ }
+
+ return null;
+ }
+
+ /**
+ * Return an array containing the Algorithm objects of the BasePlot
+ * components in this BasePlotGroup.
+ **/
+ public BaseAlgorithm [] getPlotAlgorithms () {
+ final BaseAlgorithm [] return_array =
+ new BaseAlgorithm [plot_value_producers.size ()];
+
+ for (int i = 0 ; i < plot_value_producers.size () ; ++i) {
+ final BaseAlgorithm this_algorithm =
+ (BaseAlgorithm) plot_value_producers.elementAt (i);
+ return_array[i] = this_algorithm;
+ }
+
+ return return_array;
+ }
+
+ /**
+ * Return true if and only if the BasePlot for the given Algorithm is
+ * visible.
+ **/
+ public boolean basePlotIsVisible (final Algorithm algorithm) {
+ final Component base_plot = findPlotByAlgorithm (algorithm);
+
+ return base_plot.isVisible ();
+ }
+
+ /**
+ * Given an Algorithm, find and set the visibility of the corresponding
+ * BasePlot component.
+ **/
+ public void setVisibleByAlgorithm (final Algorithm algorithm,
+ final boolean visible) {
+ final JComponent base_plot = findPlotByAlgorithm (algorithm);
+
+ base_plot.setVisible (visible);
+ if (getParent () != null) {
+ // XXX change to revalidate().
+ getParent ().validate ();
+ }
+ }
+
+ /**
+ * Find the BasePlot component in this BasePlotGroup object that is
+ * plotting the given Algorithm or null if no such BasePlot object exists.
+ **/
+ private JComponent findPlotByAlgorithm (final Algorithm algorithm) {
+ final Component [] children = getComponents ();
+
+ for (int i = 0 ; i < children.length ; ++i) {
+ if (children[i] instanceof BasePlot) {
+ final Algorithm component_algorithm =
+ ((BasePlot)children[i]).getAlgorithm ();
+ if (component_algorithm == algorithm) {
+ return (JComponent)children[i];
+ }
+ }
+ }
+
+ return null;
+ }
+
+ /**
+ * Create a Plot component for the given Algorithm and then make a button
+ * for it so that it can be shown and hidden. Note that button making is
+ * currently disabled
+ * @param algorithm The Algorithm to create a Plot of.
+ * @param gridbag The GridBagLayout to use to lay out the Plot components.
+ * @param constraints The GridBagConstraints object to use to lay out the
+ * Plot components.
+ * @return The new BasePlot
+ **/
+ private BasePlot makePlot (BaseAlgorithm algorithm,
+ GridBagLayout gridbag,
+ GridBagConstraints constraints) {
+
+ final BasePlot new_base_plot =
+ new BasePlot (algorithm, getSelection (), getGotoEventSource ());
+
+ gridbag.setConstraints (new_base_plot, constraints);
+ add (new_base_plot);
+ new_base_plot.setVisible (false);
+
+ getSelection ().addSelectionChangeListener (new_base_plot);
+
+ if (getParent () != null) {
+ // XXX change to revalidate().
+ getParent ().validate ();
+ }
+
+ return new_base_plot;
+ }
+
+ /**
+ * Return the Selection object that was passed to the constructor.
+ **/
+ private Selection getSelection () {
+ return selection;
+ }
+
+ /**
+ * Return the EntryGroup object that was passed to the constructor.
+ **/
+ private EntryGroup getEntryGroup () {
+ return entry_group;
+ }
+
+ /**
+ * Return the GotoEventSource object that was passed to the constructor.
+ **/
+ private GotoEventSource getGotoEventSource () {
+ return goto_event_source;
+ }
+
+ /**
+ * The EntryGroup that contains the sequence that this JComponent is
+ * displaying.
+ **/
+ private final EntryGroup entry_group;
+
+ /**
+ * This array contains the Algorithm objects of the BasePlot components in
+ * this BasePlotGroup, as set by the constructor.
+ **/
+ private final Vector plot_value_producers = new Vector ();
+
+ /**
+ * The layout object used by this component.
+ **/
+ private final GridBagLayout gridbag = new GridBagLayout();
+
+ /**
+ * The constraints object used by this component.
+ **/
+ private final GridBagConstraints c = new GridBagConstraints();
+
+ /**
+ * The Selection that was passed to the constructor.
+ **/
+ private Selection selection;
+
+ /**
+ * The GotoEventSource that was passed to the constructor.
+ **/
+ private GotoEventSource goto_event_source;
+
+ /**
+ * This is a reference to the parent Container of this BasePlot object.
+ **/
+ private Component owning_component;
+}
diff --git a/uk/ac/sanger/artemis/components/BioJavaEntrySource.java b/uk/ac/sanger/artemis/components/BioJavaEntrySource.java
new file mode 100644
index 000000000..8f9a64ce7
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/BioJavaEntrySource.java
@@ -0,0 +1,223 @@
+/* BioJavaEntrySource.java
+ *
+ * created: Tue Apr 10 2001
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/BioJavaEntrySource.java,v 1.1 2004-06-09 09:46:06 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import java.net.*;
+import java.io.*;
+import java.util.*;
+import java.lang.RuntimeException;
+
+import org.biojava.bio.program.das.*;
+import org.biojava.bio.BioException;
+import org.biojava.bio.seq.io.SequenceBuilderFactory;
+import org.biojava.bio.seq.io.EmblProcessor;
+import org.biojava.bio.seq.io.SmartSequenceBuilder;
+import org.biojava.bio.seq.io.SymbolTokenization;
+import org.biojava.bio.seq.io.StreamReader;
+import org.biojava.bio.seq.io.SequenceFormat;
+import org.biojava.bio.seq.io.EmblLikeFormat;
+import org.biojava.bio.seq.SequenceIterator;
+import org.biojava.bio.symbol.Alphabet;
+import org.biojava.bio.seq.DNATools;
+
+import uk.ac.sanger.artemis.util.*;
+import uk.ac.sanger.artemis.io.BioJavaEntry;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.SimpleEntryInformation;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+/**
+ * This is an EntrySource that reads Entry objects from a BioJava Sequence
+ * object.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: BioJavaEntrySource.java,v 1.1 2004-06-09 09:46:06 tjc Exp $
+ **/
+
+public class BioJavaEntrySource implements EntrySource
+{
+ /**
+ * Create a new BioJavaEntrySource.
+ **/
+ public BioJavaEntrySource () {
+
+ }
+
+ /**
+ * Get an Entry object from this source (by reading from a file, reading
+ * from a CORBA server, or whatever).
+ * @param bases The Bases object to pass to the Entry constructor.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading. (Not implemented)
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @return null if and only if the read is cancelled by the user or if the
+ * read fails.
+ **/
+ public Entry getEntry (final Bases bases, final ProgressThread progress_thread,
+ final boolean show_progress)
+ throws OutOfRangeException, IOException
+ {
+ final String fileName = "/nfs/team81/kmr/pow/java2/AB000095.embl";
+ final FileDocument document = new FileDocument (new File (fileName));
+
+ final BioJavaEntry emblEntry =
+ new BioJavaEntry (document, new EmblLikeFormat ());
+
+ return new Entry (bases, emblEntry);
+ }
+
+ /**
+ * Get an Entry object from this source (by reading from a file, reading
+ * from a CORBA server, or whatever).
+ * @param bases The Bases object to pass to the Entry constructor.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading. (Not implemented)
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @return null if and only if the read is cancelled by the user or if the
+ * read fails.
+ **/
+ public Entry getEntry (final Bases bases, final boolean show_progress)
+ throws OutOfRangeException, IOException
+ {
+ return getEntry(bases, null, show_progress);
+ }
+
+ /**
+ * Get an Entry object from this source (by reading from a file, reading
+ * from a CORBA server, or whatever). A Bases object will be created for
+ * the sequence of the new Entry.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading. (Not implemented)
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @exception NoSequenceException Thrown if the entry that we read has no
+ * sequence.
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ **/
+ public Entry getEntry(final boolean show_progress,
+ final ProgressThread progress_thread)
+ throws OutOfRangeException, NoSequenceException, IOException
+ {
+ return getEntry(show_progress);
+ }
+
+ /**
+ * Get an Entry object from this source (by reading from a file, reading
+ * from a CORBA server, or whatever). A Bases object will be created for
+ * the sequence of the new Entry.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading. (Not implemented)
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @exception NoSequenceException Thrown if the entry that we read has no
+ * sequence.
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ **/
+ public Entry getEntry (final boolean show_progress)
+ throws OutOfRangeException, NoSequenceException, IOException
+ {
+// DASSequence dasSeq = null;
+
+// try {
+// final URL dbURL =
+// new URL("http://genome.ornl.gov/das/das.cgi/ecoli");
+// // new URL("http://genome.cse.ucsc.edu:80/cgi-bin/das/cb1");
+// // new URL("http://servlet.sanger.ac.uk:8080/das/ens1131cds/");
+// final DASSequenceDB dasDB = new DASSequenceDB (dbURL);
+
+// final Set ids = dasDB.ids();
+
+// for (Iterator i = ids.iterator(); i.hasNext(); ) {
+// System.out.println(i.next().toString());
+// }
+
+// // dasSeq = (DASSequence) dasDB.getSequence((String) ids.iterator().next());
+
+// SequenceIterator si = dasDB.sequenceIterator();
+
+// if (si.hasNext()) {
+// dasSeq = (DASSequence) si.nextSequence();
+
+// System.err.println("Got: " + dasSeq);
+
+// final BioJavaEntry bioJavaEntry = new BioJavaEntry (dasSeq);
+
+// return new Entry (bioJavaEntry);
+// } else {
+// System.err.println("No more sequences...");
+// }
+
+
+// // final BioJavaEntry emblEntry =
+// // new BioJavaEntry (document, new EmblLikeFormat ());
+
+// // return new Entry (emblEntry);
+// } catch (MalformedURLException mue) {
+// mue.printStackTrace();
+// } catch (BioException be) {
+// be.printStackTrace();
+// }
+
+// return null;
+
+ final String fileName = "/nfs/team81/kmr/pow/java2/AE002734.game";
+ final FileDocument document = new FileDocument (new File (fileName));
+
+ final BioJavaEntry emblEntry =
+ new BioJavaEntry (document, new EmblLikeFormat ());
+
+ return new Entry (emblEntry);
+
+// final String fileName = "/nfs/team81/kmr/pow/java2/AB000095.embl";
+// final FileDocument document = new FileDocument (new File (fileName));
+
+// final BioJavaEntry emblEntry =
+// new BioJavaEntry (document, new EmblLikeFormat ());
+
+// return new Entry (emblEntry);
+ }
+
+ /**
+ * Returns true if and only if this EntrySource always returns "full"
+ * entries. ie. entries that contain features and sequence.
+ **/
+ public boolean isFullEntrySource () {
+ return true;
+ }
+
+ /**
+ * Return the name of this source (for display to the user in menus).
+ **/
+ public String getSourceName () {
+ return "BioJava";
+ }
+}
diff --git a/uk/ac/sanger/artemis/components/CanvasPanel.java b/uk/ac/sanger/artemis/components/CanvasPanel.java
new file mode 100644
index 000000000..cd0c1386a
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/CanvasPanel.java
@@ -0,0 +1,240 @@
+/* CanvasPanel.java
+ *
+ * created: Sat Jun 17 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/CanvasPanel.java,v 1.1 2004-06-09 09:46:07 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.Options;
+
+import java.awt.*;
+import java.awt.event.*;
+import javax.swing.*;
+
+/**
+ * This is a JPanel that contains a JPanel containing a JComponent. Both Panels
+ * have BorderLayout. The JComponent is added at "Center".
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: CanvasPanel.java,v 1.1 2004-06-09 09:46:07 tjc Exp $
+ **/
+
+abstract public class CanvasPanel extends JPanel
+{
+
+ /**
+ * Off screen image used for double buffering when drawing the canvas.
+ **/
+ private Image offscreen;
+
+ /** Contains the canvas. */
+ private JPanel mid_panel = null;
+
+ /** The drawing area for this component. */
+ private JComponent canvas = null;
+
+ /** The height of the font used in this component. */
+ private int font_ascent;
+
+ /** maximum height of the font used in this component. */
+ private int font_max_ascent;
+
+ /** descent of the font used in this component. */
+ private int font_descent;
+
+ /** The(maximum) width of the font used in this component. */
+ private int font_width;
+
+ /** base line of the font used in this component. */
+ private int font_base_line;
+
+ /**
+ * Create a new JPanel(mid_panel) and a JComponent.
+ **/
+ public CanvasPanel()
+ {
+ setLayout(new BorderLayout());
+ setFontInfo();
+ createCanvas();
+ }
+
+ /**
+ * Call repaint() on the canvas object.
+ **/
+ protected void repaintCanvas()
+ {
+ getCanvas().repaint();
+ }
+
+ /**
+ * Create a JPanel(mid_panel) and a JComponent object.
+ **/
+ private void createCanvas()
+ {
+ mid_panel = new JPanel();
+ mid_panel.setLayout(new BorderLayout());
+
+ canvas = new JComponent()
+ {
+ /**
+ * Set the offscreen buffer to null as part of invalidation.
+ **/
+ public void invalidate()
+ {
+ super.invalidate();
+ offscreen = null;
+ }
+
+ /**
+ * Override update to *not* erase the background before painting
+ */
+ public void update(final Graphics g)
+ {
+ paint(g);
+ }
+
+ /**
+ * Paint the canvas.
+ */
+ public void paint(final Graphics g)
+ {
+ final int canvas_width = canvas.getSize().width;
+ final int canvas_height = canvas.getSize().height;
+
+ // there is no point drawing into a zero width canvas
+ if(canvas_height <= 0 || canvas_width <= 0)
+ return;
+
+ if(!canvas.isVisible())
+ return;
+
+ if(offscreen == null)
+ offscreen = canvas.createImage(canvas_width, canvas_height);
+
+ Graphics og = offscreen.getGraphics();
+ og.setClip(0, 0, canvas_width, canvas_height);
+
+ paintCanvas(og);
+ g.drawImage(offscreen, 0, 0, null);
+ g.dispose();
+ }
+ };
+
+ mid_panel.add(canvas, "Center");
+ add(mid_panel, "Center");
+ }
+
+ /**
+ * Return the JComponent that was created by createCanvas().
+ **/
+ protected JComponent getCanvas()
+ {
+ return canvas;
+ }
+
+ /**
+ * Returns the sub-JPanel that contains the JComponent.
+ **/
+ protected JPanel getMidPanel()
+ {
+ return mid_panel;
+ }
+
+ /**
+ * Called by canvas.paint() when
+ **/
+ abstract protected void paintCanvas(final Graphics graphics);
+
+ /**
+ * Set font_width and font_ascent from the default font.
+ **/
+ private void setFontInfo()
+ {
+ FontMetrics fm = getFontMetrics(getFont());
+
+ // find the width of a wide character
+ font_width = fm.charWidth('M');
+ font_ascent = fm.getAscent();
+ font_max_ascent = fm.getMaxAscent();
+ font_descent = fm.getDescent();
+ }
+
+ /**
+ * Return the width of the canvas.
+ **/
+ public int getCanvasWidth()
+ {
+ return getCanvas().getSize().width;
+ }
+
+ /**
+ * Return the height of the canvas.
+ **/
+ public int getCanvasHeight()
+ {
+ return getCanvas().getSize().height;
+ }
+
+ /**
+ * Return the width of our font, as calculated by setFontInfo().
+ **/
+ public int getFontWidth()
+ {
+ return font_width;
+ }
+
+ /**
+ * Return the ascent(height above the baseline) of our font, as calculated
+ * by setFontInfo().
+ **/
+ public int getFontAscent()
+ {
+ return font_ascent;
+ }
+
+ /**
+ * Return the max ascent(height above the baseline) of our font, as
+ * calculated by setFontInfo().
+ **/
+ public int getFontMaxAscent()
+ {
+ return font_ascent;
+ }
+
+ /**
+ * Return the descent of our font, as calculated by setFontInfo().
+ **/
+ public int getFontDescent()
+ {
+ return font_descent;
+ }
+
+ /**
+ * The max ascent + descent of the default font.
+ **/
+ public int getFontHeight()
+ {
+ return getFontMaxAscent() + getFontDescent();
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/ChoiceFrame.java b/uk/ac/sanger/artemis/components/ChoiceFrame.java
new file mode 100644
index 000000000..e63fba0ed
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ChoiceFrame.java
@@ -0,0 +1,111 @@
+/* ChoiceFrame.java
+ *
+ * created: Tue Aug 6 2002
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ChoiceFrame.java,v 1.1 2004-06-09 09:46:08 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.util.StringVector;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * A Choice in a JFrame.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: ChoiceFrame.java,v 1.1 2004-06-09 09:46:08 tjc Exp $
+ **/
+
+public class ChoiceFrame extends JFrame {
+ /**
+ * Create a new ChoiceFrame component with the given list of Strings.
+ **/
+ public ChoiceFrame (final String choice_title, final StringVector strings) {
+ super (choice_title);
+
+ choice = new JComboBox ();
+
+ for (int i = 0 ; i < strings.size () ; ++i) {
+ choice.addItem (strings.elementAt (i));
+ }
+
+ final JPanel choice_panel = new JPanel ();
+ choice_panel.add (choice);
+
+ getContentPane ().add (choice_panel, "Center");
+
+ final JPanel panel = new JPanel ();
+
+ panel.add (ok_button);
+ ok_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ ChoiceFrame.this.dispose ();
+ }
+ });
+
+ panel.add (close_button);
+ close_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ ChoiceFrame.this.dispose ();
+ }
+ });
+
+ getContentPane ().add (panel, "South");
+ pack ();
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ ChoiceFrame.this.dispose ();
+ }
+ });
+
+ pack ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+ }
+
+ /**
+ * Return the Choice component that is displayed in this JFrame.
+ **/
+ public JComboBox getChoice () {
+ return choice;
+ }
+
+ /**
+ * Return the reference of the OK button of this Chooser.
+ **/
+ public JButton getOKButton () {
+ return ok_button;
+ }
+
+ private JComboBox choice;
+
+ final private JButton ok_button = new JButton ("OK");
+
+ final private JButton close_button = new JButton ("Cancel");
+}
diff --git a/uk/ac/sanger/artemis/components/ComparatorDialog.java b/uk/ac/sanger/artemis/components/ComparatorDialog.java
new file mode 100644
index 000000000..6b02d052e
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ComparatorDialog.java
@@ -0,0 +1,331 @@
+/* ComparatorDialog.java
+ *
+ * created: Wed May 10 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ComparatorDialog.java,v 1.1 2004-06-09 09:46:09 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import uk.ac.sanger.artemis.util.OutOfRangeException;
+import uk.ac.sanger.artemis.io.EntryInformationException;
+import uk.ac.sanger.artemis.util.InputStreamProgressListener;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.io.*;
+import java.util.Vector;
+
+import javax.swing.*;
+
+/**
+ * ComparatorDialog a dialog that allows the user to the choose two files to
+ * compare with a Comparator component and a file containing comparison data.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: ComparatorDialog.java,v 1.1 2004-06-09 09:46:09 tjc Exp $
+ **/
+
+public class ComparatorDialog extends JFrame
+{
+ /**
+ * Create a dialog that allow the user to the choose two files to compare
+ * and a file containing comparison data.
+ * @param ActMain the object to call makeMultiComparator() on
+ **/
+ public ComparatorDialog(final ActMain act_main)
+ {
+ final JPanel top_panel = new JPanel();
+
+ getContentPane().add(top_panel, "Center");
+
+ final GridBagLayout gridbag = new GridBagLayout();
+ top_panel.setLayout(gridbag);
+
+ final Vector text_field_vector = new Vector();
+
+ for(int i = 0; i < 3; ++i)
+ {
+ final String label;
+ switch(i)
+ {
+ case 0:
+ label = "Sequence file 1";
+ break;
+ case 1:
+ label = "Comparison file 1";
+ break;
+ case 2:
+ label = "Sequence file 2";
+ break;
+ default:
+ throw new Error("internal error");
+ }
+
+ final JTextField text_field =
+ makeFileNamePanel(label, top_panel, gridbag);
+
+ text_field_vector.addElement(text_field);
+ }
+
+
+ final GridBagConstraints c = new GridBagConstraints();
+ c.fill = GridBagConstraints.HORIZONTAL;
+ c.anchor = GridBagConstraints.NORTH;
+ c.weighty = 0;
+ c.gridwidth = 1;
+
+ final JButton more_button = new JButton("more files ...");
+
+ final JPanel more_button_panel = new JPanel();
+ more_button_panel.setLayout(new FlowLayout(FlowLayout.LEFT));
+ more_button_panel.add(more_button);
+
+ c.gridwidth = 1;
+ gridbag.setConstraints(more_button_panel, c);
+ top_panel.add(more_button_panel);
+
+ more_button.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ top_panel.remove(more_button_panel);
+
+ final boolean add_sequence_flag;
+
+ if(text_field_vector.size() % 2 == 0 ||
+ Options.getOptions().isNoddyMode())
+ add_sequence_flag = true;
+ else
+ add_sequence_flag = false;
+
+ if(text_field_vector.size() % 2 == 1 ||
+ Options.getOptions().isNoddyMode())
+ {
+ final String seq_label =
+ "Comparison file " +(text_field_vector.size() / 2 + 1);
+ final JTextField seq_text_field =
+ makeFileNamePanel(seq_label, top_panel, gridbag);
+
+ text_field_vector.addElement(seq_text_field);
+ }
+
+ if(add_sequence_flag)
+ {
+ final String comp_label =
+ "Sequence file " +(text_field_vector.size() / 2 + 1);
+ final JTextField comp_text_field =
+ makeFileNamePanel(comp_label, top_panel, gridbag);
+
+ text_field_vector.addElement(comp_text_field);
+ }
+
+ top_panel.add(more_button_panel);
+
+ packAndCentre();
+ }
+ });
+
+
+ final JButton apply_button = new JButton("Apply");
+
+ apply_button.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ doApply(act_main, text_field_vector);
+ }
+ });
+
+
+ final JButton close_button = new JButton("Close");
+
+ close_button.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ ComparatorDialog.this.dispose();
+ }
+ });
+
+
+ final FlowLayout flow_layout =
+ new FlowLayout(FlowLayout.CENTER, 15, 5);
+
+ final JPanel close_and_apply_panel = new JPanel(flow_layout);
+
+ close_and_apply_panel.add(apply_button);
+ close_and_apply_panel.add(close_button);
+
+ getContentPane().add(close_and_apply_panel, "South");
+
+
+ addWindowListener(new WindowAdapter()
+ {
+ public void windowClosing(WindowEvent event)
+ {
+ ComparatorDialog.this.dispose();
+ }
+ });
+
+ packAndCentre();
+ }
+
+ /**
+ * Call pack() and then centre the JFrame in the middle of the screen.
+ **/
+ private void packAndCentre()
+ {
+ pack();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation(new Point((screen.width - getSize().width) / 2,
+ (screen.height - getSize().height) / 2));
+ }
+
+ /**
+ * Make a panel for choosing one file name panel.
+ **/
+ private JTextField makeFileNamePanel(final String label_string,
+ final JPanel parent_panel,
+ final GridBagLayout gridbag)
+ {
+ GridBagConstraints c = new GridBagConstraints();
+
+ c.fill = GridBagConstraints.HORIZONTAL;
+ c.anchor = GridBagConstraints.NORTH;
+ c.weighty = 0;
+
+ final JLabel label = new JLabel(label_string);
+
+ final JPanel panel = new JPanel();
+ panel.setLayout(new FlowLayout(FlowLayout.LEFT));
+ panel.add(label);
+
+ c.gridwidth = 1;
+ gridbag.setConstraints(panel, c);
+ parent_panel.add(panel);
+
+ final TextFieldSink text_field = new TextFieldSink("", 28);
+ gridbag.setConstraints(text_field, c);
+ parent_panel.add(text_field);
+
+ final JButton choose_button = new JButton("Choose ...");
+
+ choose_button.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent _)
+ {
+ final StickyFileChooser file_dialog =
+ new StickyFileChooser();
+
+ file_dialog.setDialogTitle("Choose first sequence ...");
+ file_dialog.setFileSelectionMode(JFileChooser.FILES_ONLY);
+ file_dialog.setDialogType(JFileChooser.OPEN_DIALOG);
+
+ file_dialog.showOpenDialog(ComparatorDialog.this);
+
+ if(file_dialog.getSelectedFile() != null)
+ {
+ final File selected_file =
+ new File(file_dialog.getCurrentDirectory(),
+ file_dialog.getSelectedFile().getName());
+
+ text_field.setText(selected_file.toString());
+ }
+ }
+ });
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints(choose_button, c);
+ parent_panel.add(choose_button);
+
+ return text_field;
+ }
+
+ /**
+ * Attempt to call ActMain.makeComparator() for the given file names.
+ * @param ActMain the object to call makeMultiComparator() on
+ **/
+ private void doApply(final ActMain act_main,
+ final Vector text_field_vector)
+ {
+ if(text_field_vector.size() < 3)
+ throw new Error("internal error - not enough file names given to " +
+ "ComparatorDialog.doApply()");
+
+ String [] file_names = new String [text_field_vector.size()];
+
+ for(int i = 0; i < text_field_vector.size(); ++i)
+ {
+ file_names[i] =
+ ((JTextField) text_field_vector.elementAt(i)).getText().trim();
+
+ if(file_names[i].length() == 0)
+ {
+ // ignore the problem if there are at least 3 files listed(ie. seq1
+ // comp1v2 seq2) and the remaining files lengths are zero
+ if(i > 3)
+ {
+ // set to true if a text field is found that isn't zero length
+ boolean found_file = false;
+
+ for(int sub_index = i; sub_index < text_field_vector.size();
+ ++sub_index)
+ {
+ final JTextField text_field =
+ (JTextField) text_field_vector.elementAt(sub_index);
+
+ final String this_text = text_field.getText().trim();
+
+ if(this_text.length() != 0)
+ found_file = true;
+ }
+
+ if(!found_file)
+ {
+ // truncate file_names
+ final String [] new_file_names = new String [i];
+ System.arraycopy(file_names, 0, new_file_names, 0, i);
+ file_names = new_file_names;
+ break;
+ }
+ }
+
+ new MessageDialog(this, "one of the file names is missing");
+ return;
+ }
+ }
+
+ final MessageFrame reading_message = new MessageFrame("reading ...");
+
+ final InputStreamProgressListener progress_listener =
+ act_main.getInputStreamProgressListener();
+
+ if(ActMain.makeMultiComparator(act_main, progress_listener,
+ file_names))
+ ComparatorDialog.this.dispose();
+
+ reading_message.dispose();
+ }
+}
diff --git a/uk/ac/sanger/artemis/components/ComparatorGlue.java b/uk/ac/sanger/artemis/components/ComparatorGlue.java
new file mode 100644
index 000000000..8da6a0ab9
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ComparatorGlue.java
@@ -0,0 +1,464 @@
+/* ComparatorGlue.java
+ *
+ * created: Tue Sep 11 2001
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ComparatorGlue.java,v 1.1 2004-06-09 09:46:10 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import uk.ac.sanger.artemis.util.ReadOnlyException;
+import uk.ac.sanger.artemis.util.OutOfRangeException;
+
+import java.util.*;
+import java.awt.*;
+
+import javax.swing.*;
+
+/**
+ * This class contains the Event glue needed to combine two FeatureDisplays
+ * and an AlignmentViewer.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: ComparatorGlue.java,v 1.1 2004-06-09 09:46:10 tjc Exp $
+ **/
+
+public class ComparatorGlue {
+ /**
+ * Create a new ComparatorGlue object that glues the given components
+ * togeather.
+ **/
+ public ComparatorGlue (final JFrame parent_frame,
+ final FeatureDisplay subject_feature_display,
+ final FeatureDisplay query_feature_display,
+ final AlignmentViewer alignment_viewer) {
+ this.parent_frame = parent_frame;
+ this.subject_feature_display = subject_feature_display;
+ this.query_feature_display = query_feature_display;
+ this.alignment_viewer = alignment_viewer;
+
+ getSubjectEntryGroup ().addFeatureChangeListener (getSubjectSelection ());
+ getQueryEntryGroup ().addEntryChangeListener (getQuerySelection ());
+
+ addDisplayListeners (subject_feature_display, query_feature_display);
+
+ orig_subject_forward_strand =
+ getSubjectEntryGroup ().getBases ().getForwardStrand ();
+ orig_query_forward_strand =
+ getQueryEntryGroup ().getBases ().getForwardStrand ();
+
+ makeAlignmentEventListener ();
+ }
+
+ /**
+ * Wire-up the two FeatureDisplay objects with DisplayAdjustmentListeners.
+ **/
+ private void addDisplayListeners (final FeatureDisplay subject_display,
+ final FeatureDisplay query_display) {
+
+ subject_listener = new DisplayAdjustmentListener () {
+ public void displayAdjustmentValueChanged (DisplayAdjustmentEvent e) {
+ if (e.getType () == DisplayAdjustmentEvent.REV_COMP_EVENT) {
+ getAlignmentViewer ().unlockDisplays ();
+ return;
+ }
+
+ subject_display.removeDisplayAdjustmentListener (subject_listener);
+ query_display.removeDisplayAdjustmentListener (query_listener);
+
+ query_display.setScaleFactor (e.getScaleFactor ());
+
+ if (getAlignmentViewer ().displaysAreLocked () &&
+ (e.getType () == DisplayAdjustmentEvent.SCROLL_ADJUST_EVENT ||
+ e.getType () == DisplayAdjustmentEvent.ALL_CHANGE_ADJUST_EVENT)) {
+ final int difference = e.getStart () - subject_first_base_position;
+
+ query_first_base_position =
+ query_display.getForwardBaseAtLeftEdge () + difference;
+
+ query_display.setFirstBase (query_first_base_position);
+ }
+
+ subject_first_base_position = e.getStart ();
+
+ subject_display.addDisplayAdjustmentListener (subject_listener);
+ query_display.addDisplayAdjustmentListener (query_listener);
+ }
+ };
+
+ query_listener = new DisplayAdjustmentListener () {
+ public void displayAdjustmentValueChanged (DisplayAdjustmentEvent e) {
+ if (e.getType () == DisplayAdjustmentEvent.REV_COMP_EVENT) {
+ getAlignmentViewer ().unlockDisplays ();
+ return;
+ }
+
+ subject_display.removeDisplayAdjustmentListener (subject_listener);
+ query_display.removeDisplayAdjustmentListener (query_listener);
+
+ subject_display.setScaleFactor (e.getScaleFactor ());
+
+ if (getAlignmentViewer ().displaysAreLocked () &&
+ (e.getType () == DisplayAdjustmentEvent.SCROLL_ADJUST_EVENT ||
+ e.getType () == DisplayAdjustmentEvent.ALL_CHANGE_ADJUST_EVENT)) {
+ final int difference = e.getStart () - query_first_base_position;
+
+ subject_first_base_position =
+ subject_display.getForwardBaseAtLeftEdge () + difference;
+
+ subject_display.setFirstBase (subject_first_base_position);
+ }
+
+ query_first_base_position = e.getStart ();
+
+ subject_display.addDisplayAdjustmentListener (subject_listener);
+ query_display.addDisplayAdjustmentListener (query_listener);
+ }
+ };
+
+ subject_display.addDisplayAdjustmentListener (subject_listener);
+ query_display.addDisplayAdjustmentListener (query_listener);
+
+ final DisplayAdjustmentListener subject_align_listener =
+ new DisplayAdjustmentListener () {
+ public void displayAdjustmentValueChanged (DisplayAdjustmentEvent e) {
+ getAlignmentViewer ().setSubjectSequencePosition (e);
+ }
+ };
+
+ subject_display.addDisplayAdjustmentListener (subject_align_listener);
+
+ final DisplayAdjustmentListener query_align_listener =
+ new DisplayAdjustmentListener () {
+ public void displayAdjustmentValueChanged (DisplayAdjustmentEvent e) {
+ getAlignmentViewer ().setQuerySequencePosition (e);
+ }
+ };
+
+ query_display.addDisplayAdjustmentListener (query_align_listener);
+ }
+
+ /**
+ * Make an AlignmentListener which calls alignAt ().
+ **/
+ private void makeAlignmentEventListener () {
+ final AlignmentListener listener =
+ new AlignmentListener () {
+ public void alignMatchChosen (AlignmentEvent e) {
+ alignAt (e.getMatch ());
+ }
+ };
+
+ getAlignmentViewer ().addAlignmentListener (listener);
+ }
+
+ /**
+ * Scroll both the subject and query so that they centre on the given
+ * AlignMatch.
+ **/
+ private void alignAt (final AlignMatch align_match) {
+ getAlignmentViewer ().unlockDisplays ();
+ getAlignmentViewer ().disableSelection ();
+
+ maybeRevCompQuery (align_match);
+
+ final int subject_length = getSubjectForwardStrand ().getSequenceLength ();
+ final int query_length = getQueryForwardStrand ().getSequenceLength ();
+
+ int subject_sequence_start =
+ AlignmentViewer.getRealSubjectSequenceStart (align_match,
+ subject_length,
+ getAlignmentViewer ().subjectIsRevComp ());
+ int subject_sequence_end =
+ AlignmentViewer.getRealSubjectSequenceEnd (align_match,
+ subject_length,
+ getAlignmentViewer ().subjectIsRevComp ());
+ int query_sequence_start =
+ AlignmentViewer.getRealQuerySequenceStart (align_match,
+ query_length,
+ getAlignmentViewer ().queryIsRevComp ());
+ int query_sequence_end =
+ AlignmentViewer.getRealQuerySequenceEnd (align_match,
+ query_length,
+ getAlignmentViewer ().queryIsRevComp ());
+
+ if (getSubjectDisplay ().isRevCompDisplay ()) {
+ subject_sequence_start =
+ getSubjectDisplay ().getSequenceLength () - subject_sequence_start + 1;
+ subject_sequence_end =
+ getSubjectDisplay ().getSequenceLength () - subject_sequence_end + 1;
+ }
+
+ if (getQueryDisplay ().isRevCompDisplay ()) {
+ query_sequence_start =
+ getQueryDisplay ().getSequenceLength () - query_sequence_start + 1;
+ query_sequence_end =
+ getQueryDisplay ().getSequenceLength () - query_sequence_end + 1;
+ }
+
+ final int new_subject_base =
+ subject_sequence_start +
+ (subject_sequence_end - subject_sequence_start) / 2;
+ getSubjectDisplay ().makeBaseVisible (new_subject_base);
+
+ try {
+ final Strand subject_strand;
+
+ if (align_match.isRevMatch () ^
+ !getOrigSubjectForwardStrand ().isForwardStrand ()) {
+ subject_strand = getSubjectReverseStrand ();
+ } else {
+ subject_strand = getSubjectForwardStrand ();
+ }
+
+ final MarkerRange new_subject_marker =
+ subject_strand.makeMarkerRangeFromRawPositions (subject_sequence_start,
+ subject_sequence_end);
+ getSubjectSelection ().setMarkerRange (new_subject_marker);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+
+ final int new_query_base =
+ query_sequence_start +
+ (query_sequence_end - query_sequence_start) / 2;
+ getQueryDisplay ().makeBaseVisible (new_query_base);
+
+ try {
+ final Strand query_strand;
+
+ if (getOrigQueryForwardStrand ().isForwardStrand ()) {
+ query_strand = getQueryForwardStrand ();
+ } else {
+ query_strand = getQueryReverseStrand ();
+ }
+
+ final MarkerRange new_query_marker_range =
+ query_strand.makeMarkerRangeFromRawPositions (query_sequence_start,
+ query_sequence_end);
+
+ getQuerySelection ().setMarkerRange (new_query_marker_range);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+
+ getAlignmentViewer ().lockDisplays ();
+ getAlignmentViewer ().enableSelection ();
+ }
+
+ /**
+ * Called by alignAt () to reverse and complement the query sequence if the
+ * given AlignMatch is currently a match from the subject sequence to the
+ * reverse complement of the query sequence.
+ **/
+ private void maybeRevCompQuery (final AlignMatch align_match) {
+ if (!getAlignmentViewer ().offerToFlip ()) {
+ return;
+ }
+
+ // true if and only if exactly one of the query and subject is rev-comped
+ final boolean display_is_rev_comped;
+
+ if (getOrigSubjectForwardStrand ().isForwardStrand () ^
+ getOrigQueryForwardStrand ().isForwardStrand () ^
+ getSubjectDisplay ().isRevCompDisplay () ^
+ getQueryDisplay ().isRevCompDisplay ()) {
+ display_is_rev_comped = true;
+ } else {
+ display_is_rev_comped = false;
+ }
+
+ if (align_match.isRevMatch () ^ display_is_rev_comped) {
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog (parent_frame,
+ "reverse and complement query sequence display?");
+ if (yes_no_dialog.getResult ()) {
+ if (getQueryDisplay ().isRevCompDisplay ()) {
+ getQueryDisplay ().setRevCompDisplay (false);
+ } else {
+ getQueryDisplay ().setRevCompDisplay (true);
+ }
+ }
+ }
+ }
+
+ /**
+ * Send an event to those object listening for it.
+ * @param listeners A Vector of the objects that the event should be sent
+ * to.
+ * @param event The event to send
+ **/
+ private void fireAction (final Vector listeners, final EventObject event) {
+ final Vector targets;
+ // copied from a book - synchronising the whole method might cause a
+ // deadlock
+ synchronized (this) {
+ targets = (Vector) listeners.clone ();
+ }
+
+ for (int i = 0 ; i < targets.size () ; ++i) {
+ GotoListener target = (GotoListener) targets.elementAt (i);
+
+ if (event instanceof GotoEvent) {
+ final GotoListener goto_listener = (GotoListener) target;
+ goto_listener.performGoto ((GotoEvent) event);
+ } else {
+ throw new Error ("EntryEdit.fireAction () - unknown event");
+ }
+ }
+ }
+
+ /**
+ * Return the forward Strand of the subject EntryGroup from when the
+ * Comparator was created.
+ **/
+ public Strand getOrigSubjectForwardStrand () {
+ return orig_subject_forward_strand;
+ }
+
+ /**
+ * Return the forward Strand of the query EntryGroup from when the
+ * Comparator was created.
+ **/
+ public Strand getOrigQueryForwardStrand () {
+ return orig_query_forward_strand;
+ }
+
+ /**
+ * Return the GotoEventSource object used by the subject FeatureDisplay.
+ **/
+ public GotoEventSource getSubjectGotoEventSource () {
+ return getSubjectDisplay ().getGotoEventSource ();
+ }
+
+ /**
+ * Return the GotoEventSource object used by the query FeatureDisplay.
+ **/
+ public GotoEventSource getQueryGotoEventSource () {
+ return getQueryDisplay ().getGotoEventSource ();
+ }
+
+ /**
+ * Return the reference of the EntryGroup in view in the subject
+ * FeatureDisplay.
+ **/
+ public EntryGroup getSubjectEntryGroup () {
+ return getSubjectDisplay ().getEntryGroup ();
+ }
+
+ /**
+ * Return the reference of the EntryGroup in view in the query
+ * FeatureDisplay.
+ **/
+ public EntryGroup getQueryEntryGroup () {
+ return getQueryDisplay ().getEntryGroup ();
+ }
+
+ /**
+ * Return the Selection object used by the subject FeatureDisplay.
+ **/
+ public Selection getSubjectSelection () {
+ return getSubjectDisplay ().getSelection ();
+ }
+
+ /**
+ * Return the Selection object used by the query FeatureDisplay.
+ **/
+ public Selection getQuerySelection () {
+ return getQueryDisplay ().getSelection ();
+ }
+
+ /**
+ * Return the AlignmentViewer that was created in the constructor.
+ **/
+ private AlignmentViewer getAlignmentViewer () {
+ return alignment_viewer;
+ }
+
+ /**
+ * Return the reference of the subject FeatureDisplay.
+ **/
+ public FeatureDisplay getSubjectDisplay () {
+ return subject_feature_display;
+ }
+
+ /**
+ * Return the reference of the query FeatureDisplay.
+ **/
+ public FeatureDisplay getQueryDisplay () {
+ return query_feature_display;
+ }
+
+ /**
+ * Return the current forward Strand of the subject EntryGroup.
+ **/
+ private Strand getSubjectForwardStrand () {
+ return getSubjectEntryGroup ().getBases ().getForwardStrand ();
+ }
+
+ /**
+ * Return the current forward Strand of the query EntryGroup.
+ **/
+ private Strand getQueryForwardStrand () {
+ return getQueryEntryGroup ().getBases ().getForwardStrand ();
+ }
+
+ /**
+ * Return the current reverse Strand of the subject EntryGroup.
+ **/
+ private Strand getSubjectReverseStrand () {
+ return getSubjectEntryGroup ().getBases ().getReverseStrand ();
+ }
+
+ /**
+ * Return the current reverse Strand of the query EntryGroup.
+ **/
+ private Strand getQueryReverseStrand () {
+ return getQueryEntryGroup ().getBases ().getReverseStrand ();
+ }
+
+ final private JFrame parent_frame;
+ final private FeatureDisplay subject_feature_display;
+ final private FeatureDisplay query_feature_display;
+ final private AlignmentViewer alignment_viewer;
+
+ private int subject_first_base_position = 1;
+ private int query_first_base_position = 1;
+
+ private DisplayAdjustmentListener subject_listener = null;
+ private DisplayAdjustmentListener query_listener = null;
+
+ /**
+ * The forward Strand of the subject EntryGroup when the Comparator was
+ * created.
+ **/
+ final private Strand orig_subject_forward_strand;
+
+ /**
+ * The forward Strand of the query EntryGroup when the Comparator was
+ * created.
+ **/
+ final private Strand orig_query_forward_strand;
+
+}
diff --git a/uk/ac/sanger/artemis/components/CorbaEntrySource.java b/uk/ac/sanger/artemis/components/CorbaEntrySource.java
new file mode 100644
index 000000000..2c1950df2
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/CorbaEntrySource.java
@@ -0,0 +1,90 @@
+/* CorbaEntrySource.java
+ *
+ * created: Wed Jun 7 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/CorbaEntrySource.java,v 1.1 2004-06-09 09:46:11 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import java.io.*;
+import java.net.*;
+import java.awt.*;
+
+import javax.swing.*;
+
+/**
+ * This class contains the methods common to all EntrySource implementations
+ * that read from a CORBA server.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: CorbaEntrySource.java,v 1.1 2004-06-09 09:46:11 tjc Exp $
+ **/
+
+abstract public class CorbaEntrySource {
+ /**
+ * Create a new CorbaEntrySource using the given URL as the location of the
+ * server IOR.
+ * @param frame The component that created this EntrySource. (Used for
+ * requesters.)
+ * @param ior_url_string A String containing the URL of the IOR for the
+ * server.
+ **/
+ public CorbaEntrySource (final JFrame frame,
+ final String ior_url_string)
+ throws MalformedURLException //, IOException
+ {
+ this.frame = frame;
+ this.ior_url = new URL (ior_url_string);
+ }
+
+ /**
+ * Finds and returns a stringified object reference (IOR) for a CORBA
+ * server. The IOR is read from the URL that was passed to the
+ * constructor.
+ * @return The stringified IOR.
+ * @exception IOException Thrown if an error occurs while reading.
+ **/
+ public String getIOR ()
+ throws IOException {
+ // get URL of IOR
+ final BufferedReader in =
+ new BufferedReader (new InputStreamReader (ior_url.openStream()));
+ return in.readLine();
+ }
+
+ /**
+ * Return the JFrame that was passed to the constructor.
+ **/
+ public JFrame getFrame () {
+ return frame;
+ }
+
+ /**
+ * The URL containing the IOR of the CORBA server.
+ **/
+ private URL ior_url = null;
+
+ /**
+ * The JFrame that was passed to the constructor.
+ **/
+ private JFrame frame = null;
+}
diff --git a/uk/ac/sanger/artemis/components/DbfetchEntrySource.java b/uk/ac/sanger/artemis/components/DbfetchEntrySource.java
new file mode 100644
index 000000000..435af2e29
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/DbfetchEntrySource.java
@@ -0,0 +1,253 @@
+/* DbfetchEntrySource.java
+ *
+ * created: Fri Nov 28 2003
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2003 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/DbfetchEntrySource.java,v 1.1 2004-06-09 09:46:12 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import uk.ac.sanger.artemis.util.OutOfRangeException;
+import uk.ac.sanger.artemis.util.Document;
+import uk.ac.sanger.artemis.util.DocumentFactory;
+import uk.ac.sanger.artemis.io.DocumentEntryFactory;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.EntryInformationException;
+import uk.ac.sanger.artemis.io.SimpleEntryInformation;
+
+import java.io.*;
+import javax.swing.*;
+
+/**
+ * This is an EntrySource that reads Entry objects from the EMBL Dbfetch
+ * server.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: DbfetchEntrySource.java,v 1.1 2004-06-09 09:46:12 tjc Exp $
+ **/
+
+public class DbfetchEntrySource
+ implements EntrySource
+{
+ /**
+ * Create a new DbfetchEntrySource.
+ * @param frame The component that created this EntrySource. (Used for
+ * requesters.)
+ **/
+ public DbfetchEntrySource (final JFrame frame)
+ {
+
+ }
+
+ /**
+ * Get an Entry object from the Ensembl Dbfetch server.
+ * @param bases The Bases object to pass to the Entry constructor.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading. (Not implemented)
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ **/
+ public Entry getEntry (final Bases bases, ProgressThread progress_thread,
+ final boolean show_progress)
+ throws OutOfRangeException, IOException
+ {
+ return getEntry(bases,show_progress,progress_thread);
+ }
+
+ /**
+ * Get an Entry object from the Ensembl Dbfetch server.
+ * @param bases The Bases object to pass to the Entry constructor.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading. (Not implemented)
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ **/
+ public Entry getEntry (final Bases bases, final boolean show_progress)
+ throws OutOfRangeException, IOException
+ {
+ return getEntry(bases,show_progress, null);
+ }
+
+ /**
+ * Get an Entry object from the Ensembl Dbfetch server.
+ * @param bases The Bases object to pass to the Entry constructor.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading. (Not implemented)
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ **/
+ public Entry getEntry (final Bases bases, final boolean show_progress,
+ ProgressThread progress_thread)
+ throws OutOfRangeException, IOException
+ {
+ final TextDialog text_dialog =
+ new TextDialog (getFrame (), "Enter an accession number:", 10, "");
+
+ final String text = text_dialog.getText ();
+
+ if (text == null) {
+ // user cancel
+ return null;
+ }
+
+ final String embl_id = text.trim ();
+
+ if(embl_id.length () > 0)
+ {
+ final LogReadListener read_event_logger = new LogReadListener (embl_id);
+
+ final EntryInformation entry_information =
+ new SimpleEntryInformation (Options.getArtemisEntryInformation ());
+
+// final MessageDialog message_frame =
+// new MessageDialog (getFrame (),
+// "reading entry - please wait", false);
+
+ if(progress_thread != null)
+ progress_thread.start();
+
+ final String url_string =
+ "http://www.ebi.ac.uk/cgi-bin/dbfetch?db=EMBL&id=" + embl_id;
+
+ final Document url_document =
+ DocumentFactory.makeDocument (url_string);
+
+ try
+ {
+ final uk.ac.sanger.artemis.io.Entry new_embl_entry =
+ DocumentEntryFactory.makeDocumentEntry (entry_information,
+ url_document,
+ read_event_logger);
+
+ if (read_event_logger.seenMessage ()) {
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog (frame,
+ "there were warnings while reading - view now?");
+
+ if (yes_no_dialog.getResult ()) {
+ Splash.showLog ();
+ }
+ }
+
+ final Bases real_bases;
+
+ if (bases == null) {
+ if (new_embl_entry.getSequence () == null) {
+ final String message =
+ "the entry contains no sequence: " + embl_id;
+ new MessageDialog (getFrame (), message);
+ return null;
+ }
+
+ real_bases = new Bases (new_embl_entry.getSequence ());
+ } else {
+ real_bases = bases;
+ }
+
+ return new Entry (real_bases, new_embl_entry);
+ }
+ catch (EntryInformationException e)
+ {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+// finally
+// {
+// message_frame.dispose ();
+// }
+ }
+
+ return null;
+ }
+
+ /**
+ * Get an Entry object from the Ensembl Dbfetch server.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading. (Not implemented)
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @exception NoSequenceException Thrown if the entry that we read has no
+ * sequence.
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ **/
+ public Entry getEntry (final boolean show_progress)
+ throws OutOfRangeException, NoSequenceException, IOException
+ {
+ return getEntry (null, show_progress);
+ }
+
+ /**
+ * Get an Entry object from the Ensembl Dbfetch server.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading. (Not implemented)
+ * @param progress_thread Progress thread to monitor the entry reading.
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @exception NoSequenceException Thrown if the entry that we read has no
+ * sequence.
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ **/
+ public Entry getEntry (final boolean show_progress, ProgressThread progress_thread)
+ throws OutOfRangeException, NoSequenceException, IOException
+ {
+ return getEntry (null, show_progress, progress_thread);
+ }
+
+
+ /**
+ * Return the name of this source (for display to the user in menus).
+ **/
+ public String getSourceName () {
+ return "EBI - Dbfetch";
+ }
+
+ /**
+ * Returns true if and only if this EntrySource always returns "full"
+ * entries. ie. entries that contain features and sequence. Entries that
+ * are read from EMBL always contain sequence so in this class this method
+ * returns false.
+ **/
+ public boolean isFullEntrySource () {
+ return true;
+ }
+
+ /**
+ * Return the JFrame that was passed to the constructor.
+ **/
+ public JFrame getFrame () {
+ return frame;
+ }
+
+ /**
+ * The JFrame that was passed to the constructor.
+ **/
+ private JFrame frame = null;
+}
diff --git a/uk/ac/sanger/artemis/components/DisplayAdjustmentEvent.java b/uk/ac/sanger/artemis/components/DisplayAdjustmentEvent.java
new file mode 100644
index 000000000..fa70a88ba
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/DisplayAdjustmentEvent.java
@@ -0,0 +1,186 @@
+/* DisplayAdjustmentEvent.java
+ *
+ * created: Tue Dec 15 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/DisplayAdjustmentEvent.java,v 1.1 2004-06-09 09:46:13 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.ChangeEvent;
+
+/**
+ * This event is sent when a FeatureDisplay is scrolled.
+ *
+ * @author Kim Rutherford
+ * @version $Id: DisplayAdjustmentEvent.java,v 1.1 2004-06-09 09:46:13 tjc Exp $
+ **/
+
+public class DisplayAdjustmentEvent extends ChangeEvent
+{
+
+ /** The new start base, as passed to the constructor. */
+ private int start_base;
+
+ /** The new end base, as passed to the constructor. */
+ private int end_base;
+
+ /**
+ * The width in bases of the display, as passed to the constructor.
+ **/
+ private int width_in_bases;
+
+ /**
+ * The width of each base on the display, as passed to the constructor.
+ **/
+ private float base_width;
+
+ /** The scale factor, as passed to the constructor. */
+ private int scale_factor;
+
+ /**
+ * True if and only if the FeatureDisplay is drawing in
+ * reverse complement mode.
+ **/
+ private boolean rev_comp_display;
+
+ /**
+ * The type of event. One of: SCALE_ADJUST_EVENT, SCROLL_ADJUST_EVENT or
+ * ALL_CHANGE_ADJUST_EVENT.
+ **/
+ private int type;
+
+ /**
+ * The type of DisplayAdjustmentEvent where the scale (only) has changed
+ **/
+ final static public int SCALE_ADJUST_EVENT = 0;
+
+ /**
+ * The type of DisplayAdjustmentEvent where the display has scrolled but
+ * the scale has stayed the same.
+ **/
+ final static public int SCROLL_ADJUST_EVENT = 1;
+
+ /**
+ * The type of DisplayAdjustmentEvent where the display has been reverse
+ * complemented.
+ **/
+ final static public int REV_COMP_EVENT = 2;
+
+ /**
+ * The type of DisplayAdjustmentEvent where the display has scrolled and
+ * the the scale has changed.
+ **/
+ final static public int ALL_CHANGE_ADJUST_EVENT = 3;
+
+ /**
+ * Create a new DisplayAdjustmentEvent.
+ * @param source The Object that generated the event - probably a component.
+ * @param start_base The new start base on the display.
+ * @param end_base The new end base on the display.
+ * @param width_in_bases The width of the drawing area in bases. We need
+ * this because if the user scrolls to the end of the sequence, the last
+ * visible base (end_base) may not be at the right of the screen. This
+ * might be greater than end_base - start_base.
+ * @param base_width The width in pixels of a base on screen.
+ * @param scale_factor This is the scale factor use by the FeatureDisplay
+ * component. A factor of zero means the full translation will be
+ * visible. At higher scale factors only stop codons are visible, and
+ * a bigger number will mean more bases are visible.
+ * @param type the type of event: SCALE_ADJUST_EVENT, SCROLL_ADJUST_EVENT
+ * or ALL_CHANGE_ADJUST_EVENT.
+ **/
+ public DisplayAdjustmentEvent(Object source,
+ int start_base, int end_base,
+ int width_in_bases, float base_width,
+ int scale_factor,
+ boolean rev_comp_display, int type)
+ {
+ super(source);
+ this.start_base = start_base;
+ this.end_base = end_base;
+ this.width_in_bases = width_in_bases;
+ this.base_width = base_width;
+ this.scale_factor = scale_factor;
+ this.rev_comp_display = rev_comp_display;
+ this.type = type;
+ }
+
+ /**
+ * Return the new start base to display, as passed to the constructor.
+ **/
+ public int getStart()
+ {
+ return start_base;
+ }
+
+ /**
+ * Return the new end base to display, as passed to the constructor.
+ **/
+ public int getEnd()
+ {
+ return end_base;
+ }
+
+ /**
+ * Return the width in bases of the display, as passed to the constructor.
+ **/
+ public int getWidthInBases()
+ {
+ return width_in_bases;
+ }
+
+ /**
+ * Return the width of a base on the display, as passed to the constructor.
+ **/
+ public float getBaseWidth()
+ {
+ return base_width;
+ }
+
+ /**
+ * Return the scale factor that was passed to the constructor.
+ **/
+ public int getScaleFactor()
+ {
+ return scale_factor;
+ }
+
+ /**
+ * Return true if and only if the FeatureDisplay is drawing in reverse
+ * complement mode.
+ **/
+ public boolean isRevCompDisplay()
+ {
+ return rev_comp_display;
+ }
+
+ /**
+ * Return the type that was passed to the constructor.
+ **/
+ public int getType()
+ {
+ return type;
+ }
+
+}
+
+
diff --git a/uk/ac/sanger/artemis/components/DisplayAdjustmentListener.java b/uk/ac/sanger/artemis/components/DisplayAdjustmentListener.java
new file mode 100644
index 000000000..31bcc8296
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/DisplayAdjustmentListener.java
@@ -0,0 +1,45 @@
+/* DisplayAdjustmentListener.java
+ *
+ * created: Tue Dec 15 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/DisplayAdjustmentListener.java,v 1.1 2004-06-09 09:46:14 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+/**
+ * The DisplayAdjustmentListener interface is implemented by those
+ * components that need to track the scrolling of a component that can
+ * display bases. For example, BasePlot objects listen to FeatureDisplay
+ * objects.
+ *
+ * @author Kim Rutherford
+ * @version $Id: DisplayAdjustmentListener.java,v 1.1 2004-06-09 09:46:14 tjc Exp $
+ **/
+
+public interface DisplayAdjustmentListener extends uk.ac.sanger.artemis.ChangeListener {
+ /**
+ * Invoked when a component scrolls or changes the scale.
+ **/
+ void displayAdjustmentValueChanged (DisplayAdjustmentEvent event);
+}
+
+
diff --git a/uk/ac/sanger/artemis/components/DisplayComponent.java b/uk/ac/sanger/artemis/components/DisplayComponent.java
new file mode 100644
index 000000000..7953d56d1
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/DisplayComponent.java
@@ -0,0 +1,52 @@
+/* DisplayComponent.java (formally SelectionDisplayer.java)
+ *
+ * created: Fri Nov 13 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/DisplayComponent.java,v 1.1 2004-06-09 09:46:15 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.EntryGroup;
+import uk.ac.sanger.artemis.Selection;
+import uk.ac.sanger.artemis.GotoEventSource;
+
+import javax.swing.*;
+
+/**
+ * Interface discribing those methods common to all the classes in
+ * uk.ac.sanger.artemis.components that can display EntryGroup objects.
+ *
+ * @author Kim Rutherford
+ * @version $Id: DisplayComponent.java,v 1.1 2004-06-09 09:46:15 tjc Exp $
+ **/
+
+public interface DisplayComponent {
+ /**
+ * Return an object that implements the GotoEventSource interface.
+ **/
+ GotoEventSource getGotoEventSource ();
+
+ /**
+ * Return the reference of the JFrame that owns this component.
+ **/
+ JFrame getParentFrame ();
+}
diff --git a/uk/ac/sanger/artemis/components/EMBLCorbaEntrySource.java b/uk/ac/sanger/artemis/components/EMBLCorbaEntrySource.java
new file mode 100644
index 000000000..084012483
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/EMBLCorbaEntrySource.java
@@ -0,0 +1,318 @@
+/* EMBLCorbaEntrySource.java
+ *
+ * created: Wed Jun 7 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/EMBLCorbaEntrySource.java,v 1.1 2004-06-09 09:46:17 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import uk.ac.sanger.artemis.util.*;
+import uk.ac.sanger.artemis.io.LocationParseException;
+import uk.ac.sanger.artemis.io.InvalidKeyException;
+import uk.ac.sanger.artemis.io.EntryInformationException;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.SimpleEntryInformation;
+
+import nsdb.EmblSeq;
+import nsdb.EmblPackage.Superceded;
+import type.NoResult;
+
+import java.io.*;
+import java.awt.*;
+import java.net.*;
+
+import javax.swing.*;
+
+/**
+ * This is an EntrySource that reads Entry objects from the EMBL CORBA
+ * server.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: EMBLCorbaEntrySource.java,v 1.1 2004-06-09 09:46:17 tjc Exp $
+ **/
+
+public class EMBLCorbaEntrySource
+ extends CorbaEntrySource
+ implements EntrySource
+{
+ /**
+ * Create a new EMBLCorbaEntrySource from the given String.
+ * @param frame The component that created this EntrySource. (Used for
+ * requesters.)
+ * @param ior_url_string A String containing the URL of the IOR for the
+ * server.
+ **/
+ public EMBLCorbaEntrySource (final JFrame frame,
+ final String ior_url_string)
+ throws MalformedURLException//, IOException
+ {
+ super (frame, ior_url_string);
+ }
+
+ /**
+ * Get an Entry object from the Ensembl CORBA server.
+ * @param bases The Bases object to pass to the Entry constructor.
+ * @param progress_thread Progress thread to monitor entry reading.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading. (Not implemented)
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ **/
+ public Entry getEntry (final Bases bases, final ProgressThread progress_thread,
+ final boolean show_progress)
+ throws OutOfRangeException, IOException
+ {
+ return makeCorbaDialog (bases, false);
+ }
+
+ /**
+ * Get an Entry object from the Ensembl CORBA server.
+ * @param bases The Bases object to pass to the Entry constructor.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading. (Not implemented)
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ **/
+ public Entry getEntry (final Bases bases, final boolean show_progress)
+ throws OutOfRangeException, IOException
+ {
+ return makeCorbaDialog (bases, false);
+ }
+
+ /**
+ * Get an Entry object from the Ensembl CORBA server.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading. (Not implemented)
+ * @param progress_thread Progress thread to monitor entry reading.
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ **/
+ public Entry getEntry (final boolean show_progress,
+ final ProgressThread progress_thread)
+ throws OutOfRangeException, IOException
+ {
+ return makeCorbaDialog (null, false);
+ }
+
+
+ /**
+ * Get an Entry object from the Ensembl CORBA server.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading. (Not implemented)
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @exception NoSequenceException Thrown if the entry that we read has no
+ * sequence.
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ **/
+ public Entry getEntry (final boolean show_progress)
+ throws OutOfRangeException, NoSequenceException, IOException {
+ return makeCorbaDialog (null, false);
+ }
+
+ /**
+ * Return the name of this source (for display to the user in menus).
+ **/
+ public String getSourceName () {
+ return "EBI - CORBA";
+ }
+
+ /**
+ * Returns true if and only if this EntrySource always returns "full"
+ * entries. ie. entries that contain features and sequence. Entries that
+ * are read from EMBL always contain sequence so in this class this method
+ * returns false.
+ **/
+ public boolean isFullEntrySource () {
+ return true;
+ }
+
+ /**
+ * Create a TextRequester, wait for the user to type an accession number
+ * and then read that entry from the EMBL CORBA server.
+ * @param bases If this is null a new Bases object will be created for the
+ * Entry once it has been read from the server. If not null then it will
+ * be passed to the Entry constructor.
+ * @param read_only true if and only if a read-only Entry should be created
+ * (some are always read only).
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ **/
+ protected Entry makeCorbaDialog (final Bases bases,
+ final boolean read_only)
+ throws OutOfRangeException, IOException {
+ final org.omg.CORBA.ORB orb =
+ org.omg.CORBA.ORB.init (new String [0], new java.util.Properties());
+
+ final TextDialog text_dialog =
+ new TextDialog (getFrame (), "Enter an accession number:", 10, "");
+
+ final String text = text_dialog.getText ();
+
+ if (text == null) {
+ // user cancel
+ return null;
+ } else {
+ final String corba_id = text.trim ();
+
+ if (corba_id.length () > 0) {
+ final MessageDialog message_frame =
+ new MessageDialog (getFrame (),
+ "reading entry - please wait", false);
+
+ try {
+ return makeFromCorbaID (bases, corba_id, read_only);
+ } finally {
+ message_frame.dispose ();
+ }
+ } else {
+ return null;
+ }
+ }
+ }
+
+ /**
+ * Given an accession number and the handle of an EMBL corba server, this
+ * method will ask the user (using a TextRequester) for the id of a entry
+ * in the server and will then attempt to get it.
+ * @param bases If this is null a new Bases object will be created for the
+ * Entry once it has been read from the server. If not null then it will
+ * be passed to the Entry constructor.
+ * @param corba_handle The handle of the nsdb.Embl object from which we
+ * will read the entry.
+ * @param corba_id The id of the entry in the database
+ * @param read_only true if and only if a read-only Entry should be created
+ * (some are always read only).
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ **/
+ protected Entry makeFromCorbaID (final Bases bases,
+ final String corba_id,
+ final boolean read_only)
+ throws OutOfRangeException, IOException {
+ try {
+ final nsdb.Embl corba_handle = getServerHandle ();
+
+ final uk.ac.sanger.artemis.io.Entry new_embl_entry;
+
+ final nsdb.EmblWriter embl_writer =
+ nsdb.EmblWriterHelper.narrow (corba_handle);
+
+ final EntryInformation entry_information =
+ new SimpleEntryInformation (Options.getArtemisEntryInformation ());
+
+ if (read_only || embl_writer == null) {
+ // first try to make a plain EmblSeq object
+ final EmblSeq embl_seq = corba_handle.getEmblSeq (corba_id);
+
+ new_embl_entry =
+ new uk.ac.sanger.artemis.io.CorbaEntry (entry_information,
+ embl_seq);
+ } else {
+ // make a read-write object
+ final nsdb.EmblSeqWriter embl_write_seq =
+ embl_writer.getEmblSeqWriter (corba_id);
+
+ new_embl_entry =
+ new uk.ac.sanger.artemis.io.RWCorbaEntry (entry_information,
+ embl_write_seq);
+ }
+
+ final Bases real_bases;
+
+ if (bases == null) {
+ if (new_embl_entry.getSequence () == null) {
+ final String message =
+ "the entry contains no sequence: " + corba_id;
+ new MessageDialog (getFrame (), message);
+ return null;
+ }
+
+ real_bases = new Bases (new_embl_entry.getSequence ());
+ } else {
+ real_bases = bases;
+ }
+
+ return new Entry (real_bases, new_embl_entry);
+ } catch (NoResult e) {
+ final String message =
+ "Database query failed (no result) while getting id: " + corba_id;
+ new MessageDialog (getFrame (), message);
+ } catch (Superceded e) {
+ // Superceded is thrown by getEmblSeq method if accession number
+ // doesn't exist anymore because it was merged or split
+ final String message =
+ "This accession number has been superceded: " + corba_id;
+ new MessageDialog (getFrame (), message);
+ } catch (LocationParseException e) {
+ final String message =
+ "Unexpected error while accessing " + corba_id + ": " + e;
+ new MessageDialog (getFrame (), message);
+ } catch (InvalidKeyException e) {
+ final String message =
+ "Unexpected error while accessing " + corba_id + ": " + e;
+ new MessageDialog (getFrame (), message);
+ } catch (org.omg.CORBA.OBJECT_NOT_EXIST e) {
+ final String message =
+ "the object you requested (" + corba_id + ") does not exist";
+ new MessageDialog (getFrame (), message);
+ } catch (org.omg.CORBA.COMM_FAILURE e) {
+ final String message =
+ "Failed to get an object from Corba: " + e;
+ new MessageDialog (getFrame (), message);
+ } catch (EntryInformationException e) {
+ final String message =
+ "Failed to get an object from Corba: " + e;
+ new MessageDialog (getFrame (), message);
+ }
+
+ return null;
+ }
+
+ /**
+ * Return the handle of the EMBL database. The database IOR is found by
+ * calling getIOR ().
+ **/
+ protected nsdb.Embl getServerHandle ()
+ throws org.omg.CORBA.COMM_FAILURE, IOException {
+ final org.omg.CORBA.ORB orb =
+ org.omg.CORBA.ORB.init (new String [0], new java.util.Properties());
+
+ final org.omg.CORBA.Object obj;
+
+ obj = orb.string_to_object (getIOR ());
+
+ return nsdb.EmblHelper.narrow (obj);
+ }
+}
diff --git a/uk/ac/sanger/artemis/components/EditMenu.java b/uk/ac/sanger/artemis/components/EditMenu.java
new file mode 100644
index 000000000..aafe11393
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/EditMenu.java
@@ -0,0 +1,2447 @@
+/* EditMenu.java
+ *
+ * created: Thu Dec 3 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000,2001,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/EditMenu.java,v 1.1 2004-06-09 09:46:18 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+import uk.ac.sanger.artemis.util.*;
+import uk.ac.sanger.artemis.io.Range;
+import uk.ac.sanger.artemis.io.RangeVector;
+import uk.ac.sanger.artemis.io.Key;
+import uk.ac.sanger.artemis.io.Location;
+import uk.ac.sanger.artemis.io.Qualifier;
+import uk.ac.sanger.artemis.io.QualifierInfo;
+import uk.ac.sanger.artemis.io.QualifierInfoVector;
+import uk.ac.sanger.artemis.io.QualifierVector;
+import uk.ac.sanger.artemis.io.QualifierParseException;
+import uk.ac.sanger.artemis.io.InvalidQualifierException;
+import uk.ac.sanger.artemis.io.InvalidRelationException;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.EntryInformationException;
+import uk.ac.sanger.artemis.io.OutOfDateException;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.io.IOException;
+
+import javax.swing.*;
+
+/**
+ * A menu with editing commands.
+ *
+ * @author Kim Rutherford
+ * @version $Id: EditMenu.java,v 1.1 2004-06-09 09:46:18 tjc Exp $
+ **/
+
+public class EditMenu extends SelectionMenu
+ implements EntryGroupChangeListener, EntryChangeListener {
+ /**
+ * Create a new EditMenu object.
+ * @param frame The JFrame that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param goto_event_source The object the we will call makeBaseVisible ()
+ * on.
+ * @param entry_group The EntryGroup object where new features/entries will
+ * be added.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ * @param menu_name The name of the new menu.
+ **/
+ public EditMenu (final JFrame frame,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final EntryGroup entry_group,
+ final BasePlotGroup base_plot_group,
+ final String menu_name) {
+ super (frame, menu_name, selection);
+
+ this.entry_group = entry_group;
+ this.goto_event_source = goto_event_source;
+ this.base_plot_group = base_plot_group;
+
+ getEntryGroup ().addEntryGroupChangeListener (this);
+ getEntryGroup ().addEntryChangeListener (this);
+
+ refreshMenu ();
+ }
+
+ /**
+ * Create a new EditMenu object and use "Edit" as the menu name.
+ * @param frame The JFrame that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param goto_event_source The object the we will call makeBaseVisible ()
+ * on.
+ * @param entry_group The EntryGroup object where new features/entries will
+ * be added.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public EditMenu (final JFrame frame,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final EntryGroup entry_group,
+ final BasePlotGroup base_plot_group) {
+ this (frame, selection, goto_event_source, entry_group,
+ base_plot_group, "Edit");
+ }
+
+ /**
+ * The shortcut for Edit Selected Features.
+ **/
+ final static KeyStroke EDIT_FEATURES_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_E, InputEvent.CTRL_MASK);
+ final static public int EDIT_FEATURES_KEY_CODE = KeyEvent.VK_E;
+
+ /**
+ * The shortcut for Merge Selected Features.
+ **/
+ final static KeyStroke MERGE_FEATURES_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_M, InputEvent.CTRL_MASK);
+ final static public int MERGE_FEATURES_KEY_CODE = KeyEvent.VK_M;
+
+ /**
+ * The shortcut for Duplicate Selected Features.
+ **/
+ final static KeyStroke DUPLICATE_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_D, InputEvent.CTRL_MASK);
+ final static public int DUPLICATE_KEY_CODE = KeyEvent.VK_D;
+
+ /**
+ * The shortcut for Delete Selected Features.
+ **/
+ final static KeyStroke DELETE_FEATURES_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_DELETE, InputEvent.CTRL_MASK);
+ final static public int DELETE_FEATURES_KEY_CODE = KeyEvent.VK_DELETE;
+
+ /**
+ * The shortcut for Trim Selected Features.
+ **/
+ final static KeyStroke TRIM_FEATURES_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_T, InputEvent.CTRL_MASK);
+ final static public int TRIM_FEATURES_KEY_CODE = KeyEvent.VK_T;
+
+ /**
+ * The shortcut for Trim Selected Features To Next Any.
+ **/
+ final static KeyStroke TRIM_FEATURES_TO_NEXT_ANY_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_Y, InputEvent.CTRL_MASK);
+ final static public int TRIM_FEATURES_TO_NEXT_ANY_KEY_CODE = KeyEvent.VK_Y;
+
+ /**
+ * The shortcut for Extend to Previous Stop Codon.
+ **/
+ final static public int EXTEND_TO_PREVIOUS_STOP_CODON_KEY_CODE =
+ KeyEvent.VK_Q;
+ final static KeyStroke EXTEND_TO_PREVIOUS_STOP_CODON_KEY =
+ makeMenuKeyStroke (EXTEND_TO_PREVIOUS_STOP_CODON_KEY_CODE);
+
+ /**
+ * The shortcut for Undo.
+ **/
+ final static public int UNDO_KEY_CODE = KeyEvent.VK_U;
+ final static KeyStroke UNDO_KEY =
+ KeyStroke.getKeyStroke (UNDO_KEY_CODE, InputEvent.CTRL_MASK);
+
+ /**
+ * Implementation of the EntryGroupChangeListener interface. We listen to
+ * EntryGroupChange events so that we can update the display if entries
+ * are added or deleted.
+ **/
+ public void entryGroupChanged (final EntryGroupChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryGroupChangeEvent.ENTRY_ADDED:
+ case EntryGroupChangeEvent.ENTRY_DELETED:
+ case EntryGroupChangeEvent.ENTRY_INACTIVE:
+ case EntryGroupChangeEvent.ENTRY_ACTIVE:
+ case EntryGroupChangeEvent.NEW_DEFAULT_ENTRY:
+ refreshMenu ();
+ break;
+ }
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface.
+ **/
+ public void entryChanged (final EntryChangeEvent event) {
+ if (event.getType () == EntryChangeEvent.NAME_CHANGED) {
+ refreshMenu ();
+ }
+ }
+
+ /**
+ * Update the menus to the reflect the current contents of the EntryGroup.
+ **/
+ private void refreshMenu () {
+ removeAll ();
+
+ undo_item = new JMenuItem ("Undo");
+ undo_item.setAccelerator (UNDO_KEY);
+ undo_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ undo (getParentFrame (), getSelection (), getEntryGroup ());
+ }
+ });
+
+ edit_feature_item = new JMenuItem ("Edit Selected Features");
+ edit_feature_item.setAccelerator (EDIT_FEATURES_KEY);
+ edit_feature_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ editSelectedFeatures (getParentFrame (), getEntryGroup (),
+ getSelection (), getGotoEventSource ());
+ }
+ });
+
+ edit_subsequence_item = new JMenuItem ("Edit Subsequence (and Features)");
+ edit_subsequence_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ editSubSequence ();
+ }
+ });
+
+ add_qualifiers_item = new JMenuItem ("Change Qualifiers Of Selected ...");
+ add_qualifiers_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ addQualifiers (getParentFrame (), getSelection ());
+ }
+ });
+
+ remove_qualifier_item = new JMenuItem ("Remove Qualifier Of Selected ...");
+ remove_qualifier_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ removeQualifier (getParentFrame (), getSelection ());
+ }
+ });
+
+
+ merge_features_item = new JMenuItem ("Merge Selected Features");
+ merge_features_item.setAccelerator (MERGE_FEATURES_KEY);
+ merge_features_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ mergeFeatures (getParentFrame (), getSelection (), getEntryGroup ());
+ }
+ });
+
+ unmerge_feature_item = new JMenuItem ("Unmerge Selected Feature");
+ unmerge_feature_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ unmergeFeature (getParentFrame (), getSelection (), getEntryGroup ());
+ }
+ });
+
+ duplicate_item = new JMenuItem ("Duplicate Selected Features");
+ duplicate_item.setAccelerator (DUPLICATE_KEY);
+ duplicate_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ duplicateFeatures (getParentFrame (), getSelection (),
+ getEntryGroup ());
+ }
+ });
+
+ delete_features_item = new JMenuItem ("Delete Selected Features");
+ delete_features_item.setAccelerator (DELETE_FEATURES_KEY);
+ delete_features_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ deleteSelectedFeatures (getParentFrame (), getSelection (),
+ getEntryGroup ());
+ }
+ });
+
+ delete_segments_item = new JMenuItem ("Delete Selected Exons");
+ delete_segments_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ deleteSelectedSegments ();
+ }
+ });
+
+ delete_introns_item =
+ new JMenuItem ("Remove Introns of Selected Features");
+ delete_introns_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ removeIntrons ();
+ }
+ });
+
+ edit_header_item = new JMenuItem ("Edit Header Of Default Entry");
+ edit_header_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ editHeader ();
+ }
+ });
+
+ move_features_menu = new JMenu ("Move Selected Features To");
+ copy_features_menu = new JMenu ("Copy Selected Features To");
+
+ if (entry_group == null || getEntryGroup ().size () == 0) {
+ move_features_menu.add (new JMenuItem ("(No Entries Currently)"));
+ copy_features_menu.add (new JMenuItem ("(No Entries Currently)"));
+ } else {
+ for (int i = 0 ; i < getEntryGroup ().size () ; ++i) {
+ final Entry this_entry = getEntryGroup ().elementAt (i);
+
+ String entry_name = this_entry.getName ();
+
+ if (entry_name == null) {
+ entry_name = "no name";
+ }
+
+ final JMenuItem move_to_item = new JMenuItem (entry_name);
+
+ move_to_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ // unselect, move, then reselect (for speed)
+ final FeatureVector selected_features =
+ getSelection ().getAllFeatures ();
+ getSelection ().clear ();
+ moveFeatures (selected_features, this_entry);
+ getSelection ().set (selected_features);
+ }
+ });
+ move_features_menu.add (move_to_item);
+
+ final JMenuItem copy_to_item = new JMenuItem (entry_name);
+
+ copy_to_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ copyFeatures (getSelection ().getAllFeatures (), this_entry);
+ }
+ });
+ copy_features_menu.add (copy_to_item);
+ }
+ }
+
+ trim_to_any_item = new JMenuItem ("Trim Selected Features To Any");
+ trim_to_any_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ EditMenu.trimSelected (getParentFrame (), getSelection (),
+ getEntryGroup (), true, false);
+ }
+ });
+
+ trim_item = new JMenuItem ("Trim Selected Features To Met");
+ trim_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ EditMenu.trimSelected (getParentFrame (), getSelection (),
+ getEntryGroup (), false, false);
+ }
+ });
+
+ trim_to_next_any_item =
+ new JMenuItem ("Trim Selected Features To Next Any");
+ trim_to_next_any_item.setAccelerator (TRIM_FEATURES_TO_NEXT_ANY_KEY);
+ trim_to_next_any_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ EditMenu.trimSelected (getParentFrame (), getSelection (),
+ getEntryGroup (), true, true);
+ }
+ });
+
+ trim_to_next_item = new JMenuItem ("Trim Selected Features To Next Met");
+ trim_to_next_item.setAccelerator (TRIM_FEATURES_KEY);
+ trim_to_next_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ EditMenu.trimSelected (getParentFrame (), getSelection (),
+ getEntryGroup (), false, true);
+ }
+ });
+
+ extend_to_prev_stop_item =
+ new JMenuItem ("Extend to Previous Stop Codon");
+ extend_to_prev_stop_item.setAccelerator (EXTEND_TO_PREVIOUS_STOP_CODON_KEY);
+ extend_to_prev_stop_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ extendToORF (getParentFrame (), getSelection (),
+ getEntryGroup (), false);
+ }
+ });
+
+ extend_to_next_stop_item = new JMenuItem ("Extend to Next Stop Codon");
+ extend_to_next_stop_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ extendToORF (getParentFrame (), getSelection (),
+ getEntryGroup (), true);
+ }
+ });
+
+ fix_stop_codons_item = new JMenuItem ("Fix Stop Codons");
+ fix_stop_codons_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ fixStopCodons ();
+ }
+ });
+
+ auto_gene_name_item = new JMenuItem ("Automatically Create Gene Names");
+ auto_gene_name_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ autoGeneName ();
+ }
+ });
+
+ fix_gene_names_item = new JMenuItem ("Fix Gene Names");
+ fix_gene_names_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ fixGeneNames (getParentFrame (), getEntryGroup (),
+ getSelection ());
+ }
+ });
+
+ reverse_complement_item = new JMenuItem ("Reverse And Complement");
+ reverse_complement_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ reverseAndComplement ();
+ }
+ });
+
+ delete_bases_item = new JMenuItem ("Delete Selected Bases");
+ delete_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ deleteSelectedBases ();
+ }
+ });
+
+ add_bases_item = new JMenuItem ("Add Bases At Selection");
+ add_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ addBases ();
+ }
+ });
+
+ if (Options.readWritePossible ()) {
+ // only the standalone version can save or read
+ add_bases_from_file_item = new JMenuItem ("Add Bases From File ...");
+ add_bases_from_file_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ addBasesFromFile ();
+ }
+ });
+ }
+
+ if (Options.getOptions ().getPropertyTruthValue ("val_mode")) {
+ add (edit_feature_item);
+ add (edit_subsequence_item);
+ addSeparator ();
+ add (edit_header_item);
+ addSeparator ();
+ }
+
+ if (Options.getOptions ().getUndoLevels () > 0) {
+ add (undo_item);
+ addSeparator ();
+ }
+
+ if (!Options.getOptions ().getPropertyTruthValue ("val_mode")) {
+ add (edit_feature_item);
+ add (edit_subsequence_item);
+ addSeparator ();
+ add (edit_header_item);
+ addSeparator ();
+ }
+
+ add (add_qualifiers_item);
+ add (remove_qualifier_item);
+ add (duplicate_item);
+ add (merge_features_item);
+ add (unmerge_feature_item);
+ add (delete_features_item);
+ add (delete_segments_item);
+ add (delete_introns_item);
+ addSeparator ();
+ add (move_features_menu);
+ add (copy_features_menu);
+ addSeparator ();
+ add (trim_item);
+ add (trim_to_any_item);
+ add (trim_to_next_item);
+ add (trim_to_next_any_item);
+ add (extend_to_prev_stop_item);
+ add (extend_to_next_stop_item);
+ add (fix_stop_codons_item);
+ addSeparator ();
+ add (auto_gene_name_item);
+ add (fix_gene_names_item);
+ add (reverse_complement_item);
+ add (delete_bases_item);
+ add (add_bases_item);
+ if (Options.readWritePossible ()) {
+ // only the standalone version can save or read
+ add (add_bases_from_file_item);
+ }
+ }
+
+ /**
+ * Undo the last change by calling ActionController.undo().
+ * @param frame The Frame to use for MessageDialog components.
+ * @param selection The current Selection - needs to be cleared before undo
+ * @param entry_group Used to get the ActionController for calling
+ * ActionController.undo().
+ **/
+ public static void undo (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group) {
+ if (Options.getOptions ().getUndoLevels () == 0) {
+ // undo disabled
+ return;
+ }
+
+ if (entry_group.getActionController ().canUndo ()) {
+ // clear the selection because something in the selection might
+ // disappear after the undo() eg. create a feature, select it then undo
+ selection.clear ();
+ }
+
+ if (!entry_group.getActionController ().undo ()) {
+ new MessageDialog (frame, "sorry - no further undo information");
+ }
+ }
+
+ /**
+ * editSelectedFeatures () etc. will only edit this many features.
+ **/
+ private static final int MAXIMUM_SELECTED_FEATURES = 25;
+
+ /**
+ * Open an edit window (FeatureEdit) for each of the selected features.
+ * The edit component will listen for feature change events and update
+ * itself.
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The selected features to edit.
+ * @param entry_group Used to get the ActionController for calling
+ * startAction() and endAction().
+ **/
+ static void editSelectedFeatures (final JFrame frame,
+ final EntryGroup entry_group,
+ final Selection selection,
+ final GotoEventSource goto_event_source) {
+ final FeatureVector features_to_edit = selection.getAllFeatures ();
+
+ if (features_to_edit.size () > MAXIMUM_SELECTED_FEATURES) {
+ new MessageDialog (frame, "warning: only editing the first " +
+ MAXIMUM_SELECTED_FEATURES +
+ " selected features");
+ }
+
+ for (int i = 0 ;
+ i < features_to_edit.size () && i < MAXIMUM_SELECTED_FEATURES ;
+ ++i) {
+ final Feature selection_feature = features_to_edit.elementAt (i);
+
+ new FeatureEdit (selection_feature, entry_group, selection,
+ goto_event_source).show ();
+ }
+
+ selection.set (features_to_edit);
+ }
+
+ /**
+ * Create a new EntryEdit component that contains only the selected
+ * sequence and the features in the selected range.
+ **/
+ private void editSubSequence () {
+ if (getSelection ().isEmpty ()) {
+ new MessageDialog (getParentFrame (), "nothing selected");
+ }
+
+ final Range range = getSelection ().getSelectionRange ();
+
+ final EntryGroup new_entry_group = getEntryGroup ().truncate (range);
+
+ new EntryEdit (new_entry_group).show ();
+ }
+
+ /**
+ * Open a EntryHeaderEdit window for the default entry.
+ **/
+ private void editHeader () {
+ final Entry default_entry = getEntryGroup ().getDefaultEntry ();
+
+ if (default_entry == null) {
+ final String message =
+ "there is no default entry";
+ new MessageDialog (getParentFrame (), message);
+ } else {
+ if (default_entry.isReadOnly ()) {
+ new MessageDialog (getParentFrame (),
+ "the default entry is read-only " +
+ "- cannot continue");
+ return;
+ }
+
+ new EntryHeaderEdit (entry_group, default_entry);
+ }
+ }
+
+ /**
+ * Merge the selected features into one Feature. If there are selected
+ * segments then the owning Feature of each segment will be the Feature
+ * that is merged. This method will create a new Feature.
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The Selection containing the features to merge.
+ * @param entry_group Used to get the ActionController for calling
+ * startAction() and endAction().
+ **/
+ static void mergeFeatures (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ if (!checkForSelectionFeatures (frame, selection,
+ 10, "really merge all (>10) " +
+ "selected features?")) {
+ return;
+ }
+
+ final FeatureVector features_to_merge = selection.getAllFeatures ();
+
+ if (features_to_merge.size () < 2) {
+ new MessageDialog (frame,
+ "nothing to merge - select more than one feature");
+ return;
+ }
+
+ final Feature merge_feature = features_to_merge.elementAt (0);
+
+ // make sure all the features are on the same strand
+ for (int i = 1 ; i < features_to_merge.size () ; ++i) {
+ final Feature this_feature = features_to_merge.elementAt (i);
+
+ if (this_feature.isForwardFeature () !=
+ merge_feature.isForwardFeature ()) {
+ new MessageDialog (frame,
+ "all the features in a merge must be on the " +
+ "same strand");
+ return;
+ }
+
+ if (! this_feature.getKey ().equals (merge_feature.getKey ())) {
+ new MessageDialog (frame,
+ "all the features in a merge must have the " +
+ "same key");
+ return;
+ }
+ }
+
+ if (Options.getOptions ().isNoddyMode ()) {
+ final YesNoDialog dialog =
+ new YesNoDialog (frame,
+ "Are you sure you want to merge the selected " +
+ "features?");
+
+ if (!dialog.getResult ()) {
+ return;
+ }
+ }
+
+ final Feature new_feature;
+
+ try {
+ new_feature = merge_feature.duplicate ();
+ } catch (ReadOnlyException e) {
+ final String message =
+ "one or more of the features is read-only or is in a " +
+ "read-only entry - cannot continue";
+ new MessageDialog (frame, message);
+ return;
+ }
+
+ for (int i = 1 ; i < features_to_merge.size () ; ++i) {
+ final Feature this_feature = features_to_merge.elementAt (i);
+
+ final QualifierVector qualifiers = this_feature.getQualifiers ();
+
+ for (int qualifier_index = 0 ;
+ qualifier_index < qualifiers.size () ;
+ ++qualifier_index) {
+ final Qualifier this_qualifier =
+ qualifiers.elementAt (qualifier_index);
+
+ try {
+ new_feature.addQualifierValues (this_qualifier);
+ } catch (EntryInformationException e) {
+ try {
+ new_feature.removeFromEntry ();
+ } catch (ReadOnlyException _) {
+ // give up ...
+ }
+ final String message =
+ "destination entry does not support all the qualifiers " +
+ "needed by " + this_feature.getIDString ();
+ new MessageDialog (frame, message);
+ } catch (ReadOnlyException e) {
+ final String message = "the new feature is read-only so " +
+ "some qualifiers have been lost";
+ new MessageDialog (frame, message);
+ }
+ }
+
+ final FeatureSegmentVector segments = this_feature.getSegments ();
+
+ for (int segment_index = 0 ;
+ segment_index < segments.size () ;
+ ++segment_index) {
+ final FeatureSegment this_segment =
+ segments.elementAt (segment_index);
+
+ final Range this_range = this_segment.getRawRange ();
+
+ try {
+ new_feature.addSegment (this_range);
+ } catch (ReadOnlyException e) {
+ final String message =
+ "merging failed because the entry is read-only";
+ new MessageDialog (frame, message);
+ try {
+ new_feature.removeFromEntry ();
+ } catch (ReadOnlyException _) {
+ // oh dear ...
+ }
+ }
+ }
+ }
+
+ // this is set to true when a merge is done in the next (inner) loop
+ boolean keep_looping = true;
+
+ // this is a bit inefficient, but there aren't normally many segments
+ LOOP:
+ while (keep_looping) {
+ final FeatureSegmentVector feature_segments =
+ new_feature.getSegments ();
+
+ keep_looping = false;
+
+ // now merge overlapping ranges
+ for (int segment_index = 0 ;
+ segment_index < feature_segments.size () - 1;
+ ++segment_index) {
+
+ final FeatureSegment this_segment =
+ feature_segments.elementAt (segment_index);
+ final MarkerRange this_range = this_segment.getMarkerRange ();
+
+ final FeatureSegment next_segment =
+ feature_segments.elementAt (segment_index + 1);
+ final MarkerRange next_range = next_segment.getMarkerRange ();
+
+ // if it overlaps the next Range then merge it
+ if (this_range.overlaps (next_range) &&
+ this_segment.getFrameID () == next_segment.getFrameID ()) {
+ try {
+ final Range new_range =
+ this_range.combineRanges (next_range, false).getRawRange ();
+ new_feature.addSegment (new_range);
+ new_feature.removeSegment (this_segment);
+ new_feature.removeSegment (next_segment);
+
+ // start again
+ keep_looping = true;
+ continue LOOP;
+ } catch (ReadOnlyException e) {
+ final String message =
+ "merging failed because the entry is read-only";
+ new MessageDialog (frame, message);
+ } catch (LastSegmentException e) {
+ throw new Error ("internal error - tried to remove " +
+ "last segment: " + e);
+ }
+ }
+ }
+ }
+
+ boolean delete_old_features;
+
+ if (Options.getOptions ().isNoddyMode ()) {
+ final YesNoDialog delete_old_dialog =
+ new YesNoDialog (frame, "delete old features?");
+
+ delete_old_features = delete_old_dialog.getResult ();
+ } else {
+ delete_old_features = true;
+ }
+
+ if (delete_old_features) {
+ if (getReadOnlyFeatures (features_to_merge).size () > 0) {
+ new MessageDialog (frame, "deletion failed because the features " +
+ "are read-only");
+ } else {
+ for (int i = 0 ; i < features_to_merge.size () ; ++i) {
+ try {
+ features_to_merge.elementAt (i).removeFromEntry ();
+ } catch (ReadOnlyException e) {
+ new MessageDialog (frame, "deletion failed one or more of the " +
+ "features are read-only");
+ }
+ }
+ }
+ }
+
+ selection.set (new_feature);
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * If the selection contains exactly two segments and those segments are
+ * adjacent in the same feature, split the feature into two pieces. The
+ * orignal feature is truncated and a new feature is created. The
+ * qualifiers of the old feature are copied to new feature.
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The Selection containing the segments to unmerge.
+ * @param entry_group Used to get the ActionController for calling
+ * startAction() and endAction().
+ **/
+ static void unmergeFeature (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ final FeatureSegmentVector selected_segments =
+ selection.getSelectedSegments ();
+
+ if (selected_segments.size () != 2) {
+ final String message =
+ "you need to select exactly two exons use unmerge";
+ new MessageDialog (frame, message);
+ return;
+ }
+
+ FeatureSegment first_segment = selected_segments.elementAt (0);
+ FeatureSegment second_segment = selected_segments.elementAt (1);
+
+ if (first_segment.getFeature () != second_segment.getFeature ()) {
+ final String message =
+ "you need to select two exons from the same feature to use unmerge";
+ new MessageDialog (frame, message);
+ return;
+ }
+
+ final Feature segment_feature = first_segment.getFeature ();
+
+ final FeatureSegmentVector all_feature_segments =
+ segment_feature.getSegments ();
+
+ int index_of_first_segment =
+ all_feature_segments.indexOf (first_segment);
+ int index_of_second_segment =
+ all_feature_segments.indexOf (second_segment);
+
+ if (index_of_first_segment - index_of_second_segment < -1 ||
+ index_of_first_segment - index_of_second_segment > 1) {
+ final String message =
+ "you need to select two adjacent exons to use unmerge";
+ new MessageDialog (frame, message);
+ return;
+ }
+
+ if (index_of_second_segment < index_of_first_segment) {
+ // swap the segments for consistency
+ final FeatureSegment temp_segment = first_segment;
+ final int temp_segment_index = index_of_first_segment;
+
+ first_segment = second_segment;
+ index_of_first_segment = index_of_second_segment;
+
+ second_segment = temp_segment;
+ index_of_second_segment = temp_segment_index;
+ }
+
+ try {
+ final Feature new_feature = segment_feature.duplicate ();
+
+ // we set the Selection later
+ selection.clear ();
+
+ // delete the segments starting at index_of_second_segment from
+ // segment_feature and delete the segments up to (and including)
+ // index_of_first_segment from new_feature
+
+ for (int i = all_feature_segments.size () - 1 ;
+ i >= index_of_second_segment ;
+ --i) {
+ segment_feature.getSegments ().elementAt (i).removeFromFeature ();
+ }
+
+ // remove the first segment of new_feature index_of_first_segment times
+ for (int i = 0 ; i <= index_of_first_segment ; ++i) {
+ new_feature.getSegments ().elementAt (0).removeFromFeature ();
+ }
+
+ selection.set (segment_feature.getSegments ().lastElement ());
+ selection.add (new_feature.getSegments ().elementAt (0));
+ } catch (ReadOnlyException e) {
+ final String message =
+ "the selected exons (in " +
+ segment_feature.getIDString () +
+ ") are in a read only entry - cannot continue";
+ new MessageDialog (frame, message);
+ } catch (LastSegmentException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Create a QualifierEditor JFrame that acts on the selected features.
+ * @param frame The JFrame to use for MessageDialog components.
+ **/
+ private void addQualifiers (final JFrame frame, final Selection selection) {
+ if (!checkForSelectionFeatures (frame, selection)) {
+ return;
+ }
+
+ final FeatureVector selected_features = selection.getAllFeatures ();
+
+ if (getReadOnlyFeatures (selected_features).size () > 0) {
+ new MessageDialog (frame,
+ "one or more of the selected features is read-only " +
+ "- cannot continue");
+ return;
+ }
+
+ final QualifierEditor qualifier_editor =
+ new QualifierEditor (selected_features, getEntryGroup ());
+
+ qualifier_editor.setVisible (true);
+ }
+
+ /**
+ * Offer the user a choice of qualifier to remove from the selected features
+ **/
+ private void removeQualifier (final JFrame frame, final Selection selection) {
+ if (!checkForSelectionFeatures (frame, selection)) {
+ return;
+ }
+
+ final FeatureVector selected_features = selection.getAllFeatures ();
+
+ final StringVector qualifier_names =
+ Feature.getAllQualifierNames (selected_features);
+
+ if (qualifier_names.size () == 0) {
+ new MessageDialog (getParentFrame (), "feature has no qualifiers");
+ return;
+ }
+
+ final ChoiceFrame choice_frame =
+ new ChoiceFrame ("Select a qualifer name", qualifier_names);
+
+ final JComboBox choice = choice_frame.getChoice ();
+
+
+ final int MAX_VISIBLE_ROWS = 30;
+
+ choice.setMaximumRowCount (MAX_VISIBLE_ROWS);
+
+ choice.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent _) {
+ removeQualifierFromFeatures (selected_features,
+ (String) choice.getSelectedItem ());
+ choice_frame.setVisible (false);
+ choice_frame.dispose ();
+ }
+ });
+
+ choice_frame.getOKButton ().addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent _) {
+ removeQualifierFromFeatures (selected_features,
+ (String) choice.getSelectedItem ());
+ }
+ });
+
+ choice_frame.setVisible (true);
+ }
+
+ /**
+ * Remove the qualifier given by qualifier_name from the given features.
+ * Silently ignore features that don't have that qualifier. Warn the user
+ * about read-only features.
+ **/
+ private void removeQualifierFromFeatures (final FeatureVector features,
+ final String qualifier_name) {
+ boolean found_read_only = false;
+
+ try {
+ entry_group.getActionController ().startAction ();
+
+ for (int i = 0 ; i < features.size () ; ++i) {
+ final Feature this_feature = features.elementAt (i);
+ try {
+ this_feature.removeQualifierByName (qualifier_name);
+ } catch (OutOfDateException _) {
+ // ignore
+ } catch (EntryInformationException _) {
+ // ignore
+ } catch (ReadOnlyException _) {
+ found_read_only = true;
+ }
+ }
+
+ if (found_read_only) {
+ final String message =
+ "ignored one or more read-only features";
+ new MessageDialog (getParentFrame (), message);
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Duplicate the selected Feature objects. If there are selected segments
+ * then the owning Feature of each segment will be duplicated.
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The Selection containing the features to merge.
+ * @param entry_group Used to get the ActionController for calling
+ * startAction() and endAction().
+ **/
+ static void duplicateFeatures (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ if (getReadOnlyFeatures (selection.getAllFeatures ()).size () > 0) {
+ new MessageDialog (frame,
+ "one or more of the selected features is read-only " +
+ "- cannot continue");
+ return;
+ }
+
+ if (Options.getOptions ().isNoddyMode ()) {
+ final YesNoDialog dialog =
+ new YesNoDialog (frame,
+ "Are you sure you want to duplicate the selected " +
+ "features?");
+
+ if (!dialog.getResult ()) {
+ return;
+ }
+ } else {
+ if (!checkForSelectionFeatures (frame, selection,
+ 100, "really duplicate all (>100) " +
+ "selected features?")) {
+ return;
+ }
+ }
+
+ final FeatureVector features_to_duplicate =
+ selection.getAllFeatures ();
+
+ for (int i = 0 ; i < features_to_duplicate.size () ; ++i) {
+ final Feature this_feature = features_to_duplicate.elementAt (i);
+
+ try {
+ this_feature.duplicate ();
+ } catch (ReadOnlyException e) {
+ final String message =
+ "one of the selected features (" + this_feature.getIDString () +
+ ") is read only - cannot continue";
+ new MessageDialog (frame, message);
+ return;
+ }
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Delete the selected features.
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The Selection containing the features to merge.
+ * @param entry_group Used to get the ActionController for calling
+ * startAction() and endAction().
+ **/
+ static void deleteSelectedFeatures (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ final FeatureVector features_to_delete = selection.getAllFeatures ();
+
+ final String feature_count_string;
+
+ if (features_to_delete.size () == 1) {
+ feature_count_string = "the selected feature";
+ } else {
+ feature_count_string = features_to_delete.size () + " features";
+ }
+
+ if (Options.getOptions ().isNoddyMode ()) {
+ // 0 means always popup a YesNoDialog
+ if (!checkForSelectionFeatures (frame, selection, 0,
+ "really delete " +
+ feature_count_string + "?")) {
+ return;
+ }
+ }
+
+ // clear the selection now so that it doesn't need to be updated as each
+ // feature is deleted
+ selection.clear ();
+
+ while (features_to_delete.size () > 0) {
+ // delete in reverse order for speed
+
+ final Feature current_selection_feature =
+ features_to_delete.lastElement ();
+
+ features_to_delete.removeElementAt (features_to_delete.size () - 1);
+
+ try {
+ current_selection_feature.removeFromEntry ();
+ } catch (ReadOnlyException e) {
+ selection.set (current_selection_feature);
+
+ if (features_to_delete.size () == 1) {
+ final String message =
+ "the selected feature (" +
+ current_selection_feature.getIDString () +
+ ") is read only - cannot continue";
+ new MessageDialog (frame, message);
+
+ } else {
+ final String message =
+ "one of the selected features (" +
+ current_selection_feature.getIDString () +
+ ") is read only - cannot continue";
+ new MessageDialog (frame, message);
+ }
+
+ features_to_delete.add (current_selection_feature);
+
+ // reset the select so that the user can see what it was
+ selection.set (features_to_delete);
+
+ return;
+ }
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Delete the selected feature segments.
+ **/
+ private void deleteSelectedSegments () {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ final FeatureSegmentVector segments_to_delete =
+ (FeatureSegmentVector) getSelection ().getSelectedSegments ().clone ();
+
+ if (Options.getOptions ().isNoddyMode ()) {
+ // 0 means always popup a YesNoDialog
+ if (!checkForSelectionFeatureSegments (0, "really delete " +
+ (segments_to_delete.size ()==1 ?
+ "the selected exon?" :
+ segments_to_delete.size () +
+ " exons?"))) {
+ return;
+ }
+ }
+
+ for (int i = 0 ; i < segments_to_delete.size () ; ++i) {
+ final FeatureSegment selection_segment =
+ segments_to_delete.elementAt (i);
+
+ try {
+ getSelection ().remove (selection_segment);
+ selection_segment.removeFromFeature ();
+ } catch (ReadOnlyException e) {
+ final String message =
+ "one of the selected exons (in " +
+ selection_segment.getFeature ().getIDString () +
+ ") is in a read only - cannot continue";
+ new MessageDialog (getParentFrame (), message);
+ } catch (LastSegmentException e) {
+ final String message =
+ "the last exon in this feature: " +
+ selection_segment.getFeature ().getIDString () +
+ " cannot be removed (all features must have at least one exon)";
+ new MessageDialog (getParentFrame (), message);
+ }
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Remove all introns from the selected features.
+ **/
+ private void removeIntrons () {
+ if (!checkForSelectionFeatures ()) {
+ return;
+ }
+
+ boolean found_read_only = false;
+
+ try {
+ entry_group.getActionController ().startAction ();
+
+ final FeatureVector features = getSelection ().getAllFeatures ();
+
+ for (int i = 0 ; i < features.size () ; ++i) {
+ final Feature this_feature = features.elementAt (i);
+ try {
+ final RangeVector new_ranges = new RangeVector ();
+ final Range new_range = this_feature.getMaxRawRange ();
+ new_ranges.add (new_range);
+ final Location old_location = this_feature.getLocation ();
+ final Location new_location =
+ new Location (new_ranges, old_location.isComplement ());
+ this_feature.setLocation (new_location);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (ReadOnlyException _) {
+ found_read_only = true;
+ }
+ }
+
+ if (found_read_only) {
+ final String message =
+ "ignored one or more read-only features";
+ new MessageDialog (getParentFrame (), message);
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Move the given features to the given destination entry.
+ **/
+ private void moveFeatures (final FeatureVector features,
+ final Entry destination_entry) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ if (features.size () == 0) {
+ return;
+ }
+
+ final FeatureVector read_only_features =
+ getReadOnlyFeatures (features);
+
+ if (read_only_features.size () > 0) {
+ final String message =
+ (features.size () == 1 ?
+ "the selected feature (" +
+ read_only_features.elementAt (0).getIDString () +
+ ") is read only " :
+ "some of the selected features (eg. " +
+ read_only_features.elementAt (0).getIDString () +
+ ") are read only - ") +
+ "cannot continue";
+ new MessageDialog (getParentFrame (), message);
+ return;
+ }
+
+ FEATURES:
+ for (int i = 0 ; i < features.size () ; ++i) {
+ final Feature this_feature = features.elementAt (i);
+
+ // check that we don't loop forever (perhaps due to bugs in
+ // handleOpenException())
+ final int MAX_COUNT = 100;
+
+ int count = 0;
+
+ while (count++ < MAX_COUNT) {
+ try {
+ this_feature.moveTo (destination_entry, false);
+ continue FEATURES;
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (EntryInformationException e) {
+ final EntryInformation dest_entry_information =
+ destination_entry.getEntryInformation ();
+ dest_entry_information.fixException (e);
+ continue;
+ } catch (ReadOnlyException e) {
+ final String message =
+ "either the source or destination for one of the features is " +
+ "read only - cannot continue";
+ new MessageDialog (getParentFrame (), message);
+ return;
+ }
+ }
+
+ final String message =
+ "internal error while copying";
+ new MessageDialog (getParentFrame (), message);
+
+ throw new Error ("internal error in EditMenu.copyFeatures() - infinite loop");
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Copy the given features to the given destination entry.
+ **/
+ private void copyFeatures (final FeatureVector features,
+ final Entry destination_entry) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ FEATURES:
+ for (int i = 0 ; i < features.size () ; ++i) {
+ final Feature this_feature = features.elementAt (i);
+
+ // check that we don't loop forever (perhaps due to bugs in
+ // handleOpenException())
+ final int MAX_COUNT = 100;
+
+ int count = 0;
+
+ while (count++ < MAX_COUNT) {
+ try {
+ this_feature.copyTo (destination_entry);
+ continue FEATURES;
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (EntryInformationException e) {
+ final EntryInformation dest_entry_information =
+ destination_entry.getEntryInformation ();
+ dest_entry_information.fixException (e);
+ continue;
+ } catch (ReadOnlyException e) {
+ final String message =
+ "the destination entry is read only - cannot continue";
+ new MessageDialog (getParentFrame (), message);
+ return;
+ }
+ }
+
+ final String message = "internal error while copying";
+ new MessageDialog (getParentFrame (), message);
+
+ throw new Error ("internal error in EditMenu.copyFeatures() - " +
+ "infinite loop");
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Calls fixStopCodon () on each selected feature.
+ **/
+ private void fixStopCodons () {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ if (!checkForSelectionFeatures ()) {
+ return;
+ }
+
+ // features that can't be fixed
+ final FeatureVector bad_features = new FeatureVector ();
+
+ final FeatureVector features_to_fix = getSelection ().getAllFeatures ();
+
+ for (int i = 0 ; i < features_to_fix.size () ; ++i) {
+ final Feature selection_feature = features_to_fix.elementAt (i);
+
+ if (!selection_feature.isCDS ()) {
+ final String message =
+ "Warning: some of the selected features are not coding features. " +
+ "Continue?";
+
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog (getParentFrame (), message);
+
+ if (yes_no_dialog.getResult ()) {
+ break;
+ } else {
+ return;
+ }
+ }
+ }
+
+ for (int i = 0 ; i < features_to_fix.size () ; ++i) {
+ final Feature selection_feature = features_to_fix.elementAt (i);
+
+ try {
+ if (!selection_feature.fixStopCodon ()) {
+ bad_features.add (selection_feature);
+ }
+ } catch (ReadOnlyException e) {
+ final String message =
+ "one of the entries is read only - cannot continue";
+ new MessageDialog (getParentFrame (), message);
+ break;
+ }
+ }
+
+ if (bad_features.size () > 0) {
+ // select the bad feature
+ getSelection ().set (bad_features);
+
+ final String message =
+ "Warning: could not fix the stop codon for some of the features. " +
+ "View them now?";
+
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog (getParentFrame (), message);
+
+ if (yes_no_dialog.getResult ()) {
+ final FeaturePredicate predicate =
+ new FeatureFromVectorPredicate (bad_features);
+
+ final String filter_name =
+ "features that can't be fixed (filtered from: " +
+ getParentFrame ().getTitle () + ")";
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, predicate, filter_name);
+
+ final FeatureListFrame feature_list_frame =
+ new FeatureListFrame (filter_name,
+ getSelection (),
+ goto_event_source, filtered_entry_group,
+ base_plot_group);
+
+ feature_list_frame.setVisible (true);
+ }
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Calls Feature.trimStart () on all selected Feature objects.
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param entry_group Used to get the ActionController for calling
+ * startAction().
+ * @param trim_to_any If true then the features will be trimmed to ATG, GTG
+ * or TTG, otherwise the features will be trimmed to ATG only.
+ * @param trim_to_next If true then the features will be trimmed to the
+ * next start codon (dependent on trim_to_any) regardless of whether the
+ * feature currently start on a start codon. If false then the feature
+ * will only be trimmed if the feature doesn't start on a start codon.
+ **/
+ static public void trimSelected (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final boolean trim_to_any,
+ final boolean trim_to_next) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ if (!checkForSelectionFeatures (frame, selection)) {
+ return;
+ }
+
+ final FeatureVector features_to_trim = selection.getAllFeatures ();
+
+ // this will contain the features that could not be trimmed
+ final FeatureVector failed_features = new FeatureVector ();
+
+ for (int i = 0 ; i < features_to_trim.size () ; ++i) {
+ final Feature selection_feature = features_to_trim.elementAt (i);
+
+ try {
+ if (!selection_feature.trimStart (trim_to_any, trim_to_next)) {
+ failed_features.add (selection_feature);
+ }
+ } catch (ReadOnlyException e) {
+ final String message =
+ "one or more of the of the selected features are read only " +
+ "- cannot continue";
+ new MessageDialog (frame, message);
+ break;
+ }
+ }
+
+ if (failed_features.size () > 0) {
+ selection.set (failed_features);
+
+ if (failed_features.size () == 1) {
+ final String message = "could not trim the feature";
+
+ new MessageDialog (frame, message);
+
+ } else {
+ final String message =
+ "some features could not be trimmed (they are now selected)";
+
+ new MessageDialog (frame, message);
+ }
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Extend the selected segments/features so that they reach to the start or
+ * end of their containing ORF.
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param entry_group Used to get the ActionController for calling
+ * startAction() and endAction().
+ * @param extend_to_next_stop If true the feature is extended to the next
+ * stop codon (but it won't include the next stop). If false the feature
+ * is extended to the previous stop codon (but it won't include the
+ * previous stop).
+ **/
+ public static void extendToORF (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final boolean extend_to_next_stop) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ if (!checkForSelectionFeatures (frame, selection)) {
+ return;
+ }
+
+ final FeatureVector features_to_extend = selection.getAllFeatures ();
+
+ for (int i = 0 ; i < features_to_extend.size () ; ++i) {
+ final Feature selection_feature = features_to_extend.elementAt (i);
+
+ if (selection_feature.isReadOnly ()) {
+ final String message =
+ "one or more of the of the selected features are read only " +
+ "- cannot continue";
+ new MessageDialog (frame, message);
+ break;
+ }
+
+ if (selection_feature.getSegments ().size () < 1) {
+ continue;
+ }
+
+ final FeatureSegmentVector feature_segments =
+ selection_feature.getSegments ();
+
+ if (feature_segments.size () == 0) {
+ continue;
+ }
+
+ final Strand strand = selection_feature.getStrand ();
+
+ if (extend_to_next_stop) {
+ if (selection_feature.hasValidStopCodon ()) {
+ continue;
+ }
+
+ final Marker feature_end_marker =
+ selection_feature.getLastBaseMarker ();
+
+ Marker end_marker_copy = null;
+
+ // get the marker of the first base of the last codon in the range
+ // (we want to keep in the same frame)
+ try {
+ if (selection_feature.getBaseCount () == 1) {
+ end_marker_copy = feature_end_marker;
+ } else {
+ if (selection_feature.getBaseCount () == 2) {
+ end_marker_copy = feature_end_marker.moveBy (-1);
+ } else {
+ // go to the start of the codon
+ end_marker_copy = feature_end_marker.moveBy (-2);
+ }
+ }
+
+ // adjust for /codon_start
+ final int frame_shift =
+ selection_feature.getCodonStart () - 1;
+
+ // the number of bases from the start of translation to the
+ // end of the feature
+ final int bases_from_start_pos_mod_3 =
+ (3 + selection_feature.getBaseCount () - frame_shift) % 3;
+
+ end_marker_copy =
+ end_marker_copy.moveBy (-bases_from_start_pos_mod_3);
+ } catch (OutOfRangeException e) {
+ end_marker_copy = feature_end_marker;
+ }
+
+ final MarkerRange end_orf_range =
+ strand.getORFAroundMarker (end_marker_copy, true);
+
+ if (end_orf_range == null) {
+ // end_marker_copy is at the start base of a stop codon
+ continue;
+ }
+
+ final Marker new_end_marker = end_orf_range.getEnd ();
+
+ try {
+ feature_end_marker.setPosition (new_end_marker.getPosition ());
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+
+ } else {
+ final AminoAcidSequence translation =
+ selection_feature.getTranslation ();
+
+ if (translation.length () > 0) {
+ final char first_aa = translation.elementAt (0);
+
+ if (AminoAcidSequence.isStopCodon (first_aa)) {
+ continue;
+ }
+ }
+
+ final Marker feature_start_marker =
+ selection_feature.getFirstBaseMarker ();
+
+ Marker start_marker_copy = feature_start_marker;
+
+ final int frame_shift =
+ selection_feature.getCodonStart () - 1;
+
+ if (frame_shift != 0) {
+ try {
+ start_marker_copy =
+ feature_start_marker.moveBy (frame_shift);
+ } catch (OutOfRangeException e) {
+ // ignore and hope for the best
+ }
+ }
+
+ final MarkerRange start_orf_range =
+ strand.getORFAroundMarker (start_marker_copy, true);
+
+ final Marker new_start_marker = start_orf_range.getStart ();
+
+ try {
+ feature_start_marker.setPosition (new_start_marker.getPosition ());
+ selection_feature.removeQualifierByName ("codon_start");
+ } catch (EntryInformationException _) {
+ // ignore - if we can't remove codon_start, then it won't have
+ // been there to start with
+ } catch (OutOfDateException _) {
+ // ignore
+ } catch (ReadOnlyException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Reverse and complement the sequence and all the features in all Entry
+ * objects.
+ **/
+ private void reverseAndComplement () {
+ if (getEntryGroup ().isReadOnly ()) {
+ final String message =
+ "one or more of the entries or features are read only - " +
+ "cannot continue";
+ new MessageDialog (getParentFrame (), message);
+ return;
+ }
+
+ final YesNoDialog dialog =
+ new YesNoDialog (getParentFrame (),
+ "Are you sure you want to reverse complement all " +
+ "entries?");
+
+ if (!dialog.getResult ()) {
+ return;
+ }
+
+ try {
+ getEntryGroup ().reverseComplement ();
+
+ makeSelectionStartVisible ();
+ } catch (ReadOnlyException e) {
+ final String message =
+ "one of the entries is read only - cannot continue";
+ new MessageDialog (getParentFrame (), message);
+ return;
+ }
+ }
+
+ /**
+ * Delete the selected bases after asking the user for confimation.
+ **/
+ private void deleteSelectedBases () {
+ if (!checkForSelectionRange ()) {
+ return;
+ }
+
+ final MarkerRange marker_range = getSelection ().getMarkerRange ();
+
+ if (marker_range.getCount () == getEntryGroup ().getSequenceLength ()) {
+ new MessageDialog (getParentFrame (), "You can't delete every base");
+ return;
+ }
+
+ if (getEntryGroup ().isReadOnly ()) {
+ new MessageDialog (getParentFrame (),
+ "one of the current entries or features is " +
+ "read-only - connot continue");
+ return;
+ }
+
+ final Range raw_range = marker_range.getRawRange ();
+
+ final FeatureVector features_in_range;
+
+ final EntryVector old_active_entries =
+ getEntryGroup ().getActiveEntries ();
+
+ // make all the entries active so that getFeaturesInRange () gets
+ // everything
+ for (int i = 0 ; i < getEntryGroup ().size () ; ++i) {
+ getEntryGroup ().setIsActive (i, true);
+ }
+
+ try {
+ features_in_range =
+ getEntryGroup ().getFeaturesInRange (raw_range);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+
+ if (features_in_range.size () != 0) {
+ final FeatureVector read_only_features =
+ getReadOnlyFeatures (features_in_range);
+
+ if (read_only_features.size () > 0) {
+ getSelection ().set (read_only_features);
+ final String message =
+ "one or more of the features in the selected range are " +
+ "read only - cannot continue";
+ new MessageDialog (getParentFrame (), message);
+ getSelection ().setMarkerRange (marker_range);
+ return;
+ }
+
+ for (int feature_index = 0 ;
+ feature_index < features_in_range.size () ;
+ ++feature_index) {
+ final Feature this_feature =
+ features_in_range.elementAt (feature_index);
+
+ final FeatureSegmentVector segments = this_feature.getSegments ();
+
+ for (int i = 0 ; i < segments.size () ; ++i) {
+ final FeatureSegment this_segment = segments.elementAt (i);
+
+ final Range this_segment_range = this_segment.getRawRange ();
+
+ if (raw_range.getStart () <= this_segment_range.getStart () &&
+ raw_range.getEnd () >= this_segment_range.getStart () ||
+ raw_range.getStart () <= this_segment_range.getEnd () &&
+ raw_range.getEnd () >= this_segment_range.getEnd ()) {
+ new MessageDialog (getParentFrame (),
+ "the selected range overlaps the " +
+ "start or end of an exon - cannot continue");
+ return;
+ }
+ }
+ }
+ }
+
+ // reset the EntryGroup to the state it was in originally
+ for (int i = 0 ; i < getEntryGroup ().size () ; ++i) {
+ final Entry this_entry = getEntryGroup ().elementAt (i);
+ final boolean old_active_flag =
+ old_active_entries.contains (this_entry);
+ getEntryGroup ().setIsActive (i, old_active_flag);
+ }
+
+ if (Options.getOptions ().isNoddyMode ()) {
+ final YesNoDialog dialog =
+ new YesNoDialog (getParentFrame (),
+ "Are you sure you want to delete the " +
+ "selected bases?");
+ if (!dialog.getResult ()) {
+ return;
+ }
+ }
+
+ try {
+ getSelection ().setMarkerRange (null);
+
+ // deleteRange () is static and uses the strand reference from the
+ // MarkerRange to decide which Strand to edit
+ Strand.deleteRange (marker_range);
+ } catch (ReadOnlyException e) {
+ getSelection ().setMarkerRange (marker_range);
+
+ new MessageDialog (getParentFrame (),
+ "the bases are read only - cannot delete");
+ return;
+ }
+ }
+
+ /**
+ * Ask the user for some bases and then add them at the start of the
+ * selected range.
+ **/
+ private void addBases () {
+ if (!checkForSelectionRange ()) {
+ return;
+ }
+
+ if (getEntryGroup ().isReadOnly ()) {
+ new MessageDialog (getParentFrame (),
+ "one of the current entries or features is " +
+ "read-only - connot continue");
+ return;
+ }
+
+ final MarkerRange range = getSelection ().getMarkerRange ();
+
+ final TextRequester text_requester =
+ new TextRequester ("enter the bases to insert before base " +
+ range.getStart ().getPosition () +
+ (range.isForwardMarker () ?
+ " on the forward strand" :
+ " on the reverse strand") + ":",
+ 18, "");
+
+ text_requester.addTextRequesterListener (new TextRequesterListener () {
+ public void actionPerformed (final TextRequesterEvent event) {
+ if (event.getType () == TextRequesterEvent.CANCEL) {
+ return;
+ }
+
+ final String bases_string = event.getRequesterText ().trim ();
+
+ if (bases_string.length () == 0) {
+ new MessageDialog (getParentFrame (), "no bases inserted");
+ return;
+ }
+
+ try {
+ // addBases () is static and uses the strand reference from the
+ // start Marker to decide which Strand to edit
+ Strand.addBases (range.getStart (), bases_string);
+ } catch (ReadOnlyException e) {
+ new MessageDialog (getParentFrame (),
+ "sorry the bases are read only");
+ return;
+ } catch (org.biojava.bio.symbol.IllegalSymbolException e) {
+ new MessageDialog (getParentFrame (),
+ "sorry - new sequence contains non-IUB base " +
+ "codes");
+ return;
+ }
+ }
+ });
+
+ text_requester.show ();
+ }
+
+
+ /**
+ * Ask the user for some bases and then add them at the start of the
+ * selected range.
+ **/
+ private void addBasesFromFile () {
+ if (!checkForSelectionRange ()) {
+ return;
+ }
+
+ if (getEntryGroup ().isReadOnly ()) {
+ new MessageDialog (getParentFrame (),
+ "one of the current entries or features is " +
+ "read-only - connot continue");
+ return;
+ }
+
+ final MarkerRange range = getSelection ().getMarkerRange ();
+
+ // XXX add an InputStreamProgressListener
+ final EntrySourceVector entry_sources =
+ Utilities.getEntrySources (getParentFrame (), null);
+
+ EntrySource filesystem_entry_source = null;
+
+ for (int source_index = 0 ;
+ source_index < entry_sources.size () ;
+ ++source_index) {
+ final EntrySource this_source =
+ entry_sources.elementAt (source_index);
+
+ if (this_source.isFullEntrySource ()) {
+ continue;
+ }
+
+ if (this_source.getSourceName ().equals ("Filesystem")) {
+ filesystem_entry_source = this_source;
+ }
+ }
+
+ if (filesystem_entry_source == null) {
+ throw new Error ("internal error - can't find a file system to read " +
+ "from");
+ }
+
+ try {
+ final Entry new_entry = filesystem_entry_source.getEntry (true);
+
+ final Bases bases = new_entry.getBases ();
+
+ final String bases_string = bases.toString ();
+
+ if (bases_string.length () == 0) {
+ new MessageDialog (getParentFrame (), "no bases inserted");
+ return;
+ }
+
+ // addBases () is static and uses the strand reference from the
+ // start Marker to decide which Strand to edit
+ Strand.addBases (range.getStart (), bases_string);
+ } catch (ReadOnlyException e) {
+ new MessageDialog (getParentFrame (),
+ "sorry the bases are read only");
+ return;
+ } catch (IOException e) {
+ new MessageDialog (getParentFrame (),
+ "error while reading: " + e.getMessage ());
+ return;
+ } catch (OutOfRangeException e) {
+ new MessageDialog (getParentFrame (),
+ "out of range exception while reading: " +
+ e.getMessage ());
+ return;
+ } catch (NoSequenceException e) {
+ new MessageDialog (getParentFrame (),
+ "sorry the file did not contain any sequence");
+ return;
+ } catch (org.biojava.bio.symbol.IllegalSymbolException e) {
+ new MessageDialog (getParentFrame (),
+ "sorry - new sequence contains non-IUB base " +
+ "codes");
+ return;
+ }
+ }
+
+ /**
+ * Add a qualifier to the given features. The qualifier will normally be a
+ * gene name.
+ * @param prefix_string prefix of the new qualifier eg. SPAC
+ * @param start_number The number to start counting at eg. 1 give SPAC0001
+ * for the first CDS
+ * @param increment The amount to increment by at each gene.
+ * @param qualifier_name The name of the qualifier to add
+ * @param tag_complement_names If True a lowercase "c" will be appended to
+ * the new qualifier values on the reverse strand.
+ **/
+ private void autoGeneNameHelper (final FeatureVector features_to_name,
+ final String prefix_string,
+ final int start_number,
+ final int increment,
+ final String qualifier_name,
+ final boolean tag_complement_names) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ int current_number = start_number;
+
+ for (int i = 0 ; i < features_to_name.size () ; ++i) {
+ final Feature this_feature = features_to_name.elementAt (i);
+
+ final Key key = this_feature.getKey ();
+
+ if (key.equals ("CDS")) {
+ final String number_string;
+
+ if (current_number < 10) {
+ number_string = "000" + current_number;
+ } else {
+ if (current_number < 100) {
+ number_string = "00" + current_number;
+ } else {
+ if (current_number < 1000) {
+ number_string = "0" + current_number;
+ } else {
+ number_string = String.valueOf (current_number);
+ }
+ }
+ }
+
+ try {
+ final Qualifier new_qualifier =
+ new Qualifier (qualifier_name, prefix_string +
+ number_string +
+ (!tag_complement_names ||
+ this_feature.isForwardFeature () ?
+ "" :
+ "c"));
+
+ this_feature.addQualifierValues (new_qualifier);
+ } catch (EntryInformationException e) {
+ new MessageDialog (getParentFrame (),
+ "/" + qualifier_name +
+ " not supported by this entry " +
+ "- cannot continue");
+ return;
+ } catch (ReadOnlyException e) {
+ new MessageDialog (getParentFrame (),
+ "one of the features is in a read-only " +
+ "entry - cannot continue");
+ return;
+ }
+
+ current_number += increment;
+ }
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Automatically create gene names for all CDS features in the active
+ * entries.
+ **/
+ private void autoGeneName () {
+ if (!checkForSelectionFeatures (getParentFrame (), getSelection ())) {
+ return;
+ }
+
+ final FeatureVector features_to_name = getSelection ().getAllFeatures ();
+
+ if (getReadOnlyFeatures (features_to_name).size () > 0) {
+ new MessageDialog (getParentFrame (),
+ "one or more of the current features is " +
+ "read-only - cannot continue");
+ return;
+ }
+
+ final TextDialog prefix_dialog =
+ new TextDialog (getParentFrame (),
+ "enter the start characters of the new gene names:",
+ 18, "");
+
+ final String prefix_text = prefix_dialog.getText ();
+
+ if (prefix_text == null) {
+ return;
+ }
+
+ final String prefix_string = prefix_text.trim ();
+
+ if (prefix_string.length () == 0) {
+ new MessageDialog (getParentFrame (), "no prefix given");
+ return;
+ }
+
+ final TextDialog start_number_dialog =
+ new TextDialog (getParentFrame (),
+ "start counting at:", 18, "1");
+
+ final String start_number_text = start_number_dialog.getText ();
+
+ if (start_number_text == null) {
+ return;
+ }
+
+ String start_string = start_number_text.trim ();
+
+ if (start_string.length () == 0) {
+ new MessageDialog (getParentFrame (), "no start given");
+ return;
+ }
+
+ final int start_value;
+
+ try {
+ start_value = Integer.valueOf (start_string).intValue ();
+ } catch (NumberFormatException e) {
+ new MessageDialog (getParentFrame (),
+ "this is not a number: " + start_string);
+ return;
+ }
+
+ final TextDialog increment_dialog =
+ new TextDialog (getParentFrame (),
+ "increment number by:", 18, "1");
+
+ final String increment_text = increment_dialog.getText ();
+
+ if (increment_text == null) {
+ return;
+ }
+
+ String increment_string = increment_text.trim ();
+
+ if (increment_string.length () == 0) {
+ new MessageDialog (getParentFrame (), "no increment given");
+ return;
+ }
+
+ final int increment_value;
+
+ try {
+ increment_value = Integer.valueOf (increment_string).intValue ();
+ } catch (NumberFormatException e) {
+ new MessageDialog (getParentFrame (),
+ "this is not a number: " + increment_string);
+ return;
+ }
+
+ final TextDialog qualifier_name_dialog =
+ new TextDialog (getParentFrame (),
+ "enter a qualifier name to use",
+ 18, "gene");
+
+ final String qualifier_name_text = qualifier_name_dialog.getText ();
+
+ if (qualifier_name_text == null) {
+ return;
+ }
+
+ final String qualifier_name_string = qualifier_name_text.trim ();
+
+ if (qualifier_name_string.length () == 0) {
+ new MessageDialog (getParentFrame (), "no qualifier name given");
+ return;
+ }
+
+ final YesNoDialog complement_tag_dialog =
+ new YesNoDialog (getParentFrame (),
+ "append \"c\" to names of reverse strand features?");
+
+ autoGeneNameHelper (features_to_name,
+ prefix_string, start_value, increment_value,
+ qualifier_name_string,
+ complement_tag_dialog.getResult ());
+ }
+
+ /**
+ * Helper function for fixGeneNames(). Add the gene name from the CDS to
+ * neighbouring/overlapping mRNA, intron, exon, gene, 5'UTR and 3'UTR
+ * features. Warn about inconsistencies.
+ * @return true if all went well, false if fixing should stop immediately
+ **/
+ private static boolean fixGeneNamesHelper (final JFrame frame,
+ final EntryGroup entry_group,
+ final Feature cds_to_fix) {
+ if (cds_to_fix.isReadOnly ()) {
+ final String message =
+ "one or more of the of the selected features are read only " +
+ "- cannot continue";
+ new MessageDialog (frame, message);
+ return false;
+ }
+
+ try {
+ final Strand cds_to_fix_strand = cds_to_fix.getStrand ();
+
+ Marker cds_start_marker = cds_to_fix.getFirstBaseMarker ();
+ Marker cds_end_marker = cds_to_fix.getLastBaseMarker ();
+
+ // move the start one base back and the end one base forward so that
+ // when we call getFeaturesInRange() we get the UTRs
+
+ try {
+ cds_start_marker = cds_start_marker.moveBy (-1);
+ } catch (OutOfRangeException _) {
+ // ignore and use the original cds_start_marker
+ }
+
+ try {
+ cds_end_marker = cds_end_marker.moveBy (1);
+ } catch (OutOfRangeException _) {
+ // ignore and use the original cds_end_marker
+ }
+
+ final Range search_range;
+
+ if (cds_start_marker.getRawPosition () <
+ cds_end_marker.getRawPosition ()) {
+ search_range =
+ new Range (cds_start_marker.getRawPosition (),
+ cds_end_marker.getRawPosition ());
+ } else {
+ search_range =
+ new Range (cds_end_marker.getRawPosition (),
+ cds_start_marker.getRawPosition ());
+ }
+
+ final FeatureVector features_in_range =
+ entry_group.getFeaturesInRange (search_range);
+
+ final FeatureVector features_to_change =
+ new FeatureVector ();
+
+ for (int i = 0 ; i < features_in_range.size () ; ++i) {
+ final Feature this_feature = features_in_range.elementAt (i);
+
+ if (this_feature.getStrand () == cds_to_fix_strand &&
+ (this_feature.isCDS () ||
+ this_feature.getKey ().equals ("mRNA") ||
+ this_feature.getKey ().equals ("intron") ||
+ this_feature.getKey ().equals ("exon") ||
+ this_feature.getKey ().equals ("5'UTR") &&
+ (cds_to_fix.getFirstBase () ==
+ this_feature.getLastBase () + 1) ||
+ this_feature.getKey ().equals ("3'UTR") &&
+ (cds_to_fix.getLastBase () + 1 ==
+ this_feature.getFirstBase ()) ||
+ this_feature.getKey ().equals ("gene"))) {
+
+ if (this_feature.isReadOnly ()) {
+ final String message =
+ "one or more of the of the overlapping features are read only " +
+ "- cannot continue";
+ new MessageDialog (frame, message);
+ return false;
+ }
+ features_to_change.add (this_feature);
+ }
+ }
+
+ final FeatureVector overlapping_cds_features = new FeatureVector ();
+
+ for (int i = 0 ; i < features_to_change.size () ; ++i) {
+ final Feature this_test_feature = features_to_change.elementAt (i);
+
+ if (this_test_feature != cds_to_fix &&
+ this_test_feature.isCDS ()) {
+ overlapping_cds_features.add (this_test_feature);
+ features_to_change.remove (this_test_feature);
+ }
+ }
+
+ if (overlapping_cds_features.size () > 0) {
+ final String message =
+ "your CDS (" + cds_to_fix.getIDString () +
+ ") overlaps " + overlapping_cds_features.size () +
+ " other CDS feature" +
+ (overlapping_cds_features.size () == 1 ?
+ "" : "s") + " - continue?";
+
+ final YesNoDialog dialog =
+ new YesNoDialog (frame, message);
+
+ if (!dialog.getResult ()) {
+ return false;
+ }
+ }
+
+ final StringVector gene_names = new StringVector ();
+
+ for (int feature_index = 0 ;
+ feature_index < features_to_change.size () ;
+ ++feature_index) {
+ final Feature test_feature =
+ features_to_change.elementAt (feature_index);
+
+ final StringVector test_feature_gene_names =
+ test_feature.getValuesOfQualifier ("gene");
+
+ if (test_feature_gene_names != null) {
+ for (int test_feature_gene_name_index = 0 ;
+ test_feature_gene_name_index < test_feature_gene_names.size ();
+ ++test_feature_gene_name_index) {
+ final String this_gene_name =
+ test_feature_gene_names.elementAt (test_feature_gene_name_index);
+
+ if (!gene_names.contains (this_gene_name)) {
+ gene_names.add (this_gene_name);
+ }
+ }
+ }
+ }
+
+ if (gene_names.size () == 0) {
+ // ignore this feature, but continue with the other features
+ return true;
+ }
+
+ for (int feature_index = 0 ;
+ feature_index < features_to_change.size () ;
+ ++feature_index) {
+ final Feature this_feature =
+ features_to_change.elementAt (feature_index);
+ final Qualifier qualifier = new Qualifier ("gene", gene_names);
+
+ this_feature.setQualifier (qualifier);
+ }
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (InvalidRelationException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (EntryInformationException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ } catch (ReadOnlyException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+
+ return true;
+ }
+
+ /**
+ * For each selected CDS, add the gene name from the CDS to
+ * neighbouring/overlapping mRNA, intron, exon, gene, 5'UTR and 3'UTR
+ * features. Warn about inconsistencies.
+ * @param frame The Frame to use for MessageDialog components.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ **/
+ public static void fixGeneNames (final JFrame frame,
+ final EntryGroup entry_group,
+ final Selection selection) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ final FeatureVector features_to_fix = selection.getAllFeatures ();
+
+ int cds_features_found = 0;
+
+ for (int i = 0 ; i < features_to_fix.size () ; ++i) {
+ final Feature selection_feature = features_to_fix.elementAt (i);
+
+ if (selection_feature.isCDS ()) {
+ ++cds_features_found;
+ if (!fixGeneNamesHelper (frame, entry_group, selection_feature)) {
+ return;
+ }
+ }
+ }
+
+ if (cds_features_found == 0) {
+ new MessageDialog (frame, "no CDS features selected");
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Return the EntryGroup that was passed to the constructor.
+ **/
+ private EntryGroup getEntryGroup () {
+ return entry_group;
+ }
+
+ /**
+ * This method sends an GotoEvent to all the GotoEvent listeners that will
+ * make the first base of the selection visible.
+ **/
+ private void makeSelectionStartVisible () {
+ final GotoEvent new_event =
+ new GotoEvent (this, getSelection ().getStartBaseOfSelection ());
+
+ goto_event_source.sendGotoEvent (new_event);
+ }
+
+ /**
+ * Return the GotoEventSource object that was passed to the constructor.
+ **/
+ private GotoEventSource getGotoEventSource () {
+ return goto_event_source;
+ }
+
+ /**
+ * Returns a Vector containing those features in the given vector of
+ * features which are read only or are in a read only entry.
+ **/
+ private static FeatureVector
+ getReadOnlyFeatures (final FeatureVector features) {
+ final FeatureVector return_vector = new FeatureVector ();
+
+ for (int i = 0 ; i < features.size () ; ++i) {
+ final Feature this_feature = features.elementAt (i);
+ if (this_feature.isReadOnly ()) {
+ return_vector.add (this_feature);
+ }
+ }
+
+ return return_vector;
+ }
+
+ /**
+ * The GotoEventSource object that was passed to the constructor.
+ **/
+ private GotoEventSource goto_event_source = null;
+
+ /**
+ * The EntryGroup object that was passed to the constructor.
+ **/
+ private EntryGroup entry_group = null;
+
+ /**
+ * The BasePlotGroup object that was passed to the constructor.
+ **/
+ private BasePlotGroup base_plot_group = null;
+
+ private JMenuItem undo_item = null;
+ private JMenuItem edit_feature_item = null;
+ private JMenuItem raw_edit_feature_item = null;
+ private JMenuItem duplicate_item = null;
+ private JMenuItem merge_features_item = null;
+ private JMenuItem unmerge_feature_item = null;
+ private JMenuItem delete_features_item = null;
+ private JMenuItem edit_header_item = null;
+ private JMenuItem add_qualifiers_item = null;
+ private JMenuItem remove_qualifier_item = null;
+ private JMenuItem delete_segments_item = null;
+ private JMenuItem delete_introns_item = null;
+ private JMenuItem edit_subsequence_item = null;
+ private JMenuItem paste_item = null;
+ private JMenu move_features_menu = null;
+ private JMenu copy_features_menu = null;
+ private JMenuItem trim_item = null;
+ private JMenuItem trim_to_any_item = null;
+ private JMenuItem trim_to_next_item = null;
+ private JMenuItem trim_to_next_any_item = null;
+ private JMenuItem extend_to_next_stop_item = null;
+ private JMenuItem extend_to_prev_stop_item = null;
+ private JMenuItem auto_label_item = null;
+ private JMenuItem auto_gene_name_item = null;
+ private JMenuItem fix_gene_names_item = null;
+ private JMenuItem fix_stop_codons_item = null;
+ private JMenuItem reverse_complement_item = null;
+ private JMenuItem delete_bases_item = null;
+ private JMenuItem add_bases_item = null;
+ private JMenuItem add_bases_from_file_item = null;
+}
diff --git a/uk/ac/sanger/artemis/components/EntryActionListener.java b/uk/ac/sanger/artemis/components/EntryActionListener.java
new file mode 100644
index 000000000..057a82d11
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/EntryActionListener.java
@@ -0,0 +1,63 @@
+/* EntryActionListener.java
+ *
+ * created: Mon Jan 31 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/EntryActionListener.java,v 1.1 2004-06-09 09:46:21 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import java.awt.event.*;
+
+/**
+ * This class is an implementation of the ActionListener interface that can
+ * remember an entry.
+ *
+ * @author Kim Rutherford
+ * @version $Id: EntryActionListener.java,v 1.1 2004-06-09 09:46:21 tjc Exp $
+ **/
+
+abstract public class EntryActionListener implements ActionListener {
+ /**
+ * Make a new EntryActionListener from the given Entry.
+ **/
+ EntryActionListener (final EntryEdit entry_edit,
+ final Entry entry) {
+ this.entry = entry;
+ this.entry_edit = entry_edit;
+ }
+
+ abstract public void actionPerformed (final ActionEvent event);
+
+ public Entry getEntry () {
+ return entry;
+ }
+
+ public EntryEdit getEntryEdit () {
+ return entry_edit;
+ }
+
+ final private Entry entry;
+ final private EntryEdit entry_edit;
+}
+
diff --git a/uk/ac/sanger/artemis/components/EntryEdit.java b/uk/ac/sanger/artemis/components/EntryEdit.java
new file mode 100644
index 000000000..2bec3a1eb
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/EntryEdit.java
@@ -0,0 +1,1434 @@
+/* EntryEdit.java
+ *
+ * created: Fri Oct 9 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 1998,1999,2000,2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/EntryEdit.java,v 1.1 2004-06-09 09:46:24 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.Marker;
+import uk.ac.sanger.artemis.sequence.Bases;
+
+import uk.ac.sanger.artemis.util.FileDocument;
+import uk.ac.sanger.artemis.util.OutOfRangeException;
+import uk.ac.sanger.artemis.util.ReadOnlyException;
+import uk.ac.sanger.artemis.io.DocumentEntryFactory;
+import uk.ac.sanger.artemis.io.EntryInformationException;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.SimpleEntryInformation;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.io.*;
+import java.awt.dnd.*;
+import java.awt.datatransfer.Transferable;
+import java.awt.datatransfer.UnsupportedFlavorException;
+import javax.swing.*;
+import javax.swing.border.Border;
+import javax.swing.border.BevelBorder;
+
+/**
+ * Each object of this class is used to edit an EntryGroup object.
+ *
+ * @author Kim Rutherford
+ * @version $Id: EntryEdit.java,v 1.1 2004-06-09 09:46:24 tjc Exp $
+ *
+ */
+
+public class EntryEdit extends JFrame
+ implements EntryGroupChangeListener, EntryChangeListener,
+ DropTargetListener
+{
+
+ /** The shortcut for Delete Selected Features. */
+ final static KeyStroke SAVE_DEFAULT_KEY =
+ KeyStroke.getKeyStroke(KeyEvent.VK_S, InputEvent.CTRL_MASK);
+
+ /**
+ * A vector containing the Entry objects that this
+ * EntryEdit object knows about.
+ **/
+ private EntryGroup entry_group;
+
+ /**
+ * Created by the constructor to pass to those objects
+ * that are interested in GotoEvents.
+ **/
+ private GotoEventSource goto_event_source;
+
+ private final JMenuBar menu_bar = new JMenuBar();
+ private final JMenu file_menu = new JMenu("File");
+
+ private EntryGroupDisplay group_display;
+ private FeatureDisplay one_line_per_entry_display;
+ private FeatureDisplay feature_display;
+ private FeatureDisplay base_display;
+ private BasePlotGroup base_plot_group;
+ private FeatureList feature_list;
+
+ /** This Object contains the current selection. */
+ private Selection selection = null;
+
+ /**
+ * The EntrySourceVector reference that is created in the constructor.
+ **/
+ private EntrySourceVector entry_sources;
+
+
+ /**
+ * Create a new EntryEdit object and JFrame.
+ * @param entry_group The EntryGroup object that this component is editing.
+ */
+ public EntryEdit(final EntryGroup entry_group)
+ {
+ super("Artemis Entry Edit");
+
+ setDropTarget(new DropTarget(this,this));
+ entry_group.ref();
+ this.entry_group = entry_group;
+
+ // XXX add a InputStreamProgressListener
+ this.entry_sources = Utilities.getEntrySources(this, null);
+ this.goto_event_source = new SimpleGotoEventSource(getEntryGroup());
+
+ selection = new Selection(null);
+
+ getEntryGroup().addFeatureChangeListener(selection);
+ getEntryGroup().addEntryChangeListener(selection);
+ getEntryGroup().addEntryGroupChangeListener(this);
+ getEntryGroup().addEntryChangeListener(this);
+
+ if(getEntryGroup().getDefaultEntry() != null)
+ {
+ final String name = getEntryGroup().getDefaultEntry().getName();
+ if(name != null)
+ setTitle("Artemis Entry Edit: " + name);
+ }
+
+ final int font_height;
+ final int font_base_line;
+
+ final Font default_font = getDefaultFont();
+
+ if(default_font != null)
+ {
+ FontMetrics fm = getFontMetrics(default_font);
+ font_height = fm.getHeight();
+ font_base_line = fm.getMaxAscent();
+ }
+ else
+ {
+ font_height = -1;
+ font_base_line = -1;
+ }
+
+ addWindowListener(new WindowAdapter()
+ {
+ public void windowClosing(WindowEvent event)
+ {
+ closeEntryEdit();
+ }
+ });
+
+ Box box_panel = Box.createVerticalBox();
+
+ getContentPane().setLayout(new BorderLayout());
+ getContentPane().add(box_panel, "North");
+
+ menu_bar.setFont(default_font);
+
+ SelectionInfoDisplay selection_info =
+ new SelectionInfoDisplay(getEntryGroup(), getSelection());
+ box_panel.add(selection_info);
+
+ group_display = new EntryGroupDisplay(this);
+ box_panel.add(group_display);
+
+ final boolean entry_buttons_option =
+ Options.getOptions().getPropertyTruthValue("show_entry_buttons");
+
+ group_display.setVisible(entry_buttons_option);
+
+ base_plot_group =
+ new BasePlotGroup(getEntryGroup(), this, getSelection(),
+ getGotoEventSource());
+ box_panel.add(base_plot_group);
+
+ base_plot_group.setVisible(true);
+
+ one_line_per_entry_display =
+ new FeatureDisplay(getEntryGroup(), getSelection(),
+ getGotoEventSource(), base_plot_group);
+
+ one_line_per_entry_display.setShowLabels(false);
+ one_line_per_entry_display.setOneLinePerEntry(true);
+
+ box_panel.add(one_line_per_entry_display);
+ one_line_per_entry_display.setVisible(false);
+
+ feature_display =
+ new FeatureDisplay(getEntryGroup(), getSelection(),
+ getGotoEventSource(), base_plot_group);
+
+ final Options options = Options.getOptions();
+
+ if(options.getProperty("overview_feature_labels") != null)
+ {
+ final boolean option_value =
+ options.getPropertyTruthValue("overview_feature_labels");
+ feature_display.setShowLabels(option_value);
+ }
+
+ if(options.getProperty("overview_one_line_per_entry") != null)
+ {
+ final boolean option_value =
+ options.getPropertyTruthValue("overview_one_line_per_entry");
+ feature_display.setOneLinePerEntry(option_value);
+ }
+
+ feature_display.addDisplayAdjustmentListener(base_plot_group);
+ feature_display.addDisplayAdjustmentListener(one_line_per_entry_display);
+
+ one_line_per_entry_display.addDisplayAdjustmentListener(feature_display);
+
+ box_panel.add(feature_display);
+
+ feature_display.setVisible(true);
+
+ base_display =
+ new FeatureDisplay(getEntryGroup(), getSelection(),
+ getGotoEventSource(), base_plot_group);
+ base_display.setShowLabels(false);
+ base_display.setScaleFactor(0);
+ box_panel.add(base_display);
+
+ final boolean show_base_view;
+
+ if(Options.getOptions().getProperty("show_base_view") != null)
+ show_base_view =
+ Options.getOptions().getPropertyTruthValue("show_base_view");
+ else
+ show_base_view = true;
+
+ base_display.setVisible(show_base_view);
+
+ feature_list =
+ new FeatureList(getEntryGroup(), getSelection(),
+ getGotoEventSource(), base_plot_group);
+ feature_list.setFont(default_font);
+
+ final boolean list_option_value =
+ Options.getOptions().getPropertyTruthValue("show_list");
+
+ if(list_option_value)
+ feature_list.setVisible(true);
+ else
+ feature_list.setVisible(false);
+
+ getContentPane().add(feature_list, "Center");
+ makeMenus();
+ pack();
+
+ ClassLoader cl = this.getClass().getClassLoader();
+ ImageIcon icon = new ImageIcon(cl.getResource("images/icon.gif"));
+
+ if(icon != null)
+ {
+ Toolkit toolkit = Toolkit.getDefaultToolkit();
+ final Image icon_image = icon.getImage();
+ MediaTracker tracker = new MediaTracker(this);
+ tracker.addImage(icon_image, 0);
+
+ try
+ {
+ tracker.waitForAll();
+ setIconImage(icon_image);
+ }
+ catch(InterruptedException e)
+ {
+ // ignore and continue
+ }
+ }
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ int screen_height = screen.height;
+ int screen_width = screen.width;
+
+ if(screen_width <= 900 || screen_height <= 700)
+ setSize(screen_width * 9 / 10, screen_height * 9 / 10);
+ else
+ setSize(900, 700);
+
+ Utilities.centreFrame(this);
+ }
+
+ /**
+ * If there are no unsaved changes, close this EntryEdit. Otherwise ask
+ * the user first.
+ **/
+ private void closeEntryEdit()
+ {
+ if(getEntryGroup().hasUnsavedChanges() &&
+ getEntryGroup().refCount() == 1)
+ {
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog(EntryEdit.this,
+ "there are unsaved changes - really close?");
+
+ if(!yes_no_dialog.getResult())
+ return;
+ }
+
+ entryEditFinished();
+ }
+
+ /**
+ * Redraw this component. This method is public so that other classes can
+ * force an update if, for example, the options files is re-read.
+ **/
+ public void redisplay()
+ {
+ feature_display.redisplay();
+ base_display.redisplay();
+ }
+
+ /**
+ * This method sends an GotoEvent to all the GotoEvent listeners that will
+ * make the start of the first selected Feature or FeatureSegment visible.
+ **/
+ public void makeSelectionVisible()
+ {
+ final Marker first_base = getSelection().getStartBaseOfSelection();
+ final GotoEvent new_event = new GotoEvent(this, first_base);
+ getGotoEventSource().sendGotoEvent(new_event);
+ }
+
+ /**
+ * Return an object that implements the GotoEventSource interface, and is
+ * the controlling object for Goto events associated with this object.
+ **/
+ public GotoEventSource getGotoEventSource()
+ {
+ return goto_event_source;
+ }
+
+ /**
+ * Return the EntryGroup object that was passed to the constructor.
+ **/
+ public EntryGroup getEntryGroup()
+ {
+ return entry_group;
+ }
+
+ /**
+ * Returns a Selection object containing the selected features/exons.
+ **/
+ public Selection getSelection()
+ {
+ return selection;
+ }
+
+ /**
+ * Implementation of the EntryGroupChangeListener interface. We listen to
+ * EntryGroupChange events so that we can update the File menu when the
+ * EntryGroup changes.
+ **/
+ public void entryGroupChanged(final EntryGroupChangeEvent event)
+ {
+ switch(event.getType())
+ {
+ case EntryGroupChangeEvent.ENTRY_ADDED:
+ case EntryGroupChangeEvent.ENTRY_DELETED:
+ makeFileMenu();
+ break;
+ }
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface. We listen to
+ * EntryChange events so that we can update the File menu when an Entry
+ * changes.
+ **/
+ public void entryChanged(final EntryChangeEvent event)
+ {
+ if(event.getType() == EntryChangeEvent.NAME_CHANGED)
+ makeFileMenu();
+ }
+
+ /* private members: */
+
+ /**
+ * This method arranges for the EntryEdit JFrame to go away. This EntryEdit
+ * object was created by the main program, so the main program must be the
+ * one to delete us.
+ **/
+ private void entryEditFinished()
+ {
+ setVisible(false);
+ getEntryGroup().removeFeatureChangeListener(selection);
+ getEntryGroup().removeEntryChangeListener(selection);
+
+ getEntryGroup().removeEntryGroupChangeListener(this);
+ getEntryGroup().removeEntryChangeListener(this);
+
+ getEntryGroup().unref();
+ dispose();
+ }
+
+ /**
+ * Write the default Entry in the EntryGroup to the file it came from.
+ **/
+ private void saveDefaultEntry()
+ {
+ if(getEntryGroup().getDefaultEntry() == null)
+ new MessageDialog(EntryEdit.this, "There is no default entry");
+ else
+ saveEntry(entry_group.getDefaultEntry(), true, false, true,
+ DocumentEntryFactory.ANY_FORMAT);
+ }
+
+ /**
+ * Save the given entry, prompting for a file name if necessary.
+ * @param include_diana_extensions If true then any diana additions to
+ * the embl file format will be included in the output, otherwise they
+ * will be removed. Also possible problems that would cause an entry to
+ * bounce from the EMBL submission process will be flagged if this is
+ * true.
+ * @param ask_for_name If true then always prompt for a new filename,
+ * otherwise prompt only when the entry name is not set.
+ * @param keep_new_name If ask_for_name is true a file will be written with
+ * the new name the user selects - if keep_new_name is true as well, then
+ * the entry will have it's name set to the new name, otherwise it will
+ * be used for this save and then discarded.
+ * @param destination_type Should be one of EMBL_FORMAT, GENBANK_FORMAT or
+ * ANY_FORMAT. If ANY_FORMAT then the Entry will be saved in the
+ * same format it was created, otherwise it will be saved in the given
+ * format.
+ **/
+ void saveEntry(final Entry entry,
+ final boolean include_diana_extensions,
+ final boolean ask_for_name, final boolean keep_new_name,
+ final int destination_type)
+ {
+
+ if(!include_diana_extensions)
+ {
+ if(displaySaveWarnings(entry))
+ return;
+ }
+
+ if(destination_type != DocumentEntryFactory.ANY_FORMAT &&
+ entry.getHeaderText() != null)
+ {
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog(this, "header section will be lost. continue?");
+
+ if(!yes_no_dialog.getResult())
+ return;
+ }
+
+ if(!System.getProperty("os.arch").equals("alpha"))
+ {
+ final EntryFileDialog file_dialog = new EntryFileDialog(this,
+ false);
+
+ file_dialog.saveEntry(entry, include_diana_extensions, ask_for_name,
+ keep_new_name, destination_type);
+ }
+ else
+ alphaBug(entry, include_diana_extensions, ask_for_name,
+ keep_new_name, destination_type);
+ }
+
+
+ /**
+ *
+ * This routine is needed to circumvent the problem
+ * of opening a JFileChooser on alpha o/s only.
+ *
+ */
+ private void alphaBug(Entry entry,
+ boolean include_diana_extensions,
+ boolean ask_for_name,
+ boolean keep_new_name,
+ int destination_type)
+ {
+ try
+ {
+ if(ask_for_name || entry.getName() == null)
+ {
+ JCheckBox emblHeader = new JCheckBox("Add EMBL Header",
+ false);
+ Box bdown = Box.createVerticalBox();
+ JTextField fileField = new JTextField(
+ System.getProperty("user.dir")+
+ System.getProperty("file.separator"));
+ fileField.selectAll();
+ bdown.add(fileField);
+
+ if(destination_type == DocumentEntryFactory.EMBL_FORMAT)
+ bdown.add(emblHeader);
+
+ int n = JOptionPane.showConfirmDialog(null, bdown,
+ "Enter filename",
+ JOptionPane.OK_CANCEL_OPTION,
+ JOptionPane.QUESTION_MESSAGE);
+ if(n == JOptionPane.CANCEL_OPTION)
+ return;
+
+ if(emblHeader.isSelected())
+ {
+ if( entry.getHeaderText() == null ||
+ isHeaderEMBL(entry.getHeaderText()) )
+ System.out.println("NO HEADER PLEASE SET");
+ }
+
+ File file = new File(fileField.getText());
+
+ if(file.exists())
+ {
+ final YesNoDialog yes_no_dialog = new YesNoDialog(this,
+ "this file exists: " + file.getName() +
+ " overwrite it?");
+ if(!yes_no_dialog.getResult())
+ return;
+ }
+
+ final MessageDialog message = new MessageDialog(this,
+ "saving to " + file.getName() + " ...",
+ false);
+ try
+ {
+ if(include_diana_extensions)
+ entry.save(file, destination_type, false);
+ else
+ entry.saveStandardOnly(file, destination_type, true);
+ }
+ catch(EntryInformationException e)
+ {
+ final YesNoDialog yes_no_dialog = new YesNoDialog(this,
+ "destination format can't handle all " +
+ "keys/qualifiers - continue?");
+ if(yes_no_dialog.getResult())
+ {
+ try
+ {
+ if(include_diana_extensions)
+ entry.save(file, destination_type, true);
+ else
+ entry.saveStandardOnly(file, destination_type, true);
+ }
+ catch(EntryInformationException e2)
+ {
+ throw new Error("internal error - unexpected exception: "+ e);
+ }
+ catch(IOException ioe)
+ {
+ new MessageDialog(this, "error while saving: " + ioe);
+ return;
+ }
+ }
+ else
+ return;
+ }
+ finally
+ {
+ if(message != null)
+ message.dispose();
+ }
+
+ if(keep_new_name)
+ entry.setName(file.getName());
+ }
+ else
+ {
+ final MessageDialog message = new MessageDialog(this,
+ "saving to " + entry.getName() + " ...",
+ false);
+ try
+ {
+ if(include_diana_extensions)
+ entry.save(destination_type);
+ else
+ entry.saveStandardOnly(destination_type);
+ }
+ finally
+ {
+ message.dispose();
+ }
+ }
+ }
+ catch(ReadOnlyException e)
+ {
+ new MessageDialog(this, "this entry is read only");
+ return;
+ }
+ catch(IOException e)
+ {
+ new MessageDialog(this, "error while saving: " + e);
+ return;
+ }
+ catch(EntryInformationException e)
+ {
+ new MessageDialog(this, "error while saving: " + e);
+ return;
+ }
+ }
+
+
+ private boolean isHeaderEMBL(String header)
+ {
+ StringReader reader = new StringReader(header);
+ BufferedReader buff_reader = new BufferedReader(reader);
+
+ try
+ {
+ if(!buff_reader.readLine().startsWith("ID"))
+ return false;
+ }
+ catch(IOException ioe){}
+ return true;
+ }
+
+ /**
+ * Save the changes to all the Entry objects in the entry_group back to
+ * where the they came from.
+ **/
+ public void saveAllEntries()
+ {
+ for(int entry_index = 0 ;
+ entry_index < entry_group.size() ;
+ ++entry_index)
+ saveEntry(entry_group.elementAt(entry_index), true, false, true,
+ DocumentEntryFactory.ANY_FORMAT);
+ }
+
+ /**
+ * Check the given Entry for invalid EMBL features(such as CDS features
+ * without a stop codon) then display a FeatureListFrame list the problem
+ * features.
+ * @return true if and only if the save should be aborted.
+ **/
+ private boolean displaySaveWarnings(final Entry entry)
+ {
+ final FeatureVector invalid_starts = entry.checkFeatureStartCodons();
+ final FeatureVector invalid_stops = entry.checkFeatureStopCodons();
+ final FeatureVector invalid_keys = entry.checkForNonEMBLKeys();
+ final FeatureVector duplicate_features = entry.checkForEMBLDuplicates();
+ final FeatureVector overlapping_cds_features =
+ entry.checkForOverlappingCDSs();
+ final FeatureVector missing_qualifier_features =
+ entry.checkForMissingQualifiers();
+
+ // this predicate will filter out those features that aren't in the
+ // entry we are trying to save
+ final FeaturePredicate predicate =
+ new FeaturePredicate()
+ {
+ public boolean testPredicate(final Feature feature)
+ {
+ if(feature.getEntry() == entry)
+ return true;
+ else
+ return false;
+ }
+ };
+
+ String entry_name = entry.getName();
+
+ if(entry_name == null)
+ entry_name = "no name";
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup(getEntryGroup(), predicate,
+ "features from " + entry_name);
+
+ if(invalid_starts.size() + invalid_stops.size() +
+ invalid_keys.size() + duplicate_features.size() +
+ overlapping_cds_features.size() > 0)
+ {
+
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog(this,
+ "warning: some features may have problems. " +
+ "continue with save?");
+
+ if(!yes_no_dialog.getResult())
+ {
+ getSelection().clear();
+
+ if(invalid_starts.size() > 0)
+ {
+ getSelection().add(invalid_starts);
+
+ ViewMenu.showBadStartCodons(this,
+ getSelection(),
+ filtered_entry_group,
+ getGotoEventSource(),
+ base_plot_group);
+ }
+
+ if(invalid_stops.size() > 0)
+ {
+ getSelection().add(invalid_stops);
+
+ ViewMenu.showBadStopCodons(this, getSelection(),
+ filtered_entry_group,
+ getGotoEventSource(),
+ base_plot_group);
+ }
+
+ if(invalid_keys.size() > 0)
+ {
+ getSelection().add(invalid_keys);
+
+ ViewMenu.showNonEMBLKeys(this, getSelection(),
+ filtered_entry_group,
+ getGotoEventSource(),
+ base_plot_group);
+ }
+
+ if(duplicate_features.size() > 0)
+ {
+ getSelection().add(duplicate_features);
+
+ ViewMenu.showDuplicatedFeatures(this, getSelection(),
+ filtered_entry_group,
+ getGotoEventSource(),
+ base_plot_group);
+ }
+
+ if(overlapping_cds_features.size() > 0)
+ {
+ getSelection().add(overlapping_cds_features);
+
+ ViewMenu.showOverlappingCDSs(this, getSelection(),
+ filtered_entry_group,
+ getGotoEventSource(),
+ base_plot_group);
+ }
+
+ if(missing_qualifier_features.size() > 0)
+ {
+ getSelection().add(missing_qualifier_features);
+
+ ViewMenu.showMissingQualifierFeatures(this, getSelection(),
+ filtered_entry_group,
+ getGotoEventSource(),
+ base_plot_group);
+ }
+
+ return true;
+ }
+ }
+
+ return false;
+ }
+
+ /**
+ * Make and add the menus for this component.
+ **/
+ private void makeMenus()
+ {
+ final Font default_font = getDefaultFont();
+
+ setJMenuBar(menu_bar);
+ makeFileMenu();
+ menu_bar.add(file_menu);
+
+ // don't add the menu if this is an applet and we have just one entry
+ if(Options.readWritePossible() || getEntryGroup().size() > 1)
+ {
+ JMenu entry_group_menu = new EntryGroupMenu(this, getEntryGroup());
+ menu_bar.add(entry_group_menu);
+ }
+
+ JMenu select_menu = new SelectMenu(this, getSelection(),
+ getGotoEventSource(), getEntryGroup(),
+ base_plot_group);
+ menu_bar.add(select_menu);
+
+ ViewMenu view_menu = new ViewMenu(this, getSelection(),
+ getGotoEventSource(), getEntryGroup(),
+ base_plot_group);
+ menu_bar.add(view_menu);
+
+ JMenu goto_menu = new GotoMenu(this, getSelection(),
+ getGotoEventSource(), getEntryGroup());
+ menu_bar.add(goto_menu);
+
+ if(Options.readWritePossible())
+ {
+ JMenu edit_menu = new EditMenu(this, getSelection(),
+ getGotoEventSource(), getEntryGroup(),
+ base_plot_group);
+ menu_bar.add(edit_menu);
+
+ AddMenu add_menu = new AddMenu(this, getSelection(), getEntryGroup(),
+ getGotoEventSource(), base_plot_group);
+ menu_bar.add(add_menu);
+
+ JMenu write_menu = new WriteMenu(this, getSelection(), getEntryGroup());
+ menu_bar.add(write_menu);
+
+ if(Options.isUnixHost())
+ {
+ JMenu run_menu = new RunMenu(this, getSelection());
+ menu_bar.add(run_menu);
+ }
+ }
+
+ JMenu graph_menu = new GraphMenu(this, getEntryGroup(),
+ base_plot_group,
+ feature_display);
+ menu_bar.add(graph_menu);
+
+ final JMenu display_menu = new JMenu("Display");
+ final JCheckBoxMenuItem show_entry_buttons_item =
+ new JCheckBoxMenuItem("Show Entry Buttons");
+ show_entry_buttons_item.setState(true);
+ show_entry_buttons_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent event)
+ {
+ group_display.setVisible(show_entry_buttons_item.getState());
+ // XXX change to revalidate().
+ validate();
+ }
+ });
+ display_menu.add(show_entry_buttons_item);
+
+ final JCheckBoxMenuItem show_one_line =
+ new JCheckBoxMenuItem("Show One Line Per Entry View", false);
+ show_one_line.setState(one_line_per_entry_display.isVisible());
+ show_one_line.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent event)
+ {
+ one_line_per_entry_display.setVisible(show_one_line.getState());
+ validate();
+ }
+ });
+ display_menu.add(show_one_line);
+
+ final JCheckBoxMenuItem show_base_display_item =
+ new JCheckBoxMenuItem("Show Base View");
+
+ show_base_display_item.setState(base_display.isVisible());
+ show_base_display_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent event)
+ {
+ base_display.setVisible(show_base_display_item.getState());
+ // XXX change to revalidate().
+ validate();
+ }
+ });
+ display_menu.add(show_base_display_item);
+
+ final JCheckBoxMenuItem show_feature_list_item =
+ new JCheckBoxMenuItem("Show Feature List");
+ show_feature_list_item.setState(feature_list.isVisible());
+ show_feature_list_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent event)
+ {
+ feature_list.setVisible(show_feature_list_item.getState());
+ // XXX change to revalidate().
+ validate();
+ }
+ });
+ display_menu.add(show_feature_list_item);
+
+ menu_bar.add(display_menu);
+ }
+
+
+ /**
+ * Make a new File menureplacing the current one (if any).
+ **/
+ private void makeFileMenu()
+ {
+ file_menu.removeAll();
+
+ if(Options.readWritePossible())
+ {
+
+ JMenuItem popFileManager = new JMenuItem("Show File Manager ...");
+ popFileManager.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ if(ArtemisMain.filemanager == null)
+ ArtemisMain.filemanager = new FileManager(EntryEdit.this);
+ else
+ ArtemisMain.filemanager.setVisible(true);
+ }
+ });
+ file_menu.add(popFileManager);
+
+ // only the standalone version can save or read
+ EntrySource filesystem_entry_source = null;
+
+ for(int source_index = 0; source_index < entry_sources.size();
+ ++source_index)
+ {
+ final EntrySource this_source =
+ entry_sources.elementAt(source_index);
+
+ if(this_source.isFullEntrySource())
+ continue;
+
+ if(this_source.getSourceName().equals("Filesystem"))
+ filesystem_entry_source = this_source;
+
+ String entry_source_name = this_source.getSourceName();
+ String menu_item_name = null;
+
+ if(entry_source_name.equals("Filesystem"))
+ menu_item_name = "Read An Entry ...";
+ else
+ menu_item_name = "Read An Entry From " + entry_source_name + " ...";
+
+ final JMenuItem read_entry = new JMenuItem(menu_item_name);
+
+ read_entry.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ readAnEntry(this_source);
+ }
+ });
+
+ file_menu.add(read_entry);
+ }
+
+ JMenu read_features_menu = null;
+
+ if(filesystem_entry_source != null &&
+ entry_group != null && entry_group.size() > 0)
+ {
+ read_features_menu = new JMenu("Read Entry Into");
+ file_menu.add(read_features_menu);
+ }
+
+ file_menu.addSeparator();
+
+ final JMenuItem save_default =
+ new JMenuItem("Save Default Entry");
+ save_default.setAccelerator(SAVE_DEFAULT_KEY);
+ save_default.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ saveDefaultEntry();
+ }
+ });
+
+ file_menu.add(save_default);
+
+ if(entry_group == null || entry_group.size() == 0)
+ {
+ // do nothing
+ }
+ else
+ {
+ final JMenu save_entry_menu = new JMenu("Save An Entry");
+ final JMenu save_as_menu = new JMenu("Save An Entry As");
+ final JMenu save_as = new JMenu("New File");
+ final JMenu save_as_embl = new JMenu("EMBL Format");
+ final JMenu save_as_genbank = new JMenu("GENBANK Format");
+ final JMenu save_as_gff = new JMenu("GFF Format");
+ final JMenu save_embl_only = new JMenu("EMBL Submission Format");
+
+ for(int i = 0; i < getEntryGroup().size(); ++i)
+ {
+ final Entry this_entry = getEntryGroup().elementAt(i);
+ String entry_name = this_entry.getName();
+
+ if(entry_name == null)
+ entry_name = "no name";
+
+ final ActionListener save_entry_listener =
+ new SaveEntryActionListener(this, this_entry);
+
+ final JMenuItem save_entry_item = new JMenuItem(entry_name);
+
+ save_entry_item.addActionListener(save_entry_listener);
+
+ final ActionListener save_as_listener =
+ new SaveEntryAsActionListener(this, this_entry);
+
+ final JMenuItem save_as_item = new JMenuItem(entry_name);
+
+ save_as_item.addActionListener(save_as_listener);
+
+ final ActionListener save_as_embl_listener =
+ new SaveEntryAsEMBLActionListener(this, this_entry);
+
+ final JMenuItem save_as_embl_item = new JMenuItem(entry_name);
+
+ save_as_embl_item.addActionListener(save_as_embl_listener);
+
+ final ActionListener save_as_genbank_listener =
+ new SaveEntryAsGenbankActionListener(this, this_entry);
+
+ final JMenuItem save_as_genbank_item = new JMenuItem(entry_name);
+
+ save_as_genbank_item.addActionListener(save_as_genbank_listener);
+
+ final ActionListener save_as_gff_listener =
+ new SaveEntryAsGFFActionListener(this, this_entry);
+
+ final JMenuItem save_as_gff_item = new JMenuItem(entry_name);
+
+ save_as_gff_item.addActionListener(save_as_gff_listener);
+
+ final ActionListener save_embl_only_listener =
+ new SaveEntryAsSubmissionActionListener(this, this_entry);
+
+ final JMenuItem save_embl_only_item = new JMenuItem(entry_name);
+
+ save_embl_only_item.addActionListener(save_embl_only_listener);
+
+ if(read_features_menu != null)
+ {
+ final ActionListener read_into_listener =
+ new ReadFeaturesActionListener(this, filesystem_entry_source,
+ this_entry);
+
+ final JMenuItem read_into_item = new JMenuItem(entry_name);
+ read_into_item.addActionListener(read_into_listener);
+ read_features_menu.add(read_into_item);
+ }
+
+ save_entry_menu.add(save_entry_item);
+
+ save_as.add(save_as_item);
+ save_as_embl.add(save_as_embl_item);
+ save_as_genbank.add(save_as_genbank_item);
+ save_as_gff.add(save_as_gff_item);
+ save_embl_only.add(save_embl_only_item);
+ }
+
+ save_as_menu.add(save_as);
+ save_as_menu.add(save_as_embl);
+ save_as_menu.add(save_as_genbank);
+ save_as_menu.add(save_as_gff);
+ save_as_menu.addSeparator();
+ save_as_menu.add(save_embl_only);
+
+ file_menu.add(save_entry_menu);
+ file_menu.add(save_as_menu);
+ }
+
+ final JMenuItem save_all = new JMenuItem("Save All Entries");
+ save_all.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ saveAllEntries();
+ }
+ });
+
+ file_menu.add(save_all);
+ file_menu.addSeparator();
+ }
+
+ final JMenuItem clone_entry_edit = new JMenuItem("Clone This Window");
+ clone_entry_edit.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ new EntryEdit(getEntryGroup()).show();
+ }
+ });
+
+ file_menu.add(clone_entry_edit);
+ file_menu.addSeparator();
+
+
+ final JMenuItem close = new JMenuItem("Close");
+ close.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ closeEntryEdit();
+ }
+ });
+
+ file_menu.add(close);
+ }
+
+ /**
+ * Read an entry
+ **/
+ private void readAnEntry(final EntrySource this_source)
+ {
+ final ProgressThread progress_thread = new ProgressThread(null,
+ "Loading Entry...");
+
+ SwingWorker entryWorker = new SwingWorker()
+ {
+ public Object construct()
+ {
+ try
+ {
+ final Entry new_entry = this_source.getEntry(entry_group.getBases(),
+ progress_thread, true);
+ if(new_entry != null)
+ getEntryGroup().add(new_entry);
+ }
+ catch(final OutOfRangeException e)
+ {
+ new MessageDialog(EntryEdit.this,
+ "read failed: one of the features " +
+ "in the entry has an out of " +
+ "range location: " +
+ e.getMessage());
+ }
+ catch(final IOException e)
+ {
+ new MessageDialog(EntryEdit.this,
+ "read failed due to an IO error: " +
+ e.getMessage());
+ }
+ return null;
+ }
+
+ public void finished()
+ {
+ if(progress_thread !=null)
+ progress_thread.finished();
+ }
+ };
+ entryWorker.start();
+ }
+
+ /**
+ * Read an entry
+ **/
+ private void readAnEntryFromFile(final File file)
+ {
+ final ProgressThread progress_thread = new ProgressThread(null,
+ "Loading Entry...");
+ progress_thread.start();
+
+ SwingWorker entryWorker = new SwingWorker()
+ {
+ public Object construct()
+ {
+ try
+ {
+ EntryInformation new_entry_information =
+ new SimpleEntryInformation(Options.getArtemisEntryInformation());
+
+ final Entry new_entry = new Entry(entry_group.getBases(),
+ EntryFileDialog.getEntryFromFile(null,
+ new FileDocument(file),
+ new_entry_information, false));
+
+ if(new_entry != null)
+ getEntryGroup().add(new_entry);
+ }
+ catch(final OutOfRangeException e)
+ {
+ new MessageDialog(EntryEdit.this,
+ "read failed: one of the features " +
+ "in the entry has an out of " +
+ "range location: " +
+ e.getMessage());
+ }
+ return null;
+ }
+
+ public void finished()
+ {
+ if(progress_thread !=null)
+ progress_thread.finished();
+ }
+ };
+ entryWorker.start();
+ }
+
+ /**
+ * Return the current default font(from Diana.options).
+ **/
+ private Font getDefaultFont()
+ {
+ return Options.getOptions().getFont();
+ }
+
+ // DropTargetListener methods
+ protected static Border dropBorder = new BevelBorder(BevelBorder.LOWERED);
+ public void drop(DropTargetDropEvent e)
+ {
+ Transferable t = e.getTransferable();
+ try
+ {
+ if(t.isDataFlavorSupported(FileNode.FILENODE))
+ {
+ FileNode fn = (FileNode)t.getTransferData(FileNode.FILENODE);
+ readAnEntryFromFile(fn.getFile());
+ }
+ else
+ e.rejectDrop();
+ }
+ catch(UnsupportedFlavorException ufe)
+ {
+ ufe.printStackTrace();
+ }
+ catch(IOException ioe)
+ {
+ ioe.printStackTrace();
+ }
+ finally
+ {
+ ((JComponent)getContentPane()).setBorder(null);
+ }
+ }
+
+ public void dragExit(DropTargetEvent e)
+ {
+ ((JComponent)getContentPane()).setBorder(null);
+ }
+ public void dropActionChanged(DropTargetDragEvent e) {}
+
+ public void dragOver(DropTargetDragEvent e)
+ {
+ if(e.isDataFlavorSupported(FileNode.FILENODE))
+ {
+ Point ploc = e.getLocation();
+ if(this.contains(ploc.x,ploc.y))
+ {
+ ((JComponent)getContentPane()).setBorder(dropBorder);
+ e.acceptDrag(DnDConstants.ACTION_COPY_OR_MOVE);
+ }
+ else
+ e.rejectDrag();
+ }
+ }
+
+ public void dragEnter(DropTargetDragEvent e)
+ {
+ if(e.isDataFlavorSupported(FileNode.FILENODE))
+ e.acceptDrag(DnDConstants.ACTION_COPY_OR_MOVE);
+ }
+
+}
+
+/**
+ * This is an EntryActionListener that will get an entry from entry_source
+ * and then copy them to destination_entry when actionPerformed() is called.
+ **/
+class ReadFeaturesActionListener extends EntryActionListener
+{
+ final EntrySource entry_source;
+
+ ReadFeaturesActionListener(final EntryEdit entry_edit,
+ final EntrySource entry_source,
+ final Entry destination_entry)
+ {
+ super(entry_edit, destination_entry);
+ this.entry_source = entry_source;
+ }
+
+ public void actionPerformed(final ActionEvent event)
+ {
+ try
+ {
+ if(getEntry().isReadOnly())
+ {
+ final String message =
+ "the default entry is read only - cannot continue";
+ new MessageDialog(getEntryEdit(), message);
+ }
+
+ final Entry source_entry =
+ entry_source.getEntry(getEntryEdit().getEntryGroup().getBases(),
+ true);
+
+ for(int i = 0; i < source_entry.getFeatureCount(); ++i)
+ {
+ final Feature this_feature = source_entry.getFeature(i);
+ try
+ {
+ this_feature.copyTo(getEntry());
+ }
+ catch(OutOfRangeException e)
+ {
+ throw new Error("internal error - unexpected exception: " + e);
+ }
+ catch(EntryInformationException e)
+ {
+ final String message =
+ "couldn't move one of the features(" +
+ this_feature.getIDString() + "): " + e.getMessage();
+ new MessageDialog(getEntryEdit(), message);
+ }
+ catch(ReadOnlyException e)
+ {
+ final String message =
+ "the default entry is read only - cannot continue";
+ new MessageDialog(getEntryEdit(), message);
+ return;
+ }
+ }
+ }
+ catch(OutOfRangeException e)
+ {
+ new MessageDialog(getEntryEdit(),
+ "read failed: one of the features in " +
+ "the source entry has an out of range location");
+ }
+ catch(IOException e)
+ {
+ new MessageDialog(getEntryEdit(),
+ "read failed due to an IO error: " +
+ e.getMessage());
+ }
+ catch(NullPointerException e)
+ {
+ new MessageDialog(getEntryEdit(),
+ "read failed due to a null pointer error: " +
+ e.getMessage());
+ }
+
+ }
+
+}
+
+/**
+ * This is an EntryActionListener that will call saveEntry() when
+ * actionPerformed() is called.
+ **/
+class SaveEntryActionListener extends EntryActionListener
+{
+ SaveEntryActionListener(final EntryEdit entry_edit,
+ final Entry entry)
+ {
+ super(entry_edit, entry);
+ }
+
+ public void actionPerformed(final ActionEvent event)
+ {
+ getEntryEdit().saveEntry(getEntry(), true, false, true,
+ DocumentEntryFactory.ANY_FORMAT);
+ }
+}
+
+/**
+ * This is an EntryActionListener that will call saveEntry() when
+ * actionPerformed() is called.
+ **/
+class SaveEntryAsActionListener extends EntryActionListener
+{
+ SaveEntryAsActionListener(final EntryEdit entry_edit,
+ final Entry entry)
+ {
+ super(entry_edit, entry);
+ }
+
+ public void actionPerformed(final ActionEvent event)
+ {
+ getEntryEdit().saveEntry(getEntry(), true, true, true,
+ DocumentEntryFactory.ANY_FORMAT);
+ }
+}
+
+/**
+ * This is an EntryActionListener that will call saveEntry() when
+ * actionPerformed() is called. The output file type will be EMBL.
+ **/
+class SaveEntryAsEMBLActionListener extends EntryActionListener
+{
+ SaveEntryAsEMBLActionListener(final EntryEdit entry_edit,
+ final Entry entry)
+ {
+ super(entry_edit, entry);
+ }
+
+ public void actionPerformed(final ActionEvent event)
+ {
+ getEntryEdit().saveEntry(getEntry(), true, true, false,
+ DocumentEntryFactory.EMBL_FORMAT);
+ }
+}
+
+/**
+ * This is an EntryActionListener that will call saveEntry() when
+ * actionPerformed() is called. The output file type will be GENBANK.
+ **/
+class SaveEntryAsGenbankActionListener extends EntryActionListener
+{
+ SaveEntryAsGenbankActionListener(final EntryEdit entry_edit,
+ final Entry entry)
+ {
+ super(entry_edit, entry);
+ }
+
+ public void actionPerformed(final ActionEvent event)
+ {
+ getEntryEdit().saveEntry(getEntry(), true, true, false,
+ DocumentEntryFactory.GENBANK_FORMAT);
+ }
+}
+
+/**
+ * This is an EntryActionListener that will call saveEntry() when
+ * actionPerformed() is called. The output file type will be GFF, with the
+ * sequence(if any) in FASTA format.
+ **/
+class SaveEntryAsGFFActionListener extends EntryActionListener
+{
+ SaveEntryAsGFFActionListener(final EntryEdit entry_edit,
+ final Entry entry)
+ {
+ super(entry_edit, entry);
+ }
+
+ public void actionPerformed(final ActionEvent event)
+ {
+ getEntryEdit().saveEntry(getEntry(), true, true, false,
+ DocumentEntryFactory.GFF_FORMAT);
+ }
+}
+
+/**
+ * This is an EntryActionListener that will call saveEntry() when
+ * actionPerformed() is called.
+ **/
+class SaveEntryAsSubmissionActionListener extends EntryActionListener
+{
+ SaveEntryAsSubmissionActionListener(final EntryEdit entry_edit,
+ final Entry entry)
+ {
+ super(entry_edit, entry);
+ }
+
+ public void actionPerformed(final ActionEvent event)
+ {
+ getEntryEdit().saveEntry(getEntry(), false, true, false,
+ DocumentEntryFactory.ANY_FORMAT);
+ }
+}
diff --git a/uk/ac/sanger/artemis/components/EntryEditVector.java b/uk/ac/sanger/artemis/components/EntryEditVector.java
new file mode 100644
index 000000000..68421296a
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/EntryEditVector.java
@@ -0,0 +1,92 @@
+/* EntryEditVector.java
+ *
+ * created: Sat Oct 17 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/EntryEditVector.java,v 1.1 2004-06-09 09:46:27 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import java.util.Vector;
+
+/**
+ * This class implements a Vector of EntryEdit objects.
+ *
+ * @author Kim Rutherford
+ * @version $Id: EntryEditVector.java,v 1.1 2004-06-09 09:46:27 tjc Exp $
+ *
+ **/
+
+public class EntryEditVector {
+ /**
+ * Create a new, entry EntryEditVector.
+ **/
+ public EntryEditVector () {
+
+ }
+
+ /**
+ * Performs the same function as Vector.addElement ()
+ */
+ public void addElement (EntryEdit node) {
+ vector.addElement (node);
+ }
+
+ /**
+ * Performs the same function as Vector.elementAt ()
+ */
+ public EntryEdit elementAt (int index) {
+ return (EntryEdit) vector.elementAt (index);
+ }
+
+// /**
+// * Performs the same function as Vector.lastElement ()
+// **/
+// public Feature lastElement () {
+// return (Feature) vector.lastElement ();
+// }
+
+ /**
+ * Performs the same function as Vector.removeElement ()
+ **/
+ public boolean removeElement (EntryEdit entry_edit) {
+ return vector.removeElement (entry_edit);
+ }
+
+ /**
+ * Performs the same function as Vector.removeElement ()
+ **/
+ public int indexOf (EntryEdit entry_edit) {
+ return vector.indexOf (entry_edit);
+ }
+
+ /**
+ * Performs the same function as Vector.size ()
+ */
+ public int size () {
+ return vector.size ();
+ }
+
+ /**
+ * Storage for EntryEdit objects.
+ */
+ final private Vector vector = new Vector ();
+}
diff --git a/uk/ac/sanger/artemis/components/EntryFileDialog.java b/uk/ac/sanger/artemis/components/EntryFileDialog.java
new file mode 100644
index 000000000..86c1e9d1a
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/EntryFileDialog.java
@@ -0,0 +1,463 @@
+/* EntryFileDialog.java
+ *
+ * created: Mon Dec 7 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 1998-2003 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/EntryFileDialog.java,v 1.1 2004-06-09 09:46:28 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.Options;
+import uk.ac.sanger.artemis.util.*;
+import uk.ac.sanger.artemis.io.Entry;
+import uk.ac.sanger.artemis.io.DocumentEntryFactory;
+import uk.ac.sanger.artemis.io.ReadFormatException;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.EntryInformationException;
+
+import java.io.File;
+import java.io.IOException;
+import java.io.FileNotFoundException;
+import javax.swing.*;
+
+/**
+ * This class is a JFileChooser that can read EMBL Entry objects.
+ *
+ * @author Kim Rutherford
+ * @version $Id: EntryFileDialog.java,v 1.1 2004-06-09 09:46:28 tjc Exp $
+ **/
+
+public class EntryFileDialog extends StickyFileChooser
+{
+
+ /** JFrame reference that was passed to the constructor. */
+ private JFrame owner = null;
+
+ /**
+ * Create a new EntryFileDialog component.
+ * @param owner The component where this dialog was created.
+ * @param sequence_only If true default to showing only file that have
+ * suffixes that suggest that the files contain sequence(eg. .embl,
+ * .seq, .dna). Of false show all files that can be read.
+ **/
+ public EntryFileDialog(final JFrame owner,
+ final boolean show_sequence_only)
+ {
+ super();
+ this.owner = owner;
+
+ setFileSelectionMode(JFileChooser.FILES_ONLY);
+ setMultiSelectionEnabled(false);
+
+ final StringVector sequence_suffixes =
+ Options.getOptions().getOptionValues("sequence_file_suffixes");
+
+ final StringVector feature_suffixes =
+ Options.getOptions().getOptionValues("feature_file_suffixes");
+
+ final javax.swing.filechooser.FileFilter artemis_filter =
+ new javax.swing.filechooser.FileFilter()
+ {
+ public boolean accept(final File file)
+ {
+ if(file.isDirectory())
+ return true;
+
+ for(int i = 0; i<sequence_suffixes.size(); ++i)
+ {
+ final String this_suffix = sequence_suffixes.elementAt(i);
+
+ if(file.getName().endsWith("." + this_suffix) ||
+ file.getName().endsWith("." + this_suffix + ".gz"))
+ return true;
+ }
+
+ for(int i = 0; i<feature_suffixes.size(); ++i)
+ {
+ final String this_suffix = feature_suffixes.elementAt(i);
+
+ if(file.getName().endsWith("." + this_suffix) ||
+ file.getName().endsWith("." + this_suffix + ".gz"))
+ return true;
+ }
+ return false;
+ }
+
+ public String getDescription()
+ {
+ return "Artemis files";
+ }
+ };
+
+ final javax.swing.filechooser.FileFilter feature_filter =
+ new javax.swing.filechooser.FileFilter()
+ {
+ public boolean accept(final File file)
+ {
+ if(file.isDirectory())
+ return true;
+
+ for(int i = 0 ; i < feature_suffixes.size() ; ++i)
+ {
+ final String this_suffix = feature_suffixes.elementAt(i);
+
+ if(file.getName().endsWith("." + this_suffix) ||
+ file.getName().endsWith("." + this_suffix + ".gz"))
+ return true;
+ }
+
+ return false;
+ }
+
+ public String getDescription()
+ {
+ return "Feature files";
+ }
+ };
+
+ final javax.swing.filechooser.FileFilter sequence_filter =
+ new javax.swing.filechooser.FileFilter()
+ {
+ public boolean accept(final File file)
+ {
+ if(file.isDirectory())
+ return true;
+
+ for(int i = 0 ; i<sequence_suffixes.size() ; ++i)
+ {
+ final String this_suffix = sequence_suffixes.elementAt(i);
+
+ if(file.getName().endsWith("." + this_suffix) ||
+ file.getName().endsWith("." + this_suffix + ".gz"))
+ return true;
+ }
+
+ return false;
+ }
+
+ public String getDescription()
+ {
+ return "Sequence files";
+ }
+ };
+
+ addChoosableFileFilter(artemis_filter);
+ addChoosableFileFilter(feature_filter);
+ addChoosableFileFilter(sequence_filter);
+
+ if(show_sequence_only)
+ setFileFilter(sequence_filter);
+ else
+ setFileFilter(artemis_filter);
+ }
+
+ /**
+ * Return an uk.ac.sanger.artemis.io.Entry object representing the file
+ * the user has selected with the dialog or null if the read failed for any
+ * reason.
+ * @param entry_information The EntryInformation to use when reading. This
+ * supplies the list of valid keys and qualifiers. If a key or qualifier
+ * is read that is incompatible with this EntryInformation object the
+ * EntryInformation will be changed to cope.
+ * @param listener The object to which InputStreamProgressEvents will be
+ * send while reading.
+ * @exception EntryInformationException Thrown if an Entry using the given
+ * EntryInformation object cannot contain the Key, Qualifier or
+ * Key/Qualifier combination of one of the features in the Document.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading.
+ **/
+ public Entry getEntry(final EntryInformation entry_information,
+ final InputStreamProgressListener listener,
+ final ProgressThread progress_thread,
+ final boolean show_progress)
+ {
+ setDialogTitle("Select a file ...");
+ setDialogType(JFileChooser.OPEN_DIALOG);
+ SecurityManager sm = System.getSecurityManager();
+ System.setSecurityManager(null);
+
+ final int status = showOpenDialog(owner);
+
+ System.setSecurityManager(sm);
+
+ if(status != JFileChooser.APPROVE_OPTION ||
+ getSelectedFile() == null)
+ return null;
+
+ if(progress_thread != null)
+ progress_thread.start();
+
+ final File file = new File(getCurrentDirectory(),
+ getSelectedFile().getName());
+
+ return getEntryFromFile(owner, new FileDocument(file),
+ entry_information, show_progress);
+ }
+
+ /**
+ * This exists only to get around a bug in the 1.1/1.2 code generator,
+ * which generates unverifiable code.
+ * @param frame Used when creating MessageDialog components.
+ * @param file_document The Document to read the Entry from(should be made
+ * from entry_file).
+ * @param entry_information The EntryInformation to use when reading. This
+ * supplies the list of valid keys and qualifiers. If a key or qualifier
+ * is read that is incompatible with this EntryInformation object the
+ * EntryInformation will be changed to cope.
+ **/
+ private static Entry getEntryFromFileHelper(final JFrame frame,
+ final Document file_document,
+ final EntryInformation entry_information)
+ throws ReadFormatException, IOException
+ {
+
+ final LogReadListener read_event_logger =
+ new LogReadListener(file_document.getName());
+
+ final Entry new_entry;
+
+ try
+ {
+ new_entry =
+ DocumentEntryFactory.makeDocumentEntry(entry_information,
+ file_document,read_event_logger);
+ }
+ catch(EntryInformationException e)
+ {
+ throw new Error("internal error - unexpected exception: " + e);
+ }
+
+ if(read_event_logger.seenMessage())
+ {
+ final YesNoDialog yes_no_dialog = new YesNoDialog(frame,
+ "there were warnings while reading - view now?");
+
+ if(yes_no_dialog.getResult())
+ Splash.showLog();
+ }
+
+ return new_entry;
+ }
+
+ /**
+ * Read and return an Entry from the given File.
+ * @param frame Used when creating MessageDialog components.
+ * @param entry_file The file to read the Entry from.
+ * @param entry_information The EntryInformation to use when reading. This
+ * supplies the list of valid keys and qualifiers. If a key or qualifier
+ * is read that is incompatible with this EntryInformation object the
+ * EntryInformation will be changed to cope.
+ * @param listener The object to which InputStreamProgressEvents will be
+ * send while reading.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading.
+ **/
+ public static Entry getEntryFromFile(final JFrame frame,
+ final Document entry_document,
+ final EntryInformation entry_information,
+ final boolean show_progress)
+ {
+ InputStreamProgressDialog progress_dialog = null;
+
+ if(show_progress) {
+// XXX FIXME
+
+// This doesn't work because getEntryFromFile() is called from the Swing
+// thread so the Dialog never gets updated
+
+// progress_dialog =
+// new InputStreamProgressDialog(frame, "Reading ...",
+// "Reading from " +
+// entry_document.getName(), false);
+// final InputStreamProgressListener listener =
+// progress_dialog.getInputStreamProgressListener();
+
+// entry_document.addInputStreamProgressListener(listener);
+ }
+
+ try
+ {
+ return getEntryFromFileHelper(frame, entry_document,
+ entry_information);
+ }
+ catch(ReadFormatException e)
+ {
+ final String message =
+ "failed to open " + entry_document.getName() + ": " +
+ e.getMessage() +(e.getLineNumber() > 1 ?
+ " at line: " + e.getLineNumber() :
+ "");
+ System.out.println(message);
+ new MessageDialog(frame, message);
+ }
+ catch(FileNotFoundException e)
+ {
+ final String message =
+ "failed to open " + entry_document.getName() + ": file not found";
+ new MessageDialog(frame, message);
+ }
+ catch(IOException e)
+ {
+ final String message =
+ "failed to open " + entry_document.getName() + ": " + e.getMessage();
+ new MessageDialog(frame, message);
+ }
+ finally
+ {
+// if(progress_dialog != null)
+// progress_dialog.dispose();
+ }
+ return null;
+ }
+
+ /**
+ * Save the given entry, prompting for a file name if necessary.
+ * @param include_diana_extensions If true then the any diana additions to
+ * the embl file format will be included in the output, otherwise they
+ * will be removed. Also possible problems that would cause an entry to
+ * bounce from the EMBL submission process will be flagged if this is
+ * true.
+ * @param ask_for_name If true then always prompt for a new filename,
+ * otherwise prompt only when the entry name is not set.
+ * @param keep_new_name If ask_for_name is true a file will be written with
+ * the new name the user selects - if keep_new_name is true as well, then
+ * the entry will have it's name set to the new name, otherwise it will
+ * be used for this save and then discarded.
+ * @param destination_type Should be one of EMBL_FORMAT, GENBANK_FORMAT or
+ * ANY_FORMAT. If ANY_FORMAT then the Entry will be saved in the
+ * same format it was created, otherwise it will be saved in the given
+ * format.
+ **/
+ void saveEntry(final uk.ac.sanger.artemis.Entry entry,
+ final boolean include_diana_extensions,
+ final boolean ask_for_name,
+ final boolean keep_new_name,
+ final int destination_type)
+ {
+ try
+ {
+ if(ask_for_name || entry.getName() == null)
+ {
+ JCheckBox emblHeader = new JCheckBox("Add EMBL Header",
+ false);
+ setDialogTitle("Save to ...");
+ setDialogType(JFileChooser.SAVE_DIALOG);
+
+// if(destination_type == DocumentEntryFactory.EMBL_FORMAT)
+// setAccessory(emblHeader);
+ int status = showSaveDialog(owner);
+
+ if(status != JFileChooser.APPROVE_OPTION ||
+ getSelectedFile() == null)
+ return;
+
+ File file = new File(getCurrentDirectory(),
+ getSelectedFile().getName());
+
+ if(file.exists())
+ {
+ final YesNoDialog yes_no_dialog = new YesNoDialog(owner,
+ "this file exists: " + file.getName() +
+ " overwrite it?");
+
+ if(!yes_no_dialog.getResult())
+ return;
+ }
+
+ final MessageDialog message = new MessageDialog(owner,
+ "saving to " + file.getName() + " ...",
+ false);
+ try
+ {
+ if(include_diana_extensions)
+ entry.save(file, destination_type, false);
+ else
+ entry.saveStandardOnly(file, destination_type, true);
+ }
+ catch(EntryInformationException e)
+ {
+ final YesNoDialog yes_no_dialog = new YesNoDialog(owner,
+ "destination format can't handle all " +
+ "keys/qualifiers - continue?");
+ if(yes_no_dialog.getResult())
+ {
+ try
+ {
+ if(include_diana_extensions)
+ entry.save(file, destination_type, true);
+ else
+ entry.saveStandardOnly(file, destination_type, true);
+ }
+ catch(EntryInformationException e2)
+ {
+ throw new Error("internal error - unexpected exception: "+ e);
+ }
+ }
+ else
+ return;
+ }
+ finally
+ {
+ if(message != null)
+ message.dispose();
+ }
+
+ if(keep_new_name)
+ entry.setName(file.getName());
+ }
+ else
+ {
+ final MessageDialog message = new MessageDialog(owner,
+ "saving to " + entry.getName() + " ...",
+ false);
+ try
+ {
+ if(include_diana_extensions)
+ entry.save(destination_type);
+ else
+ entry.saveStandardOnly(destination_type);
+ }
+ finally
+ {
+ message.dispose();
+ }
+ }
+ }
+ catch(ReadOnlyException e)
+ {
+ new MessageDialog(owner, "this entry is read only");
+ return;
+ }
+ catch(IOException e)
+ {
+ new MessageDialog(owner, "error while saving: " + e);
+ return;
+ }
+ catch(EntryInformationException e)
+ {
+ new MessageDialog(owner, "error while saving: " + e);
+ return;
+ }
+ }
+
+}
+
diff --git a/uk/ac/sanger/artemis/components/EntryGroupDisplay.java b/uk/ac/sanger/artemis/components/EntryGroupDisplay.java
new file mode 100644
index 000000000..a37b6f6cf
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/EntryGroupDisplay.java
@@ -0,0 +1,240 @@
+/* EntryGroupDisplay.java
+ *
+ * created: Mon Dec 7 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 1998,1999,2000,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/EntryGroupDisplay.java,v 1.1 2004-06-09 09:46:29 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import java.awt.FlowLayout;
+import java.awt.Color;
+import java.awt.event.*;
+import java.util.Vector;
+
+import javax.swing.*;
+
+/**
+ * This component allows the user to change the "active" setting of the
+ * objects in an EntryGroup.
+ *
+ * @author Kim Rutherford
+ * @version $Id: EntryGroupDisplay.java,v 1.1 2004-06-09 09:46:29 tjc Exp $
+ **/
+
+public class EntryGroupDisplay extends JPanel
+ implements EntryGroupChangeListener, EntryChangeListener
+{
+ final private static Color background_colour = new Color(200, 200, 200);
+
+ /**
+ * This is a reference to the EntryEdit component that created this
+ * EntryGroupDisplay. We need this reference so that we can watch the
+ * entry group.
+ **/
+ private EntryEdit owning_component;
+
+ /**
+ * A vector containing the Entry objects that this EntryEdit object knows
+ * about. This reference is obtained from owning_component.
+ **/
+ private EntryGroup entry_group;
+
+ /**
+ * A vector containing one JCheckBox or Label for each Entry in the
+ * EntryGroup object.
+ **/
+ private Vector entry_components = new Vector();
+
+ /**
+ * A label containing the message "Entry:".
+ **/
+ private JLabel label;
+
+ /**
+ * Create a new EntryGroupDisplay object.
+ * @param owning_component The EntryEdit object that this EntryGroupDisplay
+ * component is in.
+ **/
+ public EntryGroupDisplay(final EntryEdit owning_component)
+ {
+ this.owning_component = owning_component;
+ this.entry_group = owning_component.getEntryGroup();
+
+ entry_group.addEntryGroupChangeListener(this);
+ entry_group.addEntryChangeListener(this);
+
+ final FlowLayout flow_layout = new FlowLayout(FlowLayout.LEFT);
+
+ label = new JLabel("Entry: ");
+
+ setLayout(flow_layout);
+ refreshButtons();
+
+ setBackground(background_colour);
+ }
+
+
+ /**
+ * Implementation of the EntryGroupChangeListener interface. We listen to
+ * EntryGroupChange events so that we can update the display if entries
+ * are added or deleted.
+ **/
+ public void entryGroupChanged(final EntryGroupChangeEvent event)
+ {
+ switch(event.getType())
+ {
+ case EntryGroupChangeEvent.ENTRY_ADDED:
+ case EntryGroupChangeEvent.ENTRY_DELETED:
+ refreshButtons();
+ break;
+ case EntryGroupChangeEvent.ENTRY_INACTIVE:
+ case EntryGroupChangeEvent.ENTRY_ACTIVE:
+ updateActive();
+ break;
+ case EntryGroupChangeEvent.NEW_DEFAULT_ENTRY:
+ highlightDefaultEntry(event);
+ break;
+ }
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface.
+ **/
+ public void entryChanged(final EntryChangeEvent event)
+ {
+ if(event.getType() == EntryChangeEvent.NAME_CHANGED)
+ refreshButtons();
+ }
+
+ /**
+ * Remove and then recreate the Buttons to the reflect the current contents
+ * of the EntryGroup.
+ **/
+ private void refreshButtons()
+ {
+ removeAll();
+ add(label);
+
+ entry_components = new Vector();
+
+ if(entry_group == null)
+ return;
+ else
+ {
+ for(int i = 0; i < entry_group.size(); ++i)
+ add(entry_group.elementAt(i));
+ }
+
+ doLayout();
+ }
+
+ /**
+ * Update the buttons to reflect the current state of the EntryGroup.
+ **/
+ private void updateActive()
+ {
+ for(int i = 0 ; i < entry_group.size() ; ++i)
+ {
+ final JCheckBox menu_item = (JCheckBox)entry_components.elementAt(i);
+ menu_item.setSelected(entry_group.isActive(entry_group.elementAt(i)));
+ }
+ }
+
+ /**
+ * Add a JLabel or JCheckBox for the given Entry to this component.
+ **/
+ private void add(final Entry entry)
+ {
+ final JCheckBox new_component;
+ String entry_name = entry.getName();
+
+ if(entry_name == null)
+ entry_name = "no name";
+
+ new_component = new JCheckBox(entry_name, entry_group.isActive(entry));
+
+ setEntryHighlight(entry, new_component);
+
+ new_component.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent event)
+ {
+ final int button_index =
+ entry_components.indexOf(event.getSource());
+
+ if(event.getStateChange() == ItemEvent.SELECTED)
+ entry_group.setIsActive(button_index, true);
+ else
+ entry_group.setIsActive(button_index, false);
+ }
+ });
+
+ new_component.addMouseListener(new MouseAdapter()
+ {
+ /**
+ * Listen for mouse press events so that we can change the default
+ * Entry when the popup trigger is pressed.
+ **/
+ public void mousePressed(MouseEvent event)
+ {
+ if(event.isPopupTrigger())
+ entry_group.setDefaultEntry(entry);
+ }
+ });
+
+ entry_components.addElement(new_component);
+ add(new_component);
+ }
+
+ /**
+ * Given a EntryGroupChangeEvent, this method will highlight the new
+ * default entry
+ **/
+ private void highlightDefaultEntry(final EntryGroupChangeEvent event)
+ {
+ final EntryGroup entry_group = owning_component.getEntryGroup();
+
+ for(int i = 0 ; i < entry_group.size() ; ++i)
+ {
+ final JCheckBox check_box =(JCheckBox) entry_components.elementAt(i);
+
+ setEntryHighlight(entry_group.elementAt(i), check_box);
+ }
+ }
+
+ /**
+ * Highlight the given JCheckBox/Entry appropriately. The default Entry
+ * will look different to the others
+ **/
+ private void setEntryHighlight(final Entry entry,
+ final JCheckBox component)
+ {
+ final String label = component.getText();
+
+ if(entry_group.getDefaultEntry() == entry)
+ component.setBackground(Color.yellow);
+ else
+ component.setBackground(background_colour);
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/EntryGroupInfoDisplay.java b/uk/ac/sanger/artemis/components/EntryGroupInfoDisplay.java
new file mode 100644
index 000000000..960ab6112
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/EntryGroupInfoDisplay.java
@@ -0,0 +1,536 @@
+/* EntryGroupInfoDisplay.java
+ *
+ * created: Fri Mar 12 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/EntryGroupInfoDisplay.java,v 1.1 2004-06-09 09:46:30 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.util.StringVector;
+import uk.ac.sanger.artemis.io.Key;
+import uk.ac.sanger.artemis.io.Qualifier;
+import uk.ac.sanger.artemis.io.Location;
+import uk.ac.sanger.artemis.io.FuzzyRange;
+import uk.ac.sanger.artemis.io.RangeVector;
+import uk.ac.sanger.artemis.io.InvalidRelationException;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import java.util.Hashtable;
+import java.util.Enumeration;
+import java.awt.event.*;
+
+import javax.swing.JFrame;
+
+/**
+ * This component will show general information about an EntryGroup. It will
+ * show the sequence length, GC content and a summary of the active entries.
+ *
+ * @author Kim Rutherford
+ * @version $Id: EntryGroupInfoDisplay.java,v 1.1 2004-06-09 09:46:30 tjc Exp $
+ **/
+
+public class EntryGroupInfoDisplay
+ implements FeatureChangeListener, EntryChangeListener,
+ EntryGroupChangeListener, SequenceChangeListener {
+ /**
+ * Create a new EntryGroupInfoDisplay object to summarize all features on
+ * both strands of the given EntryGroup.
+ * @param parent_frame The reference of the parent JFrame.
+ * @param entry_group The EntryGroup to view.
+ **/
+ public EntryGroupInfoDisplay (final JFrame parent_frame,
+ final EntryGroup entry_group) {
+ this (parent_frame, entry_group, BOTH);
+ }
+
+ /**
+ * Create a new EntryGroupInfoDisplay object to summarize the given
+ * EntryGroup.
+ * @param parent_frame The reference of the parent JFrame.
+ * @param entry_group The EntryGroup to view.
+ * @param strand_flag Indicates which strand to summarize. BOTH means
+ * summarize all features on both strands. FORWARD means summarize
+ * forward strand only. REVERSE means summarize reverse strand only.
+ **/
+ public EntryGroupInfoDisplay (final JFrame parent_frame,
+ EntryGroup entry_group,
+ final int strand_flag) {
+ this.strand_flag = strand_flag;
+ this.parent_frame = parent_frame;
+ this.entry_group = entry_group;
+
+ if (strand_flag == FORWARD) {
+ final FeaturePredicate forward_feature_predicate =
+ new FeaturePredicate () {
+ public boolean testPredicate (final Feature test_feature) {
+ return test_feature.isForwardFeature ();
+ }
+ };
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, forward_feature_predicate,
+ "forward strand features");
+
+ entry_group = filtered_entry_group;
+ } else {
+ if (strand_flag == REVERSE) {
+ final FeaturePredicate reverse_feature_predicate =
+ new FeaturePredicate () {
+ public boolean testPredicate (final Feature test_feature) {
+ return !test_feature.isForwardFeature ();
+ }
+ };
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, reverse_feature_predicate,
+ "reverse strand features");
+
+ entry_group = filtered_entry_group;
+ } else {
+ if (strand_flag != BOTH) {
+ throw new Error ("internal error - illegal argument");
+ }
+ }
+ }
+
+ file_viewer = new FileViewer (getFrameName ());
+
+ updateView ();
+
+ entry_group.addEntryChangeListener (this);
+ entry_group.addFeatureChangeListener (this);
+ entry_group.addEntryGroupChangeListener (this);
+ entry_group.getBases ().addSequenceChangeListener (this,
+ Bases.MAX_PRIORITY);
+
+ file_viewer.addWindowListener (new WindowAdapter () {
+ public void windowClosed (WindowEvent event) {
+ stopListening ();
+ }
+ });
+ }
+
+ /**
+ * Return the String that should be used for the title of the Overview Frame
+ **/
+ private String getFrameName () {
+ if (entry_group instanceof FilteredEntryGroup) {
+ final FilteredEntryGroup filtered_entry_group =
+ (FilteredEntryGroup) entry_group;
+
+ final String filter_name = filtered_entry_group.getFilterName ();
+
+ if (filter_name == null) {
+ return "Artemis overview of: " + parent_frame.getTitle ();
+ } else {
+ return "Artemis overview of: " + parent_frame.getTitle () +
+ " (" + filter_name + ")";
+ }
+ } else {
+ final StringBuffer buffer = new StringBuffer ("Artemis Overview");
+
+ if (entry_group.size () > 0) {
+
+ buffer.append (" of:");
+
+ for (int i = 0 ; i < entry_group.size () ; ++i) {
+ final Entry this_entry = entry_group.elementAt (i);
+
+ if (this_entry.getName () == null) {
+ buffer.append (" [no name]");
+ } else {
+ buffer.append (" " + this_entry.getName ());
+ }
+ }
+ }
+
+ return buffer.toString ();
+ }
+ }
+
+ /**
+ * Use the forward strand when summarizing.
+ **/
+ final static public int FORWARD = Bases.FORWARD;
+
+ /**
+ * Use the reverse strand when summarizing.
+ **/
+ final static public int REVERSE = Bases.REVERSE;
+
+ /**
+ * Summarize both strands.
+ **/
+ final static public int BOTH = 3;
+
+ /**
+ * Remove this object as a selection change listener.
+ **/
+ private void stopListening () {
+ entry_group.removeEntryChangeListener (this);
+ entry_group.removeEntryGroupChangeListener (this);
+ entry_group.removeFeatureChangeListener (this);
+ entry_group.getBases ().removeSequenceChangeListener (this);
+ }
+
+ /**
+ * Implementation of the FeatureChangeListener interface. We listen to
+ * FeatureChange events so that we can update the display if qualifiers
+ * change.
+ **/
+ public void featureChanged (final FeatureChangeEvent event) {
+ updateView ();
+ }
+
+ /**
+ * Implementation of the EntryGroupChangeListener interface. We listen to
+ * EntryGroupChange events so that we can update the display if entries
+ * are added, deleted, activated or deactivated.
+ **/
+ public void entryGroupChanged (final EntryGroupChangeEvent event) {
+ if (event.getType () == EntryGroupChangeEvent.DONE_GONE) {
+ stopListening ();
+ file_viewer.dispose ();
+ } else {
+ updateView ();
+ }
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface. We listen to
+ * EntryChange events so that we can update the display if features are
+ * added or deleted.
+ **/
+ public void entryChanged (final EntryChangeEvent event) {
+ updateView ();
+ }
+
+ /**
+ * Implementation of the SequenceChangeListener interface. We listen to
+ * SequenceChange events so that we can update the display if the sequence
+ * changes.
+ **/
+ public void sequenceChanged (final SequenceChangeEvent event) {
+ updateView ();
+ }
+
+ /**
+ * Update the FileViewer component to reflect the current state of the
+ * EntryGroup.
+ **/
+ private void updateView () {
+ final String frame_name = getFrameName ();
+
+ file_viewer.setTitle (frame_name);
+
+ final StringBuffer buffer = new StringBuffer ();
+
+ buffer.append (frame_name + "\n\n");
+
+ buffer.append ("Number of bases: " +
+ entry_group.getSequenceLength () + "\n");
+ buffer.append ("Number of features in the active entries: " +
+ entry_group.getAllFeaturesCount () + "\n\n");
+
+ final Bases entry_group_bases = entry_group.getBases ();
+
+ // cds_count - gene_count = pseudo gene count
+ int gene_count = 0;
+ int cds_count = 0;
+ int spliced_gene_count = 0;
+ int spliced_gene_bases_count = 0;
+ StringBuffer gene_bases_buffer = new StringBuffer ();
+ int gene_bases_count_with_introns = 0;
+ int cds_bases_count = 0;
+ int exon_count = 0;
+ int intron_count = 0;
+ int partial_count = 0;
+
+ final Hashtable table = new Hashtable ();
+
+ final FeatureEnumeration feature_enumerator = entry_group.features ();
+
+ while (feature_enumerator.hasMoreFeatures ()) {
+ final Feature this_feature = feature_enumerator.nextFeature ();
+
+ final Key key = this_feature.getKey ();
+ final String key_string = key.toString ();
+
+ final Location location = this_feature.getLocation ();
+
+ final RangeVector ranges = location.getRanges ();
+
+ for (int i = 0 ; i < ranges.size () ; ++i) {
+ if (ranges.elementAt (i) instanceof FuzzyRange) {
+ ++partial_count;
+ }
+ }
+
+ try {
+ String colour = this_feature.getValueOfQualifier ("colour");
+
+ if (colour == null || colour.length () == 0) {
+ colour = "no colour";
+ }
+
+ if (table.containsKey (key_string)) {
+ final Hashtable colour_table = (Hashtable) table.get (key_string);
+
+ final Integer colour_value = (Integer) colour_table.get (colour);
+
+ if (colour_value == null) {
+ colour_table.put (colour, new Integer (1));
+ } else {
+ final int old_value = ((Integer) colour_value).intValue ();
+
+ colour_table.put (colour, new Integer (old_value + 1));
+ }
+ } else {
+ final Hashtable colour_table = new Hashtable ();
+ colour_table.put (colour, new Integer (1));
+ table.put (key_string, colour_table);
+ }
+ } catch (InvalidRelationException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+
+ if (this_feature.isCDS ()) {
+ cds_count++;
+
+ cds_bases_count += this_feature.getBaseCount ();
+
+ final Qualifier pseudo_qualifier;
+
+ try {
+ pseudo_qualifier = this_feature.getQualifierByName ("pseudo");
+ } catch (InvalidRelationException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+
+ if (pseudo_qualifier == null) {
+ ++gene_count;
+
+ final FeatureSegmentVector segments = this_feature.getSegments ();
+
+ if (segments.size () > 1) {
+ ++spliced_gene_count;
+ spliced_gene_bases_count += this_feature.getBaseCount ();
+ intron_count += segments.size () - 1;
+ }
+
+ exon_count += segments.size ();
+
+ gene_bases_buffer.append (this_feature.getBases ());
+
+ gene_bases_count_with_introns +=
+ this_feature.getRawLastBase () -
+ this_feature.getRawFirstBase () + 1;
+ }
+ }
+ }
+
+ final String gene_bases = gene_bases_buffer.toString ();
+ final int gene_bases_count = gene_bases.length ();
+
+ final int pseudo_gene_count = cds_count - gene_count;
+ final int pseudo_gene_bases_count = cds_bases_count - gene_bases_count;
+
+ if (cds_count > 0) {
+ if (gene_count > 0) {
+ buffer.append ("Genes (CDS features without a /pseudo qualifier):\n");
+
+ final int non_spliced_gene_count = gene_count - spliced_gene_count;
+ final int non_spliced_gene_bases_count =
+ gene_bases_count - spliced_gene_bases_count;
+
+ if (spliced_gene_count > 0) {
+ buffer.append (" spliced:\n");
+ buffer.append (" count: " + spliced_gene_count + "\n");
+ buffer.append (" bases: " + spliced_gene_bases_count + "\n");
+ buffer.append (" introns: " + intron_count + "\n");
+ }
+
+ if (non_spliced_gene_count > 0) {
+ buffer.append (" non-spliced:\n");
+ buffer.append (" count: " + non_spliced_gene_count + "\n");
+ buffer.append (" bases: " + non_spliced_gene_bases_count +
+ "\n");
+ }
+
+ buffer.append (" all:\n");
+ buffer.append (" count: " + gene_count + "\n");
+ buffer.append (" partials: " + partial_count + "\n");
+ if (exon_count == gene_count) {
+ buffer.append (" bases: "
+ + gene_bases_count + "\n");
+ } else {
+ buffer.append (" bases (excluding introns): "
+ + gene_bases_count + "\n");
+ buffer.append (" bases (including introns): "
+ + gene_bases_count_with_introns + "\n");
+ buffer.append (" exons: " + exon_count + "\n");
+ buffer.append (" average exon length: " +
+ 10L * gene_bases_count / exon_count / 10.0 + "\n");
+ buffer.append (" average intron length: " +
+ 10L * (gene_bases_count_with_introns -
+ gene_bases_count) /
+ (exon_count - gene_count) / 10.0 + "\n");
+ buffer.append (" average number of exons per gene: " +
+ 100L * exon_count / gene_count / 100.00 + "\n");
+ }
+ buffer.append (" density: " +
+ 1000000L * gene_count /
+ entry_group.getSequenceLength () / 1000.0 +
+ " genes per kb (" +
+ entry_group.getSequenceLength () / gene_count +
+ " bases per gene)\n");
+ buffer.append (" average length: " +
+ gene_bases_count / gene_count + "\n");
+ buffer.append (" average length (including introns): " +
+ gene_bases_count_with_introns / gene_count + "\n");
+ buffer.append (" coding percentage: " +
+ 1000L * gene_bases_count /
+ entry_group.getSequenceLength () / 10.0 + "\n");
+ buffer.append (" coding percentage (including introns): " +
+ 1000L * gene_bases_count_with_introns /
+ entry_group.getSequenceLength () / 10.0 + "\n\n");
+
+ buffer.append (" gene sequence composition:\n\n");
+
+ final StringVector gene_base_summary =
+ SelectionViewer.getBaseSummary (gene_bases);
+
+ for (int i = 0 ; i < gene_base_summary.size () ; ++i) {
+ buffer.append (" ");
+ buffer.append (gene_base_summary.elementAt (i)).append ("\n");
+ }
+
+ buffer.append ("\n");
+ }
+
+ if (pseudo_gene_count > 0) {
+ buffer.append ("Pseudo genes (CDS features with a /pseudo " +
+ "qualifier):\n");
+
+ buffer.append (" count: " + pseudo_gene_count + "\n");
+ buffer.append (" bases: " + pseudo_gene_bases_count + "\n");
+ buffer.append (" average length: " +
+ pseudo_gene_bases_count / pseudo_gene_count + "\n\n");
+ }
+
+ if (pseudo_gene_count > 0) {
+ buffer.append ("All CDS features:\n");
+
+ buffer.append (" count: " + cds_count + "\n");
+ buffer.append (" bases: " + cds_bases_count + "\n");
+ buffer.append (" average length: " +
+ cds_bases_count / cds_count + "\n\n");
+ }
+ }
+
+ final Strand strand;
+
+ if (strand_flag == FORWARD || strand_flag == BOTH) {
+ strand = entry_group.getBases ().getForwardStrand ();
+ } else {
+ strand = entry_group.getBases ().getReverseStrand ();
+ }
+
+ final StringVector base_summary =
+ SelectionViewer.getBaseSummary (strand.getStrandBases ());
+
+ buffer.append ("\nOverall sequence composition:\n\n");
+
+ for (int i = 0 ; i < base_summary.size () ; ++i) {
+ buffer.append (base_summary.elementAt (i)).append ("\n");
+ }
+
+ buffer.append ("\nSummary of the active entries:\n");
+
+ final Enumeration e = table.keys ();
+
+ while (e.hasMoreElements()) {
+ final String this_key = (String) e.nextElement();
+ final Hashtable colour_table = (Hashtable) table.get (this_key);
+
+ buffer.append (this_key + ": ");
+
+ final StringBuffer colour_string = new StringBuffer ();
+
+ final Enumeration colour_enum = colour_table.keys ();
+
+ int total = 0;
+
+ while (colour_enum.hasMoreElements()) {
+ final String this_colour = (String) colour_enum.nextElement();
+
+ final int colour_count =
+ ((Integer) colour_table.get (this_colour)).intValue ();
+
+ total += colour_count;
+
+ final String end_string;
+
+ if (this_colour.equals ("no colour")) {
+ end_string = "no colour";
+ } else {
+ end_string = "colour: " + this_colour;
+ }
+
+ if (colour_count == 1) {
+ colour_string.append (" one has " + end_string + "\n");
+ } else {
+ colour_string.append (" " + colour_count + " have " +
+ end_string + "\n");
+ }
+ }
+
+ buffer.append (total + "\n");
+
+ buffer.append (colour_string);
+ }
+
+ file_viewer.setText (buffer.toString ());
+ }
+
+ /**
+ * This is the EntryGroup object that we are viewing.
+ **/
+ private EntryGroup entry_group;
+
+ /**
+ * The strand indicator that was passed to the constructor.
+ **/
+ private int strand_flag;
+
+ /**
+ * The FileViewer object that is displaying the EntryGroup.
+ **/
+ private FileViewer file_viewer;
+
+ /**
+ * The Frame that was passed to the constructor.
+ **/
+ private JFrame parent_frame;
+}
diff --git a/uk/ac/sanger/artemis/components/EntryGroupMenu.java b/uk/ac/sanger/artemis/components/EntryGroupMenu.java
new file mode 100644
index 000000000..5e02cbbd5
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/EntryGroupMenu.java
@@ -0,0 +1,336 @@
+/* EntryGroupMenu.java
+ *
+ * created: Fri Aug 27 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/EntryGroupMenu.java,v 1.1 2004-06-09 09:46:31 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import java.util.*;
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * A menu containing the current entries in an EntryGroup.
+ *
+ * @author Kim Rutherford
+ * @version $Id: EntryGroupMenu.java,v 1.1 2004-06-09 09:46:31 tjc Exp $
+ **/
+
+public class EntryGroupMenu extends JMenu
+ implements EntryGroupChangeListener, EntryChangeListener {
+ /**
+ * Create a new EntryGroupMenu object that will show the entries in the
+ * given EntryGroup.
+ * @param frame The JFrame that owns this JMenu.
+ * @param entry_group The EntryGroup object to display.
+ * @param menu_name The name of the new menu.
+ **/
+ public EntryGroupMenu (final JFrame frame,
+ final EntryGroup entry_group,
+ final String menu_name) {
+ super (menu_name);
+
+ this.frame = frame;
+ this.entry_group = entry_group;
+
+ entry_group.addEntryGroupChangeListener (this);
+ entry_group.addEntryChangeListener (this);
+
+ refreshMenu ();
+ }
+
+ /**
+ * Create a new EntryGroupMenu object that will show the entries in the
+ * given EntryGroup.
+ * @param frame The JFrame that owns this JMenu.
+ * @param entry_group The EntryGroup object to display.
+ **/
+ public EntryGroupMenu (final JFrame frame,
+ final EntryGroup entry_group) {
+ this (frame, entry_group, "Entries");
+ }
+
+ /**
+ * Implementation of the EntryGroupChangeListener interface. We listen to
+ * EntryGroupChange events so that we can update the display if entries
+ * are added or deleted.
+ **/
+ public void entryGroupChanged (final EntryGroupChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryGroupChangeEvent.ENTRY_ADDED:
+ case EntryGroupChangeEvent.ENTRY_DELETED:
+ case EntryGroupChangeEvent.ENTRY_INACTIVE:
+ case EntryGroupChangeEvent.ENTRY_ACTIVE:
+ case EntryGroupChangeEvent.NEW_DEFAULT_ENTRY:
+ refreshMenu ();
+ break;
+ }
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface.
+ **/
+ public void entryChanged (final EntryChangeEvent event) {
+ if (event.getType () == EntryChangeEvent.NAME_CHANGED) {
+ refreshMenu ();
+ }
+ }
+
+ /**
+ * Update the menus to the reflect the current contents of the EntryGroup.
+ **/
+ private void refreshMenu () {
+ removeAll ();
+
+ if (entry_group == null || entry_group.size () == 0) {
+ add (new JMenuItem ("(No Entries Currently)"));
+ return;
+ }
+
+ final JMenu set_entry_name_menu = new JMenu ("Set Name Of Entry");
+
+ add (set_entry_name_menu);
+
+ final JMenu set_default_menu = new JMenu ("Set Default Entry");
+ final JMenu delete_entry_menu = new JMenu ("Remove An Entry");
+
+ addSeparator ();
+
+ add (set_default_menu);
+ add (delete_entry_menu);
+
+ final JMenuItem delete_active_entries_menu =
+ new JMenuItem ("Remove Active Entries");
+
+ delete_active_entries_menu.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ deleteActiveEntries ();
+ }
+ });
+
+ add (delete_active_entries_menu);
+
+ final JMenuItem deactivate_all = new JMenuItem ("Deactivate All Entries");
+
+ deactivate_all.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ for (int i = 0 ; i < entry_group.size () ; ++i) {
+ final Entry this_entry = entry_group.elementAt (i);
+
+ entry_group.setIsActive (this_entry, false);
+ }
+ }
+ });
+
+ add (deactivate_all);
+
+ entry_components = new Vector ();
+
+ addSeparator ();
+
+ for (int i = 0 ; i < entry_group.size () ; ++i) {
+ final Entry this_entry = entry_group.elementAt (i);
+
+ String entry_name = this_entry.getName ();
+
+ if (entry_name == null) {
+ entry_name = "no name";
+ }
+
+ final JMenuItem set_entry_name_item = new JMenuItem (entry_name);
+ set_entry_name_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ setEntryName (this_entry);
+ }
+ });
+
+ set_entry_name_menu.add (set_entry_name_item);
+
+ final JMenuItem delete_entry_item = new JMenuItem (entry_name);
+ delete_entry_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ if (this_entry.hasUnsavedChanges ()) {
+ final String message;
+
+ if (this_entry.getName () != null) {
+ message = "there are unsaved changes in " +
+ this_entry.getName () + " - really remove?";
+ } else {
+ message = "there are unsaved changes in entry #" +
+ entry_group.indexOf (this_entry) + " - really remove?";
+ }
+
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog (frame, message);
+
+ if (!yes_no_dialog.getResult ()) {
+ return;
+ }
+ }
+ entry_group.remove (this_entry);
+ }
+ });
+
+ delete_entry_menu.add (delete_entry_item);
+
+ final JMenuItem set_default_entry_item = new JMenuItem (entry_name);
+ set_default_entry_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ entry_group.setDefaultEntry (this_entry);
+ }
+ });
+
+ set_default_menu.add (set_default_entry_item);
+
+ add (entry_group.elementAt (i));
+ }
+ }
+
+ /**
+ * Add a Label or Checkbox for the given Entry to this component.
+ **/
+ private void add (final Entry entry) {
+ String entry_name = entry.getName ();
+
+ if (entry_name == null) {
+ entry_name = "no name";
+ }
+
+ if (entry_group.getDefaultEntry () == entry) {
+ entry_name = entry_name + " (default entry)";
+ }
+
+ final JCheckBoxMenuItem new_component =
+ new JCheckBoxMenuItem (entry_name, entry_group.isActive (entry));
+
+ new_component.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent event) {
+ final int button_index =
+ entry_components.indexOf (event.getSource ());
+
+ if (event.getStateChange () == ItemEvent.SELECTED) {
+ entry_group.setIsActive (button_index, true);
+ } else {
+ entry_group.setIsActive (button_index, false);
+ }
+ }
+ });
+
+ entry_components.addElement (new_component);
+ add (new_component);
+ }
+
+ /**
+ * Create a new TextRequester component and set the name of the default
+ * Entry to whatever the user types.
+ **/
+ private void setEntryName (final Entry entry) {
+ final TextRequester text_requester =
+ new TextRequester ("New name for the entry?", 18, "");
+
+ text_requester.addTextRequesterListener (new TextRequesterListener () {
+ public void actionPerformed (final TextRequesterEvent event) {
+ if (event.getType () == TextRequesterEvent.CANCEL) {
+ return;
+ }
+
+ final String requester_text = event.getRequesterText ().trim ();
+ if (requester_text.length () > 0) {
+ if (entry.setName (requester_text)) {
+ // it worked
+ } else {
+ new MessageDialog (frame,
+ "could not set the name of the default entry");
+ }
+ }
+ }
+ });
+
+ text_requester.show ();
+ }
+
+ /**
+ * Delete the active entries after asking the user.
+ **/
+ private void deleteActiveEntries () {
+ if (Options.getOptions ().isNoddyMode ()) {
+ final YesNoDialog dialog =
+ new YesNoDialog (frame,
+ "Are you sure you want to remove the " +
+ "active entries?");
+
+ if (!dialog.getResult ()) {
+ return;
+ }
+ }
+
+ for (int i = entry_group.size () - 1 ; i >= 0 ; --i) {
+ final Entry this_entry = entry_group.elementAt (i);
+
+ if (this_entry.hasUnsavedChanges ()) {
+ final String message;
+
+ if (this_entry.getName () != null) {
+ message = "there are unsaved changes in " +
+ this_entry.getName () + " - really remove?";
+ } else {
+ message = "there are unsaved changes in entry #" +
+ (i + 1) + " - really remove?";
+ }
+
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog (frame, message);
+
+ if (!yes_no_dialog.getResult ()) {
+ continue;
+ }
+ }
+
+ if (entry_group.isActive (this_entry)) {
+ entry_group.remove (this_entry);
+ }
+ }
+ }
+
+ /**
+ * A vector containing the Entry objects that this EntryEdit object knows
+ * about. This reference is obtained from owning_component.
+ **/
+ private EntryGroup entry_group;
+
+ /**
+ * A vector containing one Checkbox or Label for each Entry in the
+ * EntryGroup object.
+ **/
+ private Vector entry_components = new Vector ();
+
+ /**
+ * The JFrame reference that was passed to the constructor.
+ **/
+ private JFrame frame = null;
+}
+
diff --git a/uk/ac/sanger/artemis/components/EntryGroupPanel.java b/uk/ac/sanger/artemis/components/EntryGroupPanel.java
new file mode 100644
index 000000000..b846af6db
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/EntryGroupPanel.java
@@ -0,0 +1,376 @@
+/* EntryGroupPanel.java
+ *
+ * created: Wed Jun 21 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 2000,2001,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/EntryGroupPanel.java,v 1.1 2004-06-09 09:46:32 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import java.awt.*;
+import java.awt.event.*;
+import javax.swing.*;
+
+/**
+ * A JPanel that can show an EntryGroup(in some way).
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: EntryGroupPanel.java,v 1.1 2004-06-09 09:46:32 tjc Exp $
+ **/
+
+abstract public class EntryGroupPanel extends CanvasPanel
+{
+ /** shortcut for View FASTA in browser. */
+ final int fasta_in_browser_key = KeyEvent.VK_F;
+
+ /** shortcut for View FASTA. */
+ final int view_fasta_key = KeyEvent.VK_R;
+
+ /** shortcut for View BLASTP in browser. */
+ final int blastp_in_browser_key = KeyEvent.VK_B;
+
+ /** shortcut for View BLASTP. */
+ final int view_blastp_key = KeyEvent.VK_TAB;
+
+ /** EntryGroup this component is displaying */
+ private EntryGroup entry_group;
+
+ /**
+ * This is a reference to the Selection object that was passed to the
+ * constructor.
+ **/
+ private Selection selection;
+
+ /**
+ * This is a reference to the GotoEventSource object that was passed to the
+ * constructor.
+ **/
+ private GotoEventSource goto_event_source;
+
+ /**
+ * The BasePlotGroup object that was passed to the constructor.
+ **/
+ private BasePlotGroup base_plot_group;
+
+ /**
+ * Create a new EntryGroupPanel for the given EntryGroup.
+ * @param entry_group The EntryGroup that this component will display.
+ * @param selection The Selection object for this component. Selected
+ * objects will be highlighted.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public EntryGroupPanel(final EntryGroup entry_group,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final BasePlotGroup base_plot_group)
+ {
+ this.entry_group = entry_group;
+ this.selection = selection;
+ this.goto_event_source = goto_event_source;
+ this.base_plot_group = base_plot_group;
+
+ getCanvas().addKeyListener(new KeyAdapter()
+ {
+ public void keyPressed(final KeyEvent event)
+ {
+ handleKeyPress(event);
+ }
+ });
+ }
+
+ /**
+ * Return an object that implements the GotoEventSource interface and which
+ * is relative to the sequence that this DisplayComponent is displaying.
+ **/
+ public GotoEventSource getGotoEventSource()
+ {
+ return goto_event_source;
+ }
+
+ /**
+ * Walk up through parents of this JComponent and return the JFrame at the
+ * top.
+ **/
+ public JFrame getParentFrame()
+ {
+ Component parent = this.getParent();
+
+ while(parent != null && !(parent instanceof JFrame))
+ parent = parent.getParent();
+
+ return (JFrame)parent;
+ }
+
+ /**
+ * Return the EntryGroup object that this FeatureDisplay is displaying.
+ **/
+ public EntryGroup getEntryGroup()
+ {
+ return entry_group;
+ }
+
+ /**
+ * Returns the Selection that was passed to the constructor.
+ **/
+ public Selection getSelection()
+ {
+ return selection;
+ }
+
+ /**
+ * Returns the BasePlotGroup that was passed to the constructor.
+ **/
+ public BasePlotGroup getBasePlotGroup()
+ {
+ return base_plot_group;
+ }
+
+ /**
+ * This method sends an GotoEvent to all the GotoEvent listeners that will
+ * make the start of the first selected Feature or FeatureSegment visible.
+ **/
+ protected void makeSelectionVisible()
+ {
+ final Marker first_base = getSelection().getStartBaseOfSelection();
+
+ final GotoEvent new_event = new GotoEvent(this, first_base);
+
+ getGotoEventSource().sendGotoEvent(new_event);
+ }
+
+ /**
+ * Return true if and only if the given MouseEvent(a mouse press) should
+ * pop up a JPopupMenu.
+ **/
+ protected boolean isMenuTrigger(final MouseEvent event)
+ {
+ if(event.isPopupTrigger() ||
+ (event.getModifiers() & InputEvent.BUTTON3_MASK) != 0)
+ return true;
+ else
+ return false;
+ }
+
+ /**
+ * Handle key press events.
+ **/
+ private void handleKeyPress(final KeyEvent event)
+ {
+ // this is done so that menu shortcuts don't cause each action to be
+ // performed twice
+ if(!event.isShiftDown() && event.getModifiers() != 0)
+ return;
+
+ final FeatureVector selected_features = getSelection().getAllFeatures();
+
+ if(selected_features.size() == 0)
+ {
+ final MarkerRange marker_range = getSelection().getMarkerRange();
+
+ if(marker_range != null)
+ {
+ switch(event.getKeyCode())
+ {
+ case AddMenu.CREATE_FROM_BASE_RANGE_KEY_CODE:
+ AddMenu.createFeatureFromBaseRange(getParentFrame(),
+ getSelection(),
+ entry_group,
+ getGotoEventSource());
+ break;
+ }
+ }
+
+ }
+ else
+ {
+ final Feature first_selected_feature = selected_features.elementAt(0);
+
+ final int feature_index =
+ getEntryGroup().indexOf(first_selected_feature);
+
+ final int event_key_code = event.getKeyCode();
+
+ switch(event_key_code)
+ {
+ case KeyEvent.VK_UP:
+ case KeyEvent.VK_DOWN:
+ case KeyEvent.VK_LEFT:
+ case KeyEvent.VK_RIGHT:
+ {
+ if((event_key_code == KeyEvent.VK_LEFT ||
+ event_key_code == KeyEvent.VK_RIGHT) &&
+ !event.isShiftDown())
+ break;
+
+ final FeatureSegmentVector selected_segments =
+ getSelection().getSelectedSegments();
+
+ if(event.isShiftDown())
+ {
+ if(selected_segments.size() > 0)
+ {
+ final FeatureSegment selected_segment =
+ selected_segments.elementAt(0);
+
+ final Feature selected_segment_feature =
+ selected_segment.getFeature();
+
+ final FeatureSegmentVector feature_segments =
+ selected_segment_feature.getSegments();
+
+ final int segment_index =
+ feature_segments.indexOf(selected_segment);
+
+ if(event_key_code == KeyEvent.VK_UP ||
+ event_key_code == KeyEvent.VK_LEFT &&
+ !selected_segment_feature.isForwardFeature() ||
+ event_key_code == KeyEvent.VK_RIGHT &&
+ selected_segment_feature.isForwardFeature())
+ {
+ final int segment_count = feature_segments.size();
+ final int new_index = segment_index + 1;
+ if(segment_index < segment_count - 1)
+ selection.set(feature_segments.elementAt(new_index));
+ }
+ else
+ {
+ if(segment_index > 0)
+ {
+ final int new_index = segment_index - 1;
+ selection.set(feature_segments.elementAt(new_index));
+ }
+ }
+ }
+ }
+ else
+ {
+ if(event_key_code == KeyEvent.VK_DOWN)
+ {
+ if(feature_index <
+ getEntryGroup().getAllFeaturesCount() - 1)
+ {
+ selection.set(getEntryGroup().featureAt(feature_index + 1));
+ makeSelectionVisible();
+ }
+ }
+ else
+ {
+ if(feature_index > 0)
+ {
+ selection.set(getEntryGroup().featureAt(feature_index - 1));
+ makeSelectionVisible();
+ }
+ }
+ }
+ }
+ break;
+ case EditMenu.EDIT_FEATURES_KEY_CODE:
+ EditMenu.editSelectedFeatures(getParentFrame(),
+ getEntryGroup(),
+ getSelection(),
+ getGotoEventSource());
+ break;
+ case EditMenu.UNDO_KEY_CODE:
+ EditMenu.undo(getParentFrame(), getSelection(), getEntryGroup());
+ break;
+ case EditMenu.MERGE_FEATURES_KEY_CODE:
+ EditMenu.mergeFeatures(getParentFrame(), getSelection(),
+ getEntryGroup());
+ break;
+ case EditMenu.DUPLICATE_KEY_CODE:
+ EditMenu.duplicateFeatures(getParentFrame(), getSelection(),
+ getEntryGroup());
+ break;
+ case EditMenu.DELETE_FEATURES_KEY_CODE:
+ EditMenu.deleteSelectedFeatures(getParentFrame(), getSelection(),
+ getEntryGroup());
+ break;
+ case EditMenu.TRIM_FEATURES_KEY_CODE:
+ EditMenu.trimSelected(getParentFrame(), getSelection(),
+ getEntryGroup(), false, true);
+ break;
+ case EditMenu.TRIM_FEATURES_TO_NEXT_ANY_KEY_CODE:
+ EditMenu.trimSelected(getParentFrame(), getSelection(),
+ getEntryGroup(), true, true);
+ break;
+ case EditMenu.EXTEND_TO_PREVIOUS_STOP_CODON_KEY_CODE:
+ EditMenu.extendToORF(getParentFrame(), getSelection(),
+ getEntryGroup(), false);
+ break;
+ case AddMenu.CREATE_FROM_BASE_RANGE_KEY_CODE:
+ AddMenu.createFeatureFromBaseRange(getParentFrame(), getSelection(),
+ entry_group,
+ getGotoEventSource());
+ break;
+ case ViewMenu.VIEW_FEATURES_KEY_CODE:
+ ViewMenu.viewSelectedFeatures(getParentFrame(), getSelection());
+ break;
+ case ViewMenu.PLOT_FEATURES_KEY_CODE:
+ ViewMenu.plotSelectedFeatures(getParentFrame(), getSelection());
+ break;
+ case ViewMenu.OVERVIEW_KEY_CODE:
+ new EntryGroupInfoDisplay(getParentFrame(), entry_group);
+ break;
+ case ViewMenu.FASTA_IN_BROWSER_KEY_CODE:
+ viewResults("fasta", true);
+ break;
+ case ViewMenu.BLASTP_IN_BROWSER_KEY_CODE:
+ viewResults("blastp", true);
+ break;
+ case ViewMenu.VIEW_FASTA_KEY_CODE:
+ viewResults("fasta", false);
+ break;
+ case ViewMenu.VIEW_BLASTP_KEY_CODE:
+ viewResults("blastp", false);
+ break;
+ case ViewMenu.VIEW_HTH_KEY_CODE:
+ viewResults("hth", false);
+ break;
+ }
+ }
+ }
+
+ /**
+ * Show the output file from an external program (like fasta) for the
+ * selected Feature objects. The name of the file to read is stored in a
+ * feature qualifier. The qualifier used is the program name plus "_file".
+ * @param send_to_browser if true the results should be sent straight to
+ * the web browser rather than using a SearchResultViewer object.
+ **/
+ private void viewResults(final String program_name,
+ final boolean send_to_browser)
+ {
+ final boolean sanger_options =
+ Options.getOptions().getPropertyTruthValue("sanger_options");
+
+ if(sanger_options && send_to_browser)
+ ViewMenu.viewExternalResults(getParentFrame(), getSelection(),
+ program_name, true);
+ else
+ ViewMenu.viewExternalResults(getParentFrame(), getSelection(),
+ program_name, false);
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/EntryHeaderEdit.java b/uk/ac/sanger/artemis/components/EntryHeaderEdit.java
new file mode 100644
index 000000000..007460e96
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/EntryHeaderEdit.java
@@ -0,0 +1,209 @@
+/* EntryHeaderEdit.java
+ *
+ * created: Wed Jun 16 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/EntryHeaderEdit.java,v 1.1 2004-06-09 09:46:33 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import java.awt.*;
+import java.awt.event.*;
+import javax.swing.*;
+import javax.swing.event.*;
+import javax.swing.text.*;
+
+import java.io.*;
+
+/**
+ * Objects of this class are used to edit the header of an Entry.
+ *
+ * @author Kim Rutherford
+ * @version $Id: EntryHeaderEdit.java,v 1.1 2004-06-09 09:46:33 tjc Exp $
+ **/
+
+public class EntryHeaderEdit
+ implements EntryChangeListener, EntryGroupChangeListener,
+ DocumentListener {
+ /**
+ * Create a new EntryHeaderEdit object for the given Entry.
+ **/
+ public EntryHeaderEdit (final EntryGroup entry_group,
+ final Entry edit_entry) {
+
+ this.edit_entry = edit_entry;
+ this.entry_group = entry_group;
+
+ file_viewer = new FileViewer ("Artemis Entry Header Editor: " +
+ edit_entry.getName () == null ?
+ "" : edit_entry.getName ());
+
+ file_viewer.getContentPane ().add (error_text, "North");
+
+ readHeader ();
+
+ file_viewer.getTextArea ().setEditable (true);
+ file_viewer.getTextArea ().getDocument ().addDocumentListener (this);
+
+ getEntry ().addEntryChangeListener (this);
+ entry_group.addEntryGroupChangeListener (this);
+
+ file_viewer.addWindowListener (new WindowAdapter () {
+ public void windowClosed (WindowEvent event) {
+ stopListening ();
+ }
+ });
+ }
+
+
+ /**
+ * Remove this object as a feature and entry change listener.
+ **/
+ public void stopListening () {
+ getEntry ().removeEntryChangeListener (this);
+ entry_group.removeEntryGroupChangeListener (this);
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface. We listen to
+ * EntryChange events so we can update this component if the header changes
+ * for another reason.
+ **/
+ public void entryChanged (EntryChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryChangeEvent.HEADER_CHANGED:
+
+ if (event.getSource () == current_text) {
+ // don't bother with events from us
+ return;
+ }
+
+ // re-read the information from the entry
+ readHeader ();
+ break;
+ default:
+ // do nothing
+ break;
+ }
+ }
+
+ /**
+ * Implementation of the EntryGroupChangeListener interface. We listen to
+ * EntryGroupChange events so we can notify the user if of this component
+ * if the entry gets deleted.
+ **/
+ public void entryGroupChanged (final EntryGroupChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryGroupChangeEvent.ENTRY_DELETED:
+ if (event.getEntry () == edit_entry) {
+ stopListening ();
+ file_viewer.dispose ();
+ }
+ break;
+ default:
+ // do nothing
+ break;
+ }
+ }
+
+ public void changedUpdate(DocumentEvent e) {
+ textValueChanged ();
+ }
+ public void insertUpdate(DocumentEvent e) {
+ textValueChanged ();
+ }
+ public void removeUpdate(DocumentEvent e) {
+ textValueChanged ();
+ }
+
+ /**
+ * Implementation of the TextListener interface. When the text changes we
+ * update the Feature object that we are showing.
+ **/
+ public void textValueChanged () {
+ if (current_text.equals (file_viewer.getText ())) {
+ // the text hasn't really changed
+ return;
+ }
+
+ current_text = file_viewer.getText ();
+
+ try {
+ // ignore text change events while reading
+ edit_entry.setHeaderText (current_text);
+ error_text.setText ("");
+ } catch (uk.ac.sanger.artemis.io.ReadFormatException e) {
+ error_text.setText (e + (e.getLineNumber () > 1 ?
+ " at line: " + e.getLineNumber () :
+ ""));
+ } catch (java.io.IOException e) {
+ error_text.setText (e.toString ());
+ }
+ }
+
+ /**
+ * Read the header of edit_entry into this component.
+ **/
+ public void readHeader () {
+ final String header = edit_entry.getHeaderText ();
+
+ if (header != null) {
+ file_viewer.setText (header);
+
+ current_text = file_viewer.getText ();
+ }
+ }
+
+ /**
+ * Return the Entry that this object is displaying.
+ **/
+ private Entry getEntry () {
+ return edit_entry;
+ }
+
+ /**
+ * The EntryGroup that passed to the constructor.
+ **/
+ private EntryGroup entry_group;
+
+ /**
+ * The Entry that contains the Feature this object is displaying.
+ **/
+ private Entry edit_entry;
+
+ /**
+ * The FileViewer object that is displaying the feature.
+ **/
+ private FileViewer file_viewer;
+
+ /**
+ * The text version of the Feature we are currently displaying.
+ **/
+ private String current_text = "";
+
+ /**
+ * A Label for showing errors and messages.
+ **/
+ private JLabel error_text = new JLabel ("");
+}
+
diff --git a/uk/ac/sanger/artemis/components/ExternalProgramOptions.java b/uk/ac/sanger/artemis/components/ExternalProgramOptions.java
new file mode 100644
index 000000000..01714cbb0
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ExternalProgramOptions.java
@@ -0,0 +1,66 @@
+/* ExternalProgramOptions.java
+ *
+ * created: Mon Oct 4 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ExternalProgramOptions.java,v 1.1 2004-06-09 09:46:34 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import java.awt.*;
+
+/**
+ * This component allows the user to set the options of an ExternalProgram.
+ *
+ * @author Kim Rutherford
+ * @version $Id: ExternalProgramOptions.java,v 1.1 2004-06-09 09:46:34 tjc Exp $
+ **/
+
+public class ExternalProgramOptions {
+ /**
+ * Create a new ExternalProgramOptions object for the given
+ * ExternalProgram.
+ **/
+ public ExternalProgramOptions (final ExternalProgram external_program) {
+ if (external_program.getType () == ExternalProgram.AA_PROGRAM ||
+ external_program.getType () == ExternalProgram.DNA_PROGRAM) {
+
+ final TextRequester requester =
+ new TextRequester ("Options for " + external_program.getName () + ":",
+ 18, external_program.getProgramOptions ());
+
+ requester.addTextRequesterListener (new TextRequesterListener () {
+ public void actionPerformed (final TextRequesterEvent event) {
+ final String requester_text = event.getRequesterText ().trim ();
+ if (requester_text.length () > 0) {
+ external_program.setProgramOptions (requester_text);
+ }
+ }
+ });
+
+ requester.show ();
+ } else {
+ throw new Error ("internal error - please hit the programmer");
+ }
+ }
+}
diff --git a/uk/ac/sanger/artemis/components/FeatureAminoAcidViewer.java b/uk/ac/sanger/artemis/components/FeatureAminoAcidViewer.java
new file mode 100644
index 000000000..17f6a6586
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FeatureAminoAcidViewer.java
@@ -0,0 +1,172 @@
+/* FeatureAminoAcidViewer.java
+ *
+ * created: Sat Dec 19 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/FeatureAminoAcidViewer.java,v 1.1 2004-06-09 09:46:35 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import java.awt.event.*;
+
+/**
+ * A component for viewing the amino acids of a protein feature. Once
+ * created this component listens for FeatureChange events to keep the the
+ * sequence up to date.
+ *
+ * @author Kim Rutherford
+ * @version $Id: FeatureAminoAcidViewer.java,v 1.1 2004-06-09 09:46:35 tjc Exp $
+ **/
+
+public class FeatureAminoAcidViewer
+ implements EntryChangeListener, FeatureChangeListener {
+ /**
+ * Create a new FeatureAminoAcidViewer component to display the amino acids
+ * of the given Feature.
+ * @param feature The feature to view.
+ * @param include_numbers If true then the amino acids will be numbered
+ * (every second line of the display will be numbers rather than
+ * sequence).
+ **/
+ public FeatureAminoAcidViewer (final Feature feature,
+ final boolean include_numbers) {
+ this.feature = feature;
+ this.entry = feature.getEntry ();
+ this.include_numbers = include_numbers;
+
+ sequence_viewer =
+ new SequenceViewer ("Feature base viewer for feature:" +
+ getFeature ().getIDString (), include_numbers);
+
+ redisplay ();
+
+ getFeature ().getEntry ().addEntryChangeListener (this);
+ getFeature ().addFeatureChangeListener (this);
+
+ sequence_viewer.addWindowListener (new WindowAdapter () {
+ public void windowClosed (WindowEvent event) {
+ stopListening ();
+ }
+ });
+ }
+
+ /**
+ * Remove this object as a entry and feature change listener.
+ **/
+ private void stopListening () {
+ getEntry ().removeEntryChangeListener (this);
+ getFeature ().removeFeatureChangeListener (this);
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface. We listen to
+ * EntryChange events so we can delete this component if the feature gets
+ * deleted.
+ **/
+ public void entryChanged (EntryChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryChangeEvent.FEATURE_DELETED:
+ if (event.getFeature () == getFeature ()) {
+ stopListening ();
+ sequence_viewer.dispose ();
+ }
+ break;
+ default:
+ // do nothing;
+ break;
+ }
+ }
+ /**
+ * Implementation of the FeatureChangeListener interface. We need to
+ * listen to feature change events from the Features in this object so that
+ * we can keep the display up to date.
+ * @param event The change event.
+ **/
+ public void featureChanged (FeatureChangeEvent event) {
+// System.out.println ("FeatureViewer: feature change event type: " +
+// event.getType ());
+
+ // re-read the information from the feature
+ redisplay ();
+ }
+
+ /**
+ * Redisplay the amino acids.
+ **/
+ private void redisplay () {
+ String small_note = getFeature ().getNote ();
+
+ if (small_note == null) {
+ small_note = getFeature ().getIDString ();
+ } else {
+ if (small_note.length () > 50) {
+ small_note = small_note.substring (0, 50);
+ }
+ }
+
+ final String comment = ">" + small_note + " - " +
+ getFeature ().getFirstBase () + ": " +
+ getFeature ().getLastBase () + " MW: " +
+ getFeature ().getMolecularWeight ();
+
+ final String sequence =
+ getFeature ().getTranslation ().toString ().toUpperCase ();
+
+ sequence_viewer.setSequence (comment, sequence);
+ }
+
+
+ /**
+ * Return the feature this component is showing information about.
+ **/
+ private Feature getFeature () {
+ return feature;
+ }
+
+ /**
+ * Return the Entry that contains the Feature this object is displaying.
+ **/
+ private Entry getEntry () {
+ return entry;
+ }
+
+ /**
+ * The Feature that this component is showing information about.
+ **/
+ private Feature feature = null;
+
+ /**
+ * The SequenceViewer object that is displaying the feature bases.
+ **/
+ private SequenceViewer sequence_viewer;
+
+ /**
+ * The Entry that contains the Feature this object is displaying.
+ **/
+ private Entry entry;
+
+ /**
+ * If true then the amino acids will be numbered (every second line of the
+ * display will be numbers rather than sequence).
+ **/
+ private final boolean include_numbers;
+}
diff --git a/uk/ac/sanger/artemis/components/FeatureBaseViewer.java b/uk/ac/sanger/artemis/components/FeatureBaseViewer.java
new file mode 100644
index 000000000..929377d56
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FeatureBaseViewer.java
@@ -0,0 +1,166 @@
+/* FeatureBaseViewer.java
+ *
+ * created: Sat Dec 19 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/FeatureBaseViewer.java,v 1.1 2004-06-09 09:46:36 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import java.awt.event.*;
+
+/**
+ * A component for viewing the bases of a feature. Once created this
+ * component listens for FeatureChange events to keep the the sequence up to
+ * date.
+ *
+ * @author Kim Rutherford
+ * @version $Id: FeatureBaseViewer.java,v 1.1 2004-06-09 09:46:36 tjc Exp $
+ **/
+
+public class FeatureBaseViewer
+ implements EntryChangeListener, FeatureChangeListener {
+ /**
+ * Create a new FeatureBaseViewer component to display the bases of the
+ * given Feature.
+ * @param feature The feature to view.
+ * @param include_numbers If true then the sequence will be numbered
+ * (every second line of the display will be numbers rather than
+ * sequence).
+ **/
+ public FeatureBaseViewer (final Feature feature,
+ final boolean include_numbers) {
+ this.feature = feature;
+ this.entry = feature.getEntry ();
+ this.include_numbers = include_numbers;
+
+ sequence_viewer =
+ new SequenceViewer ("Feature base viewer for feature:" +
+ getFeature ().getIDString (), include_numbers);
+
+ redisplay ();
+
+ getFeature ().getEntry ().addEntryChangeListener (this);
+ getFeature ().addFeatureChangeListener (this);
+
+ sequence_viewer.addWindowListener (new WindowAdapter () {
+ public void windowClosed (WindowEvent event) {
+ stopListening ();
+ }
+ });
+ }
+
+ /**
+ * Remove this object as a entry and feature change listener.
+ **/
+ private void stopListening () {
+ getEntry ().removeEntryChangeListener (this);
+ getFeature ().removeFeatureChangeListener (this);
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface. We listen to
+ * EntryChange events so we can delete this component if the feature gets
+ * deleted.
+ **/
+ public void entryChanged (EntryChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryChangeEvent.FEATURE_DELETED:
+ if (event.getFeature () == getFeature ()) {
+ stopListening ();
+ sequence_viewer.dispose ();
+ }
+ break;
+ default:
+ // do nothing;
+ break;
+ }
+ }
+
+ /**
+ * Implementation of the FeatureChangeListener interface. We need to
+ * listen to feature change events from the Features in this object so that
+ * we can keep the display up to date.
+ * @param event The change event.
+ **/
+ public void featureChanged (FeatureChangeEvent event) {
+ // re-read the information from the feature
+ redisplay ();
+ }
+
+ /**
+ * Redisplay the bases.
+ **/
+ private void redisplay () {
+ String small_note = getFeature ().getNote ();
+
+ if (small_note == null) {
+ small_note = "";
+ } else {
+ if (small_note.length () > 50) {
+ small_note = small_note.substring (0, 50);
+ }
+ }
+
+ final String comment = ">" + small_note + " - " +
+ getFeature ().getFirstBase () + ": " +
+ getFeature ().getLastBase ();
+
+ final String bases = getFeature ().getBases ().toUpperCase ();
+ sequence_viewer.setSequence (comment, bases);
+ }
+
+ /**
+ * Return the feature this component is showing information about.
+ **/
+ private Feature getFeature () {
+ return feature;
+ }
+
+ /**
+ * Return the Entry that contains the Feature this object is displaying.
+ **/
+ private Entry getEntry () {
+ return entry;
+ }
+
+ /**
+ * The Feature that this component is showing information about.
+ **/
+ private Feature feature = null;
+
+ /**
+ * The SequenceViewer object that is displaying the feature bases.
+ **/
+ private SequenceViewer sequence_viewer;
+
+ /**
+ * The Entry that contains the Feature this object is displaying.
+ **/
+ private Entry entry;
+
+ /**
+ * If true then the amino acids will be numbered (every second line of the
+ * display will be numbers rather than sequence).
+ **/
+ private final boolean include_numbers;
+}
diff --git a/uk/ac/sanger/artemis/components/FeatureDisplay.java b/uk/ac/sanger/artemis/components/FeatureDisplay.java
new file mode 100644
index 000000000..db5a79546
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FeatureDisplay.java
@@ -0,0 +1,4699 @@
+/* FeatureDisplay.java
+ *
+ * created: Fri Oct 9 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 1998,1999,2000,2001,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/FeatureDisplay.java,v 1.1 2004-06-09 09:46:37 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.util.OutOfRangeException;
+import uk.ac.sanger.artemis.util.StringVector;
+import uk.ac.sanger.artemis.io.Range;
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import java.awt.event.*;
+import java.awt.*;
+import java.lang.Math;
+import java.util.Vector;
+import java.util.Comparator;
+
+import javax.swing.JScrollBar;
+import javax.swing.JComponent;
+
+/**
+ * This component is used for displaying an Entry.
+ *
+ * @author Kim Rutherford
+ * @version $Id: FeatureDisplay.java,v 1.1 2004-06-09 09:46:37 tjc Exp $
+ **/
+
+public class FeatureDisplay extends EntryGroupPanel
+ implements EntryGroupChangeListener,
+ EntryChangeListener, FeatureChangeListener,
+ SelectionChangeListener, GotoListener, SequenceChangeListener,
+ DisplayComponent, OptionChangeListener, DisplayAdjustmentListener
+{
+
+ /** Key code for calling zoomToSelection(). */
+ final static public int ZOOM_TO_SELECTION_KEY = KeyEvent.VK_Z;
+
+ final static public int SCROLLBAR_AT_TOP = 1;
+ final static public int SCROLLBAR_AT_BOTTOM = 2;
+ final static public int NO_SCROLLBAR = 3;
+
+ public final static int FORWARD = Bases.FORWARD;
+ public final static int REVERSE = Bases.REVERSE;
+
+ public final static int NO_FRAME = FeatureSegment.NO_FRAME;
+ public final static int FORWARD_STRAND = FeatureSegment.FORWARD_STRAND;
+ public final static int REVERSE_STRAND = FeatureSegment.REVERSE_STRAND;
+ public final static int FORWARD_FRAME_1 = FeatureSegment.FORWARD_FRAME_1;
+ public final static int FORWARD_FRAME_2 = FeatureSegment.FORWARD_FRAME_2;
+ public final static int FORWARD_FRAME_3 = FeatureSegment.FORWARD_FRAME_3;
+ public final static int REVERSE_FRAME_3 = FeatureSegment.REVERSE_FRAME_3;
+ public final static int REVERSE_FRAME_2 = FeatureSegment.REVERSE_FRAME_2;
+ public final static int REVERSE_FRAME_1 = FeatureSegment.REVERSE_FRAME_1;
+ public final static int SCALE_LINE = FeatureSegment.SCALE_LINE;
+
+
+ /**
+ * The JScrollBar for this FeatureDisplay object. We create the scrollbar
+ * as part of this object rather than in the EntryEdit component because we
+ * may need to change the parameters of the scrollbar later.
+ **/
+ private JScrollBar scrollbar = null;
+
+ /** A scroll bar for changing the viewing scale. */
+ private JScrollBar scale_changer = null;
+
+ /** Used to colour the frames. */
+ private Color light_grey = new Color(240, 240, 240);
+
+ /** Used to colour sequence line. */
+ private Color not_so_light_grey = new Color(200, 200, 200);
+
+ /**
+ * The colour used for the active entry line when
+ * one_line_per_entry is set.
+ **/
+ private Color active_entry_colour = new Color(255, 255, 140);
+
+ /**
+ * This Vector containing the references of those features that are
+ * currently visible.
+ **/
+ private FeatureVector visible_features = new FeatureVector();
+
+ /**
+ * If true updateVisibleFeatureVector() will be called by paint().
+ * updateVisibleFeatureVector() sets this to false,
+ * needVisibleFeatureVectorUpdate() sets this to true.
+ **/
+ private boolean update_visible_features = true;
+
+ /** Contains those objects listening for adjustment events. */
+ final private Vector adjustment_listener_list = new Vector();
+
+ /**
+ * The index of the first base that we are displaying.
+ * Can be negative if hard_left_edge is true.
+ **/
+ private int left_edge_base = 1;
+
+ /** See getScaleFactor(). */
+ private int scale_factor = 3;
+
+ /** See getScaleFactor(). */
+ private float scale_value = 1;
+
+ /** true if labels should be shown. */
+ private boolean show_labels = true;
+
+ /**
+ * This variable is true if the forward frame lines(or forward entry lines
+ * - see one_line_per_entry) should be drawn.
+ **/
+ private boolean show_forward_lines = true;
+
+ /**
+ * This variable is true if the reverse frame lines(or reverse entry lines
+ * - see one_line_per_entry) should be drawn.
+ **/
+ private boolean show_reverse_lines = true;
+
+ /**
+ * If true draw all features, sequence and scale lines reverse complemented.
+ **/
+ private boolean rev_comp_display = false;
+
+ /**
+ * This variable is true if(for each strand) each entry should be on a
+ * separate line.
+ **/
+ private boolean one_line_per_entry = false;
+
+ /**
+ * If true the there will never be a gap between the left edge of the
+ * screen and the first visible base.
+ **/
+ private boolean hard_left_edge = true;
+
+ /** true if source features should be shown. */
+ private boolean show_source_features = false;
+
+ /** true if stop codons should be shown. */
+ private boolean show_stop_codons = true;
+
+ /** true if start codons should be shown. */
+ private boolean show_start_codons = false;
+
+ /** true if directional arrows should be shown on features. */
+ private boolean show_feature_arrows;
+
+ /** true a black border will be drawn around each feature. */
+ private boolean show_feature_borders;
+
+ /**
+ * This variable is true if each base should be drawn in a different colour
+ * at scale feature 1.
+ **/
+ private boolean show_base_colours = false;
+
+ /**
+ * All features(not just CDS features) will be drawn on the frame lines if
+ * and only if this variable is true. See setFrameFeaturesFlag() and
+ * getFrameFeaturesFlag().
+ **/
+ private boolean frame_features_flag = false;
+
+ /**
+ * The position(s) of the last mouse click on the dna line. The
+ * MarkerRange contains a reference to the appropriate Strand and contains
+ * the base positions. See getMarkerRangeFromPosition() to understand why
+ * one click can give multiple bases.
+ **/
+ private MarkerRange click_range = null;
+
+ /**
+ * The last(FeatureSegment) Marker that the user clicked on. This is used
+ * for dragging the ends of segments.
+ **/
+ private Marker click_segment_marker = null;
+
+ /**
+ * This is true if click_segment_marker is the Marker at the start of
+ * segment false otherwise. The value is only useful if
+ * click_segment_marker is set.
+ **/
+ private boolean click_segment_marker_is_start_marker = false;
+
+ /**
+ * When a FeatureSegment Marker drag starts, this is set to the Marker at
+ * the other end of the segment. This is used to check that the drag has
+ * not move the Marker too far(past the end of the segment).
+ **/
+ private Marker other_end_of_segment_marker = null;
+
+ /**
+ * Features with a /score qualifier less than this value will not be shown.
+ **/
+ private int current_min_score = 0;
+
+ /**
+ * Features with a /score qualifier greater than this value will not be
+ * shown.
+ **/
+ private int current_max_score = 100;
+
+ private MouseEvent last_mouse_press_event;
+
+ /**
+ * If set no DisplayAdjustment events will be sent. This is set by
+ * displayAdjustmentValueChanged() to prevent an event we send from
+ * returning to us(a FeatureDisplay can listen for DisplayAdjustment
+ * events from another FeatureDisplay).
+ **/
+ private boolean disable_display_events = false;
+
+ /**
+ * Set to true by selectionChanged() to tell updateVisibleFeatureVector()
+ * to raise the contents of the select before updating.
+ **/
+ private boolean raise_selection_flag = false;
+
+ /** the minimum distance in pixels between the labels. */
+ private final static int MINIMUM_LABEL_SPACING = 80;
+
+ /** colour used for A. */
+ private static Color dark_green = new Color(0, 150, 0);
+
+ /**
+ * Used by drawOneLetter() - declared here so that we we don't need to
+ * allocated a whole array each time drawOneLetter() is called.
+ **/
+ private final char [] draw_one_char_temp_array = new char [1];
+
+
+ /**
+ * Create a new FeatureDisplay object with the horizontal scrollbar at the
+ * bottom of the component.
+ * @param entry_group The EntryGroup that this component will display.
+ * @param selection The Selection object for this component. Selected
+ * objects will be highlighted.
+ * @param goto_event_source The object to use when we need to call
+ * gotoBase().
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public FeatureDisplay(final EntryGroup entry_group,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final BasePlotGroup base_plot_group)
+ {
+ this(entry_group, selection, goto_event_source,
+ base_plot_group, SCROLLBAR_AT_BOTTOM);
+ }
+
+ /**
+ * Create a new FeatureDisplay object.
+ * @param entry_group The EntryGroup that this component will display.
+ * @param owning_component The EntryEdit object that contains the selection
+ * that this component uses.
+ * @param scrollbar_at_top If true the horizontal scrollbar will be at the
+ * top of component.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ * @param scrollbar_style Controls the type of horizontal scrollbar. Must
+ * be one of SCROLLBAR_AT_TOP, SCROLLBAR_AT_BOTTOM or NO_SCROLLBAR.
+ **/
+ public FeatureDisplay(final EntryGroup entry_group,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final BasePlotGroup base_plot_group,
+ final int scrollbar_style)
+ {
+ super(entry_group, selection, goto_event_source, base_plot_group);
+
+ show_feature_arrows =
+ Options.getOptions().getPropertyTruthValue("draw_feature_arrows");
+
+ show_feature_borders =
+ Options.getOptions().getPropertyTruthValue("draw_feature_borders");
+
+ frame_features_flag =
+ Options.getOptions().getPropertyTruthValue("features_on_frame_lines");
+
+ one_line_per_entry =
+ Options.getOptions().getPropertyTruthValue("one_line_per_entry");
+
+ show_labels =
+ Options.getOptions().getPropertyTruthValue("feature_labels");
+
+// getCanvas().addComponentListener(new ComponentAdapter()
+ addComponentListener(new ComponentAdapter()
+ {
+ public void componentResized(ComponentEvent e)
+ {
+ // update the scroll bar as soon as we know the size of the canvas
+ fixScrollbar();
+ needVisibleFeatureVectorUpdate();
+ fireAdjustmentEvent(DisplayAdjustmentEvent.ALL_CHANGE_ADJUST_EVENT);
+ }
+
+ public void componentShown(ComponentEvent e)
+ {
+ // update the scroll bar as soon as we know the size of the canvas
+ fixScrollbar();
+ needVisibleFeatureVectorUpdate();
+ fireAdjustmentEvent(DisplayAdjustmentEvent.ALL_CHANGE_ADJUST_EVENT);
+ }
+ });
+
+ setScaleValue();
+
+ if(scrollbar_style == SCROLLBAR_AT_TOP)
+ createScrollbar(true);
+ else
+ {
+ if(scrollbar_style == SCROLLBAR_AT_BOTTOM)
+ createScrollbar(false);
+ }
+
+ createScaleScrollbar();
+ fixCanvasSize();
+ fixScrollbar();
+ addListeners();
+
+ needVisibleFeatureVectorUpdate();
+
+ fireAdjustmentEvent(DisplayAdjustmentEvent.ALL_CHANGE_ADJUST_EVENT);
+
+ getSelection().addSelectionChangeListener(this);
+ getGotoEventSource().addGotoListener(this);
+
+ getEntryGroup().addEntryGroupChangeListener(this);
+ getEntryGroup().addEntryChangeListener(this);
+ getEntryGroup().addFeatureChangeListener(this);
+
+ getBases().addSequenceChangeListener(this, Bases.MIN_PRIORITY);
+
+ Options.getOptions().addOptionChangeListener(this);
+ }
+
+ /**
+ * Returns the value of a flag that indicates whether this component can be
+ * traversed using Tab or Shift-Tab keyboard focus traversal - returns true
+ * for FeatureDisplay components
+ **/
+// tjc - deprecated replaced by isFocusable().
+//public boolean isFocusTraversable()
+//{
+// return true;
+//}
+
+ /**
+ * Overriden to call fixCanvasSize()
+ **/
+ public void setVisible(final boolean visible)
+ {
+ super.setVisible(visible);
+ fixCanvasSize();
+ }
+
+ /**
+ * Set value of the show label flag.
+ * @param show_label Show labels if and only if this argument is true.
+ **/
+ public void setShowLabels(boolean show_labels)
+ {
+ if(this.show_labels != show_labels)
+ {
+ this.show_labels = show_labels;
+ fixCanvasSize();
+ }
+ }
+
+ /**
+ * Get the value of the "show label" flag.
+ **/
+ public boolean getShowLabels()
+ {
+ return show_labels;
+ }
+
+ /**
+ * Set value of the "show forward frame lines" flag.
+ * @param show_forward_lines Show forward frame lines if and only if
+ * this argument is true.
+ **/
+ public void setShowForwardFrameLines(boolean show_forward_lines)
+ {
+ if(this.show_forward_lines != show_forward_lines)
+ {
+ this.show_forward_lines = show_forward_lines;
+ fixCanvasSize();
+ }
+ }
+
+ /**
+ * Get the value of the "show forward frame lines" flag.
+ **/
+ public boolean getShowForwardFrameLines()
+ {
+ return show_forward_lines;
+ }
+
+ /**
+ * Set value of the "show reverse frame lines" flag.
+ * @param show_reverse_lines Show frame lines if and only if this
+ * argument is true.
+ **/
+ public void setShowReverseFrameLines(boolean show_reverse_lines)
+ {
+ if(this.show_reverse_lines != show_reverse_lines)
+ {
+ this.show_reverse_lines = show_reverse_lines;
+ fixCanvasSize();
+ }
+ }
+
+ /**
+ * Get the value of the "show source features" flag.
+ **/
+ public boolean getShowSourceFeatures()
+ {
+ return show_source_features;
+ }
+
+ /**
+ * Set value of the "show source features" flag.
+ * @param show_source_features Show features with a "source" key if and
+ * only if this argument is true.
+ **/
+ public void setShowSourceFeatures(boolean show_source_features)
+ {
+ if(this.show_source_features != show_source_features)
+ {
+ this.show_source_features = show_source_features;
+ needVisibleFeatureVectorUpdate();
+// getCanvas().repaint();
+ repaint();
+ }
+ }
+
+ /**
+ * Get the value of the "show frame lines" flag.
+ **/
+ public boolean getShowReverseFrameLines()
+ {
+ return show_reverse_lines;
+ }
+
+ /**
+ * Set value of the show base colours flag.
+ * @param show_base_colours At scale_factor less than two show each base in
+ * a different colour if and only if this argument is true.
+ **/
+ public void setShowBaseColours(boolean show_base_colours)
+ {
+ if(this.show_base_colours != show_base_colours)
+ {
+ this.show_base_colours = show_base_colours;
+ if(getScaleFactor() > 1)
+ setScaleFactor(1);
+// getCanvas().repaint();
+ repaint();
+ }
+ }
+
+ /**
+ * Get the value of the "show base colours" flag.
+ **/
+ public boolean getShowBaseColours()
+ {
+ return show_base_colours;
+ }
+
+ /**
+ * Set value of the "one line per entry" flag.
+ * @param one_line_per_entry If true then each entry will be shown on a
+ * different line, instead of showing frame lines.
+ **/
+ public void setOneLinePerEntry(final boolean one_line_per_entry)
+ {
+ if(this.one_line_per_entry != one_line_per_entry)
+ {
+ this.one_line_per_entry = one_line_per_entry;
+ fixCanvasSize();
+ }
+ }
+
+ /**
+ * Get the value of the "one line per entry" flag.
+ **/
+ public boolean getOneLinePerEntryFlag()
+ {
+ return one_line_per_entry;
+ }
+
+ /**
+ * Set value of the "hard left edge" flag.
+ * @param hard_left_edge If true the there will never be a gap between the
+ * left edge of the screen and the first visible base. If false base one
+ * can be moved to the centre of the display.
+ **/
+ public void setHardLeftEdge(final boolean hard_left_edge)
+ {
+ if(this.hard_left_edge != hard_left_edge)
+ {
+ this.hard_left_edge = hard_left_edge;
+ if(hard_left_edge && getForwardBaseAtLeftEdge() < 1)
+ setFirstVisibleForwardBase(1);
+
+ fixScrollbar();
+ }
+ }
+
+ /**
+ * Get the value of the "hard left edge" flag.
+ **/
+ public boolean getHardLeftEdgeFlag()
+ {
+ return hard_left_edge;
+ }
+
+ /**
+ * Set value of the show stop codons flag.
+ * @param show_stop_codons Show stop codons if and only if this argument is
+ * true.
+ **/
+ public void setShowStopCodons(boolean show_stop_codons)
+ {
+ if(this.show_stop_codons != show_stop_codons)
+ {
+ this.show_stop_codons = show_stop_codons;
+ getCanvas().repaint();
+ }
+ }
+
+ /**
+ * Return the value of the "show stop codons" flag.
+ **/
+ public boolean getShowStopCodons()
+ {
+ return show_stop_codons;
+ }
+
+ /**
+ * Set value of the show start codons flag.
+ * @param show_start_codons Show start codons if and only if this argument
+ * is true.
+ **/
+ public void setShowStartCodons(boolean show_start_codons)
+ {
+ if(this.show_start_codons != show_start_codons)
+ {
+ this.show_start_codons = show_start_codons;
+ getCanvas().repaint();
+ }
+ }
+
+ /**
+ * Return the value of the "show start codons" flag.
+ **/
+ public boolean getShowStartCodons()
+ {
+ return show_start_codons;
+ }
+
+ /**
+ * Set value of the reverse complement display flag.
+ * @param show_start_codons Draw all features and sequence reverse
+ * complemented if and only if this argument is true.
+ **/
+ public void setRevCompDisplay(boolean rev_comp_display)
+ {
+ if(this.rev_comp_display != rev_comp_display)
+ {
+ this.rev_comp_display = rev_comp_display;
+ int remember_position = getCentreForwardBase();
+
+ // we want to keep the selection visible after the flip, so
+ // that will override the centre position
+ final Marker first_base_marker =
+ getSelection().getStartBaseOfSelection();
+
+ if(first_base_marker != null && baseVisible(first_base_marker))
+ remember_position = first_base_marker.getRawPosition();
+
+ final Marker last_base_marker =
+ getSelection().getStartBaseOfSelection();
+
+ if(last_base_marker != null && baseVisible(last_base_marker))
+ remember_position = last_base_marker.getRawPosition();
+
+ fireAdjustmentEvent(DisplayAdjustmentEvent.REV_COMP_EVENT);
+
+ makeBaseVisibleInternal(remember_position, isRevCompDisplay(), true);
+
+ needVisibleFeatureVectorUpdate();
+ fixScrollbar();
+ getCanvas().repaint();
+ }
+ }
+
+ /**
+ * Return the value of the "reverse complement display" flag.
+ **/
+ public boolean isRevCompDisplay()
+ {
+ return rev_comp_display;
+ }
+
+ /**
+ * Set value of the show feature arrows flag.
+ * @param show_feature_arrows Show directional arrows if and only if this
+ * argument is true.
+ **/
+ public void setShowFeatureArrows(boolean show_feature_arrows)
+ {
+ if(this.show_feature_arrows != show_feature_arrows)
+ {
+ this.show_feature_arrows = show_feature_arrows;
+ getCanvas().repaint();
+ }
+ }
+
+ /**
+ * Return the value of the "show feature arrows" flag.
+ **/
+ public boolean getShowFeatureArrows()
+ {
+ return show_feature_arrows;
+ }
+
+ /**
+ * Set value of the show feature borders flag.
+ * @param show_feature_borders Draw a border around each feature if and
+ * only if this argument is true.
+ **/
+ public void setShowFeatureBorders(boolean show_feature_borders)
+ {
+ if(this.show_feature_borders != show_feature_borders)
+ {
+ this.show_feature_borders = show_feature_borders;
+ getCanvas().repaint();
+ }
+ }
+
+ /**
+ * Return the value of the "show feature borders" flag.
+ **/
+ public boolean getShowFeatureBorders()
+ {
+ return show_feature_borders;
+ }
+
+ /**
+ * Set value of the show frame features flag.
+ * @param frame_features_flag All features(not just CDS features) will be
+ * drawn on the frame lines if and only if this argument is true.
+ **/
+ public void setFrameFeaturesFlag(boolean frame_features_flag)
+ {
+ if(this.frame_features_flag != frame_features_flag)
+ {
+ this.frame_features_flag = frame_features_flag;
+ getCanvas().repaint();
+ }
+ }
+
+ /**
+ * Return the value of the "show frame features" flag.
+ **/
+ public boolean getFrameFeaturesFlag()
+ {
+ return frame_features_flag;
+ }
+
+ /**
+ * Set the value of the minimum score for this FeatureDisplay - features
+ * that have a /score lower than this value are never shown.
+ **/
+ public void setMinimumScore(final int minimum_score)
+ {
+ current_min_score = minimum_score;
+ needVisibleFeatureVectorUpdate();
+ getCanvas().repaint();
+ }
+
+ /**
+ * Return the value of the minimum score for this FeatureDisplay - see
+ * setMinimumScore().
+ **/
+ public int getMinimumScore()
+ {
+ return current_min_score;
+ }
+
+ /**
+ * Set the value of the maximum score for this FeatureDisplay - features
+ * that have a /score higher than this value are never shown.
+ **/
+ public void setMaximumScore(final int maximum_score)
+ {
+ current_max_score = maximum_score;
+ needVisibleFeatureVectorUpdate();
+ getCanvas().repaint();
+ }
+
+ /**
+ * Return the value of the maximum score for this FeatureDisplay - see
+ * setMaximumScore().
+ **/
+ public int getMaximumScore()
+ {
+ return current_max_score;
+ }
+
+ /**
+ * Redraw this component. This method is public so that other classes can
+ * force an update. for example this is called when the options files is
+ * re-read.
+ **/
+ public void redisplay()
+ {
+ getCanvas().repaint();
+ }
+
+ /**
+ * Adds the specified event adjustment listener to receive adjustment
+ * change events from this object.
+ * @param l the event change listener.
+ **/
+ public void addDisplayAdjustmentListener(DisplayAdjustmentListener l)
+ {
+ adjustment_listener_list.addElement(l);
+ }
+
+ /**
+ * Removes the specified event listener so that it no longer receives
+ * adjustment change events from this object.
+ * @param l the event change listener.
+ **/
+ public void removeDisplayAdjustmentListener(DisplayAdjustmentListener l)
+ {
+ adjustment_listener_list.removeElement(l);
+ }
+
+ /**
+ * Handle key press events. This is static because making it non-static
+ * triggered a java.lang.VerifyError
+ **/
+ private static void handleKeyPress(final FeatureDisplay feature_display,
+ final KeyEvent event)
+ {
+ // this is done so that menu shortcuts don't cause each action to be
+ // performed twice
+ if(event.getModifiers() != 0)
+ return;
+
+ switch(event.getKeyCode())
+ {
+ case ZOOM_TO_SELECTION_KEY:
+ FeaturePopup.zoomToSelection(feature_display);
+ break;
+ default:
+ break;
+ }
+ }
+
+ /**
+ * Set the scale factor and update the display if the scale factor has
+ * changed. A factor of zero means the full translation will be visible.
+ * At higher scale factors only stop codons are visible, and a bigger
+ * number will mean more bases are visible.
+ **/
+ public void setScaleFactor(int scale_factor)
+ {
+ if(this.scale_factor != scale_factor)
+ {
+ // we will try to keep the base in the centre of the view to stay where
+ // it is, so we save it's position in remember_position.
+ int remember_position = getCentreForwardBase();
+
+ // if the first base is visible then keep it visible
+ if(hard_left_edge && getFirstVisibleForwardBase() == 1)
+ remember_position = 1;
+
+ if(!getSelection().isEmpty())
+ {
+ // but, we want to keep the selection visible after a scale change, so
+ // that will override the centre position
+ final Marker first_base_marker =
+ getSelection().getStartBaseOfSelection();
+
+ final int first_base_marker_raw_position =
+ first_base_marker.getRawPosition();
+ final int first_base_marker_position;
+
+ if(isRevCompDisplay())
+ first_base_marker_position =
+ getBases().getComplementPosition(first_base_marker_raw_position);
+ else
+ first_base_marker_position = first_base_marker_raw_position;
+
+ final Marker last_base_marker =
+ getSelection().getEndBaseOfSelection();
+
+ final int last_base_marker_raw_position =
+ last_base_marker.getRawPosition();
+
+ final int last_base_marker_position;
+
+ if(isRevCompDisplay())
+ last_base_marker_position =
+ getBases().getComplementPosition(last_base_marker_raw_position);
+ else
+ last_base_marker_position = last_base_marker_raw_position;
+
+ final int lowest_visible_base = getFirstVisibleForwardBase();
+ final int highest_visible_base = getLastVisibleForwardBase();
+
+ // first selected base or first visible base, whichever is greater
+ int restricted_first_selected_base = lowest_visible_base;
+
+ // last selected base or last visible base, whichever is smaller
+ int restricted_last_selected_base = highest_visible_base;
+
+ if(first_base_marker != null)
+ {
+ if(first_base_marker_position > lowest_visible_base &&
+ first_base_marker_position < highest_visible_base)
+ restricted_first_selected_base = first_base_marker_position;
+ }
+
+ if(last_base_marker != null)
+ {
+ if(last_base_marker_position < highest_visible_base &&
+ last_base_marker_position > lowest_visible_base)
+ restricted_last_selected_base = last_base_marker_position;
+ }
+
+ if(getSelection().getMarkerRange() == null)
+ remember_position = restricted_first_selected_base;
+ else
+ {
+ // keep the centre of the selection in the middle of the display if
+ // a range of bases is selected
+ remember_position = restricted_first_selected_base +
+ (restricted_last_selected_base -
+ restricted_first_selected_base) / 2;
+ }
+ }
+
+ this.scale_factor = scale_factor;
+
+ setScaleValue();
+ scale_changer.setValue(scale_factor);
+ setCentreVisibleForwardBase(remember_position);
+ fixScrollbar();
+ fireAdjustmentEvent(DisplayAdjustmentEvent.SCALE_ADJUST_EVENT);
+ needVisibleFeatureVectorUpdate();
+
+ getCanvas().repaint();
+ }
+ }
+
+ /**
+ * Implementation of the FeatureChangeListener interface. We listen to
+ * FeatureChange events so that we can update the display if qualifiers
+ * change.
+ **/
+ public void featureChanged(final FeatureChangeEvent event)
+ {
+ final Feature event_feature = event.getFeature();
+
+ // the feature isn't in an active entry
+ if(!getEntryGroup().contains(event_feature))
+ return;
+
+ // if the feature is visible now or is in the list of visible features
+ //(ie. it was visible previously) then redisplay.
+ if(featureVisible(event_feature) ||
+ getVisibleFeatures().contains(event_feature))
+ {
+ // update the visible_features vector
+ if(getVisibleFeatures().contains(event_feature) &&
+ !featureVisible(event_feature))
+ getVisibleFeatures().remove(event_feature);
+ else
+ {
+ // the visibility of the feature has changed
+ if(!getVisibleFeatures().contains(event_feature) &&
+ featureVisible(event_feature))
+ getVisibleFeatures().add(event_feature);
+ }
+
+ getCanvas().repaint();
+ }
+ }
+
+ /**
+ * Implementation of the EntryGroupChangeListener interface. We listen to
+ * EntryGroupChange events so that we can update the display if entries
+ * are added or deleted.
+ **/
+ public void entryGroupChanged(final EntryGroupChangeEvent event)
+ {
+ switch(event.getType())
+ {
+ case EntryGroupChangeEvent.ENTRY_ADDED:
+ case EntryGroupChangeEvent.ENTRY_ACTIVE:
+ case EntryGroupChangeEvent.ENTRY_DELETED:
+ case EntryGroupChangeEvent.ENTRY_INACTIVE:
+ if(getOneLinePerEntryFlag())
+ fixCanvasSize();
+
+ needVisibleFeatureVectorUpdate();
+ break;
+ }
+
+ getCanvas().repaint();
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface. We listen to
+ * EntryChange events so that we can update the display if features are
+ * added or deleted.
+ **/
+ public void entryChanged(final EntryChangeEvent event)
+ {
+ switch(event.getType())
+ {
+ case EntryChangeEvent.FEATURE_DELETED:
+ remove(event.getFeature());
+ break;
+ case EntryChangeEvent.FEATURE_ADDED:
+ add(event.getFeature());
+ break;
+ }
+ }
+
+ /**
+ * Implementation of the SelectionChangeListener interface. We listen to
+ * SelectionChange events so that we can update the list to reflect the
+ * current selection.
+ **/
+ public void selectionChanged(final SelectionChangeEvent event)
+ {
+ // don't bother with events we sent ourself
+ if(event.getSource() == this)
+ return;
+
+ needVisibleFeatureVectorUpdate();
+
+ if(event.getType() == SelectionChangeEvent.SELECTION_CHANGED)
+ raise_selection_flag = true;
+
+ getCanvas().repaint();
+ }
+
+ /**
+ * Implementation of the SequenceChangeListener interface.
+ **/
+ public void sequenceChanged(final SequenceChangeEvent event)
+ {
+ visible_features = new FeatureVector();
+
+ if(event.getType() == SequenceChangeEvent.REVERSE_COMPLEMENT)
+ {
+ final int old_centre_position = getCentreForwardBase();
+
+ final int new_centre_position =
+ getBases().getComplementPosition(old_centre_position);
+
+ makeBaseVisibleInternal(new_centre_position, true, false);
+ }
+ else
+ makeBaseVisibleInternal(event.getPosition(), true, false);
+
+ fixScrollbar();
+ needVisibleFeatureVectorUpdate();
+ getCanvas().repaint();
+
+ if(event.getType() == SequenceChangeEvent.REVERSE_COMPLEMENT)
+ fireAdjustmentEvent(DisplayAdjustmentEvent.REV_COMP_EVENT);
+ else
+ fireAdjustmentEvent(DisplayAdjustmentEvent.SCROLL_ADJUST_EVENT);
+ }
+
+ /**
+ * Invoked when an Option is changed.
+ **/
+ public void optionChanged(OptionChangeEvent event)
+ {
+ getCanvas().repaint();
+ }
+
+ /**
+ * Implementation of the GotoListener interface. Invoked when the listener
+ * should goto to the given base.
+ **/
+ public void performGoto(final GotoEvent event)
+ {
+ makeBaseVisible(event.getMarker());
+ }
+
+ /**
+ * Implementation of the DisplayAdjustmentListener interface. Invoked when
+ * a component(FeatureDisplay) scrolls or changes the scale. Set the
+ * position and scale of this FeatureDisplay to match the event
+ **/
+ public void displayAdjustmentValueChanged(DisplayAdjustmentEvent event)
+ {
+ disable_display_events = true;
+ try
+ {
+ setScaleFactor(event.getScaleFactor());
+ setFirstVisibleForwardBase(event.getStart());
+ }
+ finally
+ {
+ disable_display_events = false;
+ }
+ }
+
+ /**
+ * Return a MarkerRange that exactly covers the visible bases
+ **/
+ public MarkerRange getVisibleMarkerRange()
+ {
+ final int first_base = getFirstVisibleForwardBase();
+ final int last_base = getLastVisibleForwardBase();
+
+ final Strand strand = getBases().getForwardStrand();
+
+ try
+ {
+ return strand.makeMarkerRangeFromPositions(first_base, last_base);
+ }
+ catch(OutOfRangeException e)
+ {
+ throw new Error("internal error - unexpected exception: " + e);
+ }
+ }
+
+ /**
+ * Arrange for the given feature to be drawn last - ie. so that it will
+ * appear at the front of the other features.
+ **/
+ void raiseFeature(Feature feature)
+ {
+ if(getVisibleFeatures().remove(feature))
+ {
+ getVisibleFeatures().addElementAtEnd(feature);
+ getCanvas().repaint();
+ }
+ }
+
+ /**
+ * Arrange for the given feature to be drawn first - ie. so that it will
+ * appear at the back of the other features.
+ **/
+ void lowerFeature(Feature feature)
+ {
+ if(getVisibleFeatures().remove(feature))
+ {
+ getVisibleFeatures().insertElementAt(feature, 0);
+ getCanvas().repaint();
+ }
+ }
+
+ /**
+ * Redraw the display with the smallest features on top. Selected features
+ * will always be on top.
+ **/
+ void smallestToFront()
+ {
+ visible_features = new FeatureVector();
+ needVisibleFeatureVectorUpdate();
+ getCanvas().repaint();
+ }
+
+ /**
+ * Scroll the display so the given base on the Strand currently display on
+ * top will be in the centre of the display. No events are sent.
+ * @param base_position The new centre base position.
+ **/
+ private void setCentreVisibleForwardBase(final int base_position)
+ {
+ final int max_visible_bases = getMaxVisibleBases();
+ final int possible_base_position = base_position - max_visible_bases / 2;
+ int real_base_position;
+
+ if(possible_base_position < 1 && hard_left_edge)
+ real_base_position = 1;
+ else
+ real_base_position = possible_base_position;
+
+ if(real_base_position > getSequenceLength())
+ real_base_position = getSequenceLength();
+
+ setFirstVisibleForwardBase(real_base_position);
+ }
+
+ /**
+ * Scroll the display so that the given base is in the middle of the
+ * screen. This method obeys the rev_comp_display flag.
+ * @param base_position The base position to make visible.
+ * @param forward true means FORWARD - the base_position refers to a
+ * position on the forward strand, false means REVERSE - the
+ * base_position refers to the reverse strand.
+ * @param send_event Send a DisplayAdjustmentEvent if and only if this is
+ * true
+ **/
+ private void makeBaseVisibleInternal(final int base_position,
+ final boolean forward,
+ final boolean send_event)
+ {
+ int forward_base_position = base_position;
+
+ if(!forward ^ isRevCompDisplay())
+ forward_base_position =
+ getBases().getComplementPosition(forward_base_position);
+
+ setCentreVisibleForwardBase(forward_base_position);
+
+ if(send_event)
+ fireAdjustmentEvent(DisplayAdjustmentEvent.SCROLL_ADJUST_EVENT);
+ }
+
+ /**
+ * Scroll the display so that the given base is in the middle of the screen
+ * @param base_marker The Marker of base to make visible.
+ **/
+ private void makeBaseVisible(final Marker base_marker)
+ {
+ makeBaseVisibleInternal(base_marker.getPosition(),
+ base_marker.getStrand().isForwardStrand(),
+ true);
+ }
+
+ /**
+ * Scroll the display so that the given base is in the middle of the screen.
+ * @param base The base to scroll to.
+ **/
+ public void makeBaseVisible(final int base)
+ {
+ makeBaseVisibleInternal(base, true, true);
+ }
+
+ /**
+ * This method is called to add a single feature to the display by adding it
+ * to the vector of visible features(if it is visible that is).
+ * @param feature The object to add
+ **/
+ private void add(Feature feature)
+ {
+ if(getEntryGroup().isActive(feature.getEntry()) &&
+ featureVisible(feature))
+ {
+ if(visible_features.contains(feature))
+ {
+// throw new Error("internal error - feature added a second time");
+ }
+ else
+ getVisibleFeatures().addElementAtEnd(feature);
+ }
+
+ getCanvas().repaint();
+ }
+
+
+ /**
+ * The method is called when a Feature should be removed from the display.
+ * The feature is removed from the vector of visible features.
+ * @param feature The object to remove
+ **/
+ private void remove(Feature feature)
+ {
+ if(visible_features != null)
+ visible_features.remove(feature);
+
+ getCanvas().repaint();
+ }
+
+ /**
+ * Returns the vector containing those features that are currently visible.
+ **/
+ private FeatureVector getVisibleFeatures()
+ {
+ return visible_features;
+ }
+
+ /**
+ * Returns a copy of the vector containing those features that are
+ * currently visible.
+ **/
+ public FeatureVector getCurrentVisibleFeatures()
+ {
+ return(FeatureVector)visible_features.clone();
+ }
+
+ /**
+ * Returns a Range that starts at the first visible base and ends at the
+ * last visible base.
+ **/
+ private Range getVisibleRange()
+ {
+ final int first_visible_base = getFirstVisibleForwardBase();
+ final int last_visible_base = getLastVisibleForwardBase();
+
+ if(first_visible_base <= last_visible_base)
+ return newRange(first_visible_base, last_visible_base);
+ else
+ return null;
+ }
+
+ /**
+ * This is called after scrolling to add all features that have become
+ * visible and remove those that have become invisible. The method changes
+ * visible_features as little as possible so that features that were at the
+ * end(and hence drawn last/on top) stay there. Selected features and
+ * segments will always be on top of unselected ones.
+ **/
+ private void updateVisibleFeatureVector()
+ {
+ final Range visible_range;
+
+ if(getCanvas().getSize().width == 0)
+ {
+ // don't bother doing any thinking
+ visible_features = new FeatureVector();
+ return;
+ }
+
+ if(raise_selection_flag)
+ {
+ final FeatureVector all_features = getSelection().getAllFeatures();
+
+ for(int i = 0 ; i < all_features.size() ; ++i)
+ raiseFeature(all_features.elementAt(i));
+
+ raise_selection_flag = false;
+ }
+
+ if(isRevCompDisplay())
+ {
+ final int first_visible_base = getFirstVisibleReverseBase();
+ final int last_visible_base = getLastVisibleReverseBase();
+ visible_range = newRange(first_visible_base, last_visible_base);
+ }
+ else
+ visible_range = getVisibleRange();
+
+ if(visible_range == null)
+ {
+ visible_features = new FeatureVector();
+ return;
+ }
+
+ final FeatureVector real_visible_features =
+ getSortedFeaturesInRange(visible_range);
+
+ final FeatureVector new_visible_features = new FeatureVector();
+
+ // add features that are in visible_features and
+ // real_visible_features - ie features that are still visible
+ for(int i = 0 ; i < visible_features.size() ; ++i)
+ {
+ final Feature new_feature = visible_features.elementAt(i);
+ if(real_visible_features.contains(new_feature))
+ new_visible_features.addElementAtEnd(new_feature);
+ }
+
+ // add features that are in real_visible_features and not currently
+ // in visible_features and are not selected(selected features will be
+ // added last so that they stay on top).
+ for(int i = 0 ; i < real_visible_features.size() ; ++i)
+ {
+ final Feature new_feature = real_visible_features.elementAt(i);
+
+ if(!visible_features.contains(new_feature) &&
+ !getSelection().contains(new_feature)) {
+ new_visible_features.addElementAtEnd(new_feature);
+ }
+ }
+
+ final FeatureVector selection_features = getSelection().getAllFeatures();
+
+ // now add features that are in real_visible_features, are not in
+ // visible_features and are selected(selected features are added last so
+ // that they stay on top).
+ for(int i = 0 ; i < real_visible_features.size() ; ++i)
+ {
+ final Feature new_feature = real_visible_features.elementAt(i);
+ if(!visible_features.contains(new_feature) &&
+ selection_features.contains(new_feature))
+ new_visible_features.addElementAtEnd(new_feature);
+ }
+
+ visible_features = new_visible_features;
+ update_visible_features = false;
+ }
+
+ /**
+ * This is used by getSortedFeaturesInRange().
+ **/
+ final private static Comparator feature_comparator = new Comparator()
+ {
+ /**
+ * Compare two Objects with respect to ordering.
+ * @return a negative number if feature1_object is less than
+ * feature2_object ; a positive number if feature1_object is greater
+ * than feature2_object; else 0
+ **/
+ public int compare(final Object feature1_object,
+ final Object feature2_object)
+ {
+ final Feature feature1 =(Feature) feature1_object;
+ final Feature feature2 =(Feature) feature2_object;
+
+ final int feature1_size = feature1.getBaseCount();
+ final int feature2_size = feature2.getBaseCount();
+
+ if(feature1_size > feature2_size)
+ return -1;
+ else
+ {
+ if(feature1_size < feature2_size)
+ return 1;
+ else
+ {
+ // use hash value as a last resort
+ if(feature1.hashCode() < feature2.hashCode())
+ return -1;
+ else
+ {
+ if(feature1.hashCode() == feature2.hashCode())
+ return 0;
+ else
+ return 1;
+ }
+ }
+ }
+ }
+ };
+
+ /**
+ * Return a vector containing the references of the Feature objects in the
+ * EntryGroup that are within the given range are which should be
+ * displayed. source features are not returned unless show_source_features
+ * is true. features with a score less than getMinimumScore() or higher
+ * than getMaximumScore() aren't returned.
+ * @param range Return features that overlap this range - ie the start of
+ * the feature is less than or equal to the end of the range and the end
+ * of the feature is greater than or equal to the start of the range.
+ * @return The features the are within the given range. The returned
+ * object is a copy - changes will not effect the EntryGroup object
+ * itself. The Features are sorted so that the features with the least
+ * bases come last, which is the reverse of Entry.getFeaturesInRange().
+ **/
+ private FeatureVector getSortedFeaturesInRange(final Range range)
+ {
+ try
+ {
+ FeatureVector features_from_entry =
+ getEntryGroup().getFeaturesInRange(range);
+
+ final int min_score = getMinimumScore();
+ final int max_score = getMaximumScore();
+
+ final FeatureVector filtered_features = new FeatureVector();
+
+ // filter out low and high scoring features and(possibly) source
+ // features
+ for(int i = features_from_entry.size() - 1 ; i >= 0 ; --i)
+ {
+ final Feature this_feature = features_from_entry.elementAt(i);
+
+ if(this_feature.getKey().equals("source") &&
+ !getShowSourceFeatures() &&
+ !getSelection().contains(this_feature))
+ continue;
+
+ if(min_score > 0 || max_score < 100)
+ {
+ final int this_feature_score = this_feature.getScore();
+
+ // features with no /score are always shown
+ if(this_feature_score != -1 &&
+ (this_feature_score < getMinimumScore() ||
+ this_feature_score > getMaximumScore()) &&
+ !getSelection().contains(this_feature))
+ continue;
+ }
+
+ filtered_features.add(this_feature);
+ }
+
+ features_from_entry = filtered_features;
+
+ final FeatureVector sorted_features =
+ features_from_entry.sort(feature_comparator);
+
+ return sorted_features;
+ }
+ catch(OutOfRangeException e)
+ {
+ throw new Error("internal error - unexpected exception: " + e);
+ }
+ }
+
+ /**
+ * The main paint function for the canvas. An off screen image
+ * used for double buffering when drawing the canvas.
+ * @param g The Graphics object of the canvas.
+ **/
+ protected void paintCanvas(Graphics g)
+ {
+ if(!isVisible())
+ return;
+
+ if(update_visible_features)
+ updateVisibleFeatureVector();
+
+ fillBackground(g);
+
+ final Selection selection = getSelection();
+ final FeatureVector selected_features = selection.getAllFeatures();
+
+ final FeatureSegmentVector selected_segments =
+ selection.getSelectedSegments();
+
+ // we draw the feature backgrounds first then the visible indication
+ // that there is a MarkerRange selected, then the feature outlines.
+ for(int i = 0 ; i < getVisibleFeatures().size() ; ++i)
+ drawFeature(g, getVisibleFeatures().elementAt(i),
+ true, selected_features, selected_segments);
+
+ drawBaseSelection(g);
+ drawScale(g);
+ drawCodons(g);
+ drawBases(g);
+
+ // now draw the feature outlines
+ for(int i = 0 ; i < getVisibleFeatures().size() ; ++i)
+ drawFeature(g, getVisibleFeatures().elementAt(i),
+ false, selected_features, selected_segments);
+ }
+
+ /**
+ * Draw the background colour of the frames.
+ **/
+ private void fillBackground(Graphics g)
+ {
+ g.setColor(Color.white);
+
+ g.fillRect(0, 0, getCanvas().getSize().width,
+ getCanvas().getSize().height);
+
+ if(getOneLinePerEntryFlag())
+ {
+ for(int i = 0 ; i < getEntryGroup().size() ; ++i)
+ {
+ final int forward_entry_line = getDisplayLineOfEntryIndex(i, true);
+ final int reverse_entry_line = getDisplayLineOfEntryIndex(i, false);
+
+ final Entry current_entry = getEntryGroup().elementAt(i);
+
+ if(getEntryGroup().getDefaultEntry() == current_entry &&
+ Options.getOptions().highlightActiveEntryFlag())
+ {
+ fillLane(g, forward_entry_line, active_entry_colour);
+ fillLane(g, reverse_entry_line, active_entry_colour);
+ }
+ else
+ {
+ fillLane(g, forward_entry_line, light_grey);
+ fillLane(g, reverse_entry_line, light_grey);
+ }
+ }
+ }
+ else
+ {
+ if(show_forward_lines)
+ {
+ fillLane(g, getFrameDisplayLine(FORWARD_FRAME_1), light_grey);
+ fillLane(g, getFrameDisplayLine(FORWARD_FRAME_2), light_grey);
+ fillLane(g, getFrameDisplayLine(FORWARD_FRAME_3), light_grey);
+ }
+
+ if(show_reverse_lines)
+ {
+ fillLane(g, getFrameDisplayLine(REVERSE_FRAME_1), light_grey);
+ fillLane(g, getFrameDisplayLine(REVERSE_FRAME_2), light_grey);
+ fillLane(g, getFrameDisplayLine(REVERSE_FRAME_3), light_grey);
+ }
+ }
+
+ fillLane(g, getFrameDisplayLine(FORWARD_STRAND), not_so_light_grey);
+ fillLane(g, getFrameDisplayLine(REVERSE_STRAND), not_so_light_grey);
+ }
+
+ /**
+ * Fill one lane/frame line with the given colour.
+ **/
+ private void fillLane(Graphics g, int fill_line_number, Color colour)
+ {
+ final int fill_line_top = fill_line_number*getLineHeight() + 1;
+
+ g.setColor(colour);
+
+ final int first_visible_base_coord =
+ getLowXPositionOfBase(getFirstVisibleForwardBase());
+
+ final int last_visible_base_coord =
+ getHighXPositionOfBase(getLastVisibleForwardBase());
+
+ g.fillRect(first_visible_base_coord, fill_line_top,
+ last_visible_base_coord - first_visible_base_coord + 1,
+ getFeatureHeight());
+ }
+
+
+ /**
+ * Draw the line showing the base numbers in the middle of the canvas.
+ * The smallest numbers will be to the left.
+ **/
+ private void drawScale(Graphics g)
+ {
+ g.setColor(Color.black);
+
+ final int scale_line = getFrameDisplayLine(SCALE_LINE);
+ final int scale_number_y_pos = scale_line * getLineHeight();
+
+ final float bases_per_pixel =
+ (float)getMaxVisibleBases() / getCanvasWidth();
+
+ final int base_label_spacing;
+
+ if(getScaleFactor() == 0)
+ {
+ // set the spacing so that the labels are at multiples of ten at the
+ // lowest scale factor
+ base_label_spacing =
+ (int) Math.ceil(MINIMUM_LABEL_SPACING * bases_per_pixel / 10) * 10;
+ }
+ else
+ {
+ // set the spacing so that the labels are at multiples of 100 otherwise
+ base_label_spacing =
+ (int) Math.ceil(MINIMUM_LABEL_SPACING * bases_per_pixel / 100) * 100;
+ }
+
+ final int label_spacing =(int)(base_label_spacing / bases_per_pixel);
+
+ final int possible_index_of_first_label;
+
+ if(isRevCompDisplay())
+ possible_index_of_first_label = (getSequenceLength() -
+ getLastVisibleForwardBase() + 1) / base_label_spacing;
+ else
+ possible_index_of_first_label =
+ getFirstVisibleForwardBase() / base_label_spacing;
+
+ final int index_of_first_label;
+
+ if(possible_index_of_first_label <= 0)
+ index_of_first_label = 1;
+ else
+ index_of_first_label = possible_index_of_first_label;
+
+ final int index_of_last_label;
+
+ if(isRevCompDisplay())
+ index_of_last_label = (getSequenceLength() -
+ getFirstVisibleForwardBase() + 1) / base_label_spacing;
+ else
+ index_of_last_label =
+ getLastVisibleForwardBase() / base_label_spacing;
+
+ for(int i = index_of_first_label; i <= index_of_last_label; ++i)
+ {
+ final String label_string=
+ String.valueOf((int)(i * base_label_spacing));
+ final int scale_number_x_pos;
+
+ if(isRevCompDisplay())
+ scale_number_x_pos =
+ getLowXPositionOfBase(getSequenceLength() -
+ i * base_label_spacing + 1);
+ else
+ scale_number_x_pos =
+ getLowXPositionOfBase(i * base_label_spacing);
+
+ g.setFont(getFont());
+
+ g.drawString(label_string,
+ scale_number_x_pos + 2,
+ scale_number_y_pos + getFontAscent() + 1);
+
+ g.drawLine(scale_number_x_pos, scale_number_y_pos,
+ scale_number_x_pos, scale_number_y_pos + getLineHeight());
+
+ if(isRevCompDisplay())
+ g.drawLine(scale_number_x_pos, scale_number_y_pos,
+ scale_number_x_pos + getFontWidth(), scale_number_y_pos);
+ else
+ g.drawLine(scale_number_x_pos,
+ scale_number_y_pos + getLineHeight(),
+ scale_number_x_pos + getFontWidth(),
+ scale_number_y_pos + getLineHeight());
+ }
+ }
+
+ /**
+ * Draw the bases of the forward and reverse strands into a Graphics
+ * object.
+ **/
+ private void drawBases(Graphics g)
+ {
+ if(getScaleFactor() > 1 ||
+ getScaleFactor() == 1 && !show_base_colours)
+ return;
+
+ final Strand forward_strand;
+ final Strand reverse_strand;
+
+ if(isRevCompDisplay())
+ {
+ reverse_strand = getBases().getForwardStrand();
+ forward_strand = getBases().getReverseStrand();
+ }
+ else
+ {
+ forward_strand = getBases().getForwardStrand();
+ reverse_strand = getBases().getReverseStrand();
+ }
+
+ final Range forward_range =
+ newRange(getFirstVisibleForwardBase(),
+ getLastVisibleForwardBase());
+
+ String forward_visible_bases =
+ forward_strand.getSubSequence(forward_range).toUpperCase();
+
+ final int forward_frame_line = getFrameDisplayLine(FORWARD_STRAND);
+
+ final int forward_sequence_length = forward_visible_bases.length();
+
+ final int offset;
+
+ if(getForwardBaseAtLeftEdge() < 1)
+ offset = 1 - getForwardBaseAtLeftEdge();
+ else
+ offset = 0;
+
+
+ for(int base_index = 0; base_index < forward_sequence_length;
+ ++base_index)
+ {
+ final char char_to_draw =
+ forward_visible_bases.charAt(base_index);
+
+ if(getScaleFactor() == 0)
+ drawOneBaseLetter(g,
+ char_to_draw,
+ (offset + base_index) * getFontWidth(),
+ forward_frame_line * getLineHeight());
+ else
+ drawOnePixelBase(g,
+ char_to_draw,
+ offset + base_index,
+ forward_frame_line * getLineHeight());
+ }
+
+ final Range reverse_range = newRange(getFirstVisibleReverseBase(),
+ getLastVisibleReverseBase());
+
+ String reverse_visible_bases =
+ reverse_strand.getSubSequence(reverse_range).toUpperCase();
+
+ final int reverse_frame_line = getFrameDisplayLine(REVERSE_STRAND);
+
+ final int reverse_sequence_length = reverse_visible_bases.length();
+
+ for(int base_index = 0; base_index < reverse_sequence_length;
+ ++base_index)
+ {
+ final char char_to_draw =
+ reverse_visible_bases.charAt(reverse_sequence_length -
+ base_index - 1);
+
+ if(getScaleFactor() == 0)
+ drawOneBaseLetter(g,
+ char_to_draw,
+ (offset + base_index) * getFontWidth(),
+ reverse_frame_line * getLineHeight());
+ else
+ drawOnePixelBase(g,
+ char_to_draw,
+ offset + base_index,
+ reverse_frame_line * getLineHeight());
+ }
+ }
+
+
+ /**
+ * Draw the codons of the sequence into a graphics object. If the scale is
+ * 0 then the codon letters will be drawn, otherwise just the stop codons
+ * will marked.
+ * @param g The object to draw into.
+ **/
+ private void drawCodons(Graphics g)
+ {
+ g.setColor(Color.black);
+
+ if(getScaleFactor() == 0)
+ {
+ if(!getOneLinePerEntryFlag())
+ {
+ if(show_forward_lines)
+ drawForwardCodonLetters(g);
+
+ if(show_reverse_lines)
+ drawReverseCodonLetters(g);
+ }
+ }
+ else
+ {
+ final int MAX_STOP_CODON_SCALE_FACTOR = 7;
+ if((show_stop_codons || show_start_codons) &&
+ getScaleFactor() <= MAX_STOP_CODON_SCALE_FACTOR)
+ {
+ if(!getOneLinePerEntryFlag())
+ {
+ if(show_forward_lines)
+ drawForwardCodons(g);
+
+ if(show_reverse_lines)
+ drawReverseCodons(g);
+ }
+ }
+ }
+ }
+
+ /**
+ * Mark the start and stop codons into the three forward frame lines.
+ * @param g The object to draw into.
+ **/
+ private void drawForwardCodons(Graphics g)
+ {
+ final Strand strand;
+
+ if(isRevCompDisplay())
+ strand = getBases().getReverseStrand();
+ else
+ strand = getBases().getForwardStrand();
+
+ final int first_visible_base = getForwardBaseAtLeftEdge();
+
+ final int frame_shift =(first_visible_base - 1) % 3;
+
+ // base to start translation at - we start slightly off the left of the
+ // screen
+ final int start_base = first_visible_base - frame_shift;
+
+ // base to end translation at
+ // we + 3 to the upper bound because partial codons do not get translated
+ // by getTranslation()
+ final int end_base = getLastVisibleForwardBase() + 3;
+
+ // not used if show_stop_codons is false
+ int [][] forward_stop_codons = null;
+
+ if(show_stop_codons)
+ {
+ forward_stop_codons = new int [][] {
+ strand.getStopCodons(newRange(start_base, end_base)),
+ strand.getStopCodons(newRange(start_base + 1, end_base)),
+ strand.getStopCodons(newRange(start_base + 2, end_base))
+ };
+ }
+
+ // not used if show_start_codons is false
+ int [][] forward_start_codons = null;
+
+ if(show_start_codons)
+ {
+ final StringVector start_codons;
+
+ if(Options.getOptions().isEukaryoticMode())
+ start_codons = Options.getOptions().getEukaryoticStartCodons();
+ else
+ start_codons = Options.getOptions().getProkaryoticStartCodons();
+
+ forward_start_codons = new int [][] {
+ strand.getMatchingCodons(newRange(start_base, end_base),
+ start_codons),
+ strand.getMatchingCodons(newRange(start_base + 1, end_base),
+ start_codons),
+ strand.getMatchingCodons(newRange(start_base + 2, end_base),
+ start_codons)
+ };
+ }
+
+ for(int i = 0 ; i < 3 ; ++i)
+ {
+ final int frame_line = getFrameDisplayLine(FORWARD_FRAME_1 + i);
+
+ final int frame_x_start = i;
+
+ if(show_start_codons)
+ {
+ final int [] this_frame_start_codons = forward_start_codons [i];
+
+ drawCodonMarkLine(g,
+ frame_line,
+ this_frame_start_codons,
+ FORWARD,
+ 80);
+ }
+
+ if(show_stop_codons)
+ {
+ final int [] this_frame_stop_codons = forward_stop_codons [i];
+
+ drawCodonMarkLine(g,
+ frame_line,
+ this_frame_stop_codons,
+ FORWARD,
+ 100);
+ }
+ }
+ }
+
+ /**
+ * Mark the stop codons into the three reverse frame lines.
+ * @param g The object to draw into.
+ **/
+ private void drawReverseCodons(Graphics g)
+ {
+ final Strand strand;
+
+ if(isRevCompDisplay())
+ strand = getBases().getForwardStrand();
+ else
+ strand = getBases().getReverseStrand();
+
+ final int first_visible_base = getFirstVisibleReverseBase();
+
+ final int frame_shift = (first_visible_base - 1) % 3;
+
+ // base to start translation at
+ final int start_base = first_visible_base - frame_shift;
+
+ // base to end translation at
+ // we + 3 to the upper bound because partial codons do not get translated
+ // by getTranslation()
+ final int end_base = getLastVisibleReverseBase() + 3;
+
+ // not used if show_stop_codons is false
+ int [][] reverse_stop_codons = null;
+
+ if(show_stop_codons)
+ {
+ reverse_stop_codons = new int [][] {
+ strand.getStopCodons(newRange(start_base, end_base)),
+ strand.getStopCodons(newRange(start_base + 1, end_base)),
+ strand.getStopCodons(newRange(start_base + 2, end_base))
+ };
+ }
+
+ // not used if show_start_codons is false
+ int [][] reverse_start_codons = null;
+
+ if(show_start_codons)
+ {
+ final StringVector start_codons;
+
+ if(Options.getOptions().isEukaryoticMode())
+ start_codons = Options.getOptions().getEukaryoticStartCodons();
+ else
+ start_codons = Options.getOptions().getProkaryoticStartCodons();
+
+ reverse_start_codons = new int [][] {
+ strand.getMatchingCodons(newRange(start_base, end_base),
+ start_codons),
+ strand.getMatchingCodons(newRange(start_base + 1, end_base),
+ start_codons),
+ strand.getMatchingCodons(newRange(start_base + 2, end_base),
+ start_codons)
+ };
+ }
+
+ for(int i = 0 ; i < 3 ; ++i)
+ {
+ final int frame_line = getFrameDisplayLine(REVERSE_FRAME_1 - i);
+ final int frame_x_start = i;
+
+ if(show_start_codons)
+ {
+ final int [] this_frame_start_codons = reverse_start_codons [i];
+ drawCodonMarkLine(g,
+ frame_line,
+ this_frame_start_codons,
+ REVERSE,
+ 80);
+ }
+
+ if(show_stop_codons)
+ {
+ final int [] this_frame_stop_codons = reverse_stop_codons [i];
+ drawCodonMarkLine(g,
+ frame_line,
+ this_frame_stop_codons,
+ REVERSE,
+ 100);
+ }
+ }
+ }
+
+ /**
+ * Draw the codon letters into the three forward frame lines.
+ * @param g The object to draw into.
+ **/
+ private void drawForwardCodonLetters(Graphics g)
+ {
+ final Strand strand;
+
+ if(isRevCompDisplay())
+ strand = getBases().getReverseStrand();
+ else
+ strand = getBases().getForwardStrand();
+
+ final int first_visible_base = getFirstVisibleForwardBase();
+
+ for(int i = 0 ; i < 3 ; ++i)
+ {
+ final int frame_shift = 1 -(first_visible_base + 3 - i) % 3;
+
+ // base to start translation at - we start slightly off the left of the
+ // screen so that the first partial codon is translated as '.'
+ final int start_base = first_visible_base + frame_shift;
+
+ // base to end translation at - we end slightly off the right of the
+ // screen
+ final int end_base = getLastVisibleForwardBase() + 1;
+
+ final int frame_line = getFrameDisplayLine(FORWARD_FRAME_1 + i);
+
+ int frame_x_start = frame_shift;
+
+ final AminoAcidSequence this_frame_translation =
+ strand.getTranslation(newRange(start_base, end_base),
+ false);
+
+ final String this_frame_translation_string =
+ this_frame_translation.toString();
+
+ drawCodonLine(g,
+ frame_x_start,
+ frame_line,
+ this_frame_translation_string,
+ FORWARD);
+ }
+ }
+
+ /**
+ * Draw the codon letters into the three reverse frame lines.
+ * @param g The object to draw into.
+ **/
+ private void drawReverseCodonLetters(Graphics g)
+ {
+ final Strand strand;
+
+ if(isRevCompDisplay())
+ strand = getBases().getForwardStrand();
+ else
+ strand = getBases().getReverseStrand();
+
+ final int first_visible_base = getFirstVisibleReverseBase();
+
+ for(int i = 0 ; i < 3 ; ++i)
+ {
+ final int frame_shift = 1 -(first_visible_base + 3 - i) % 3;
+
+ // base to start translation at - we start slightly off the right of the
+ // screen so that the first partial codon is translated as '.'
+ final int start_base = first_visible_base + frame_shift;
+
+ // base to end translation at - we end slightly off the left of the
+ // screen
+ final int end_base = getLastVisibleReverseBase() + 1;
+
+ final int frame_line = getFrameDisplayLine(REVERSE_FRAME_1 - i);
+
+ int frame_x_start = frame_shift;
+
+ final AminoAcidSequence this_frame_translation =
+ strand.getTranslation(newRange(start_base, end_base),
+ false);
+
+ final String this_frame_translation_string =
+ this_frame_translation.toString();
+
+ drawCodonLine(g,
+ frame_x_start,
+ frame_line,
+ this_frame_translation_string,
+ REVERSE);
+ }
+ }
+
+
+ /**
+ * Draw one line of codons.
+ * @param g The object to draw into.
+ * @param frame_start When drawing in the FORWARD direction this is the
+ * offset from the left of the screen at which to start drawing the line.
+ * For REVERSE it is the offset from the last visible base.
+ * @param line_number The frame line to draw into. (see
+ * getFrameDisplayLine() for more details about these line numbers).
+ * @param codons A String containing the codon letters to draw.
+ * @param direction The direction to draw the letters in(see the
+ * frame_start parameter).
+ **/
+ private void drawCodonLine(Graphics g,
+ int frame_start,
+ int line_number,
+ String codons,
+ int direction)
+ {
+ final int offset;
+
+ if(getForwardBaseAtLeftEdge() < 1 && direction != REVERSE)
+ offset = 1 - getForwardBaseAtLeftEdge();
+ else
+ offset = 0;
+
+ final String upper_case_codons = codons.toUpperCase();
+ final int draw_y_position = line_number * getLineHeight();
+
+ // draw each AA letter
+ for(int i = 0 ; i < upper_case_codons.length() ; ++i)
+ {
+ final char aa_char = upper_case_codons.charAt(i);
+
+ int draw_x_position =
+ (int)((offset + frame_start + 3 * i + 1) * getScaleValue());
+
+ if(direction == REVERSE)
+ {
+ // draw in the opposite direction
+ draw_x_position =
+ getLowXPositionOfBase(getLastVisibleForwardBase()) -
+ draw_x_position;
+ }
+
+ drawOneLetter(g, aa_char, draw_x_position, draw_y_position);
+ }
+ }
+
+ /**
+ * Draw one line of codons marks(stop codons or start codons).
+ * @param g The object to draw into.
+ * @param line_number The frame line to draw into. (see
+ * getFrameDisplayLine() for more details about these line numbers).
+ * @param codon_positions A vector containing the base positions of the
+ * codons to mark.
+ * @param direction The direction to draw the letters in(see the
+ * frame_start parameter).
+ * @param height_percent The height of the mark as a percentage of the
+ * frame line height.
+ **/
+ private void drawCodonMarkLine(final Graphics g,
+ final int line_number,
+ final int [] codon_positions,
+ final int direction,
+ final int height_percent)
+ {
+
+ final int first_visible_forward_base = getForwardBaseAtLeftEdge();
+ final int first_visible_reverse_base = getFirstVisibleReverseBase();
+ final int last_visible_forward_base = getLastVisibleForwardBase();
+ final double scale_value = getScaleValue();
+
+ final int line_height = getLineHeight();
+
+ final Integer colour_number =
+ Options.getOptions().getIntegerProperty("colour_of_start_codon");
+
+ final Color start_codon_colour;
+
+ if(colour_number != null)
+ {
+ final int int_colour_number = colour_number.intValue();
+ start_codon_colour =
+ Options.getOptions().getColorFromColourNumber(int_colour_number);
+ }
+ else
+ start_codon_colour = Color.blue;
+
+ final int draw_y_position = line_number * line_height +
+ (int)(1.0 * line_height *(100 - height_percent) / 100 / 2 + 0.5);
+
+ final int mark_height = height_percent * line_height / 100;
+
+ // used to remember the position of the previously drawn codon
+ int last_x_position = -1;
+
+ for(int i = 0 ; i < codon_positions.length ; ++i)
+ {
+ final int codon_base_start = codon_positions[i];
+
+ // zero is the end of data marker
+ if(codon_base_start == 0)
+ break;
+
+ int draw_x_position;
+
+ if(direction == FORWARD)
+ draw_x_position = getLowXPositionOfBase(codon_base_start);
+ else
+ {
+ final int raw_base_position =
+ getBases().getComplementPosition(codon_base_start);
+ draw_x_position = getLowXPositionOfBase(raw_base_position);
+ }
+
+ // draw only if we haven't drawn on the position already
+ if(last_x_position == -1 || draw_x_position != last_x_position)
+ {
+ if(height_percent < 100)
+ drawOneCodonMark(g, draw_x_position, draw_y_position,
+ direction, mark_height, start_codon_colour);
+ else
+ drawOneCodonMark(g, draw_x_position, draw_y_position,
+ direction, mark_height, Color.black);
+
+ last_x_position = draw_x_position;
+ }
+ }
+ }
+
+ /**
+ * Return the colour in which the given base should be drawn: blue for C,
+ * red for T, green for A and black for G.
+ **/
+ private static Color getColourOfBase(final char base_char)
+ {
+ switch(base_char)
+ {
+ case 'c': case 'C':
+ return Color.blue;
+ case 't': case 'T':
+ return Color.red;
+ case 'a': case 'A':
+ return dark_green;
+ case 'g': case 'G':
+ return Color.black;
+ default:
+ return Color.white;
+ }
+ }
+
+
+ /**
+ * Draw a letter at a specified position in a Graphics object.
+ * @param g The object to draw into.
+ * @param letter The character to draw.
+ * @param x_pos The x position at which to draw the letter.
+ * @param y_pos The y position at which to draw the letter.
+ **/
+ private void drawOneLetter(final Graphics g, final char letter,
+ final int x_pos, final int y_pos)
+ {
+ draw_one_char_temp_array[0] = letter;
+
+ g.setFont(getFont());
+ g.drawChars(draw_one_char_temp_array, 0, 1, x_pos,
+ y_pos + getFontAscent() + 1);
+ }
+
+ /**
+ * Draw a letter at a specified position in a Graphics object.
+ * @param g The object to draw into.
+ * @param base_char The character of the base to draw(A, T, G or C).
+ * @param x_pos The x position at which to draw the letter.
+ * @param y_pos The y position at which to draw the letter.
+ **/
+ private void drawOneBaseLetter(final Graphics g, final char base_char,
+ final int x_pos, final int y_pos)
+ {
+ if(show_base_colours)
+ g.setColor(getColourOfBase(base_char));
+
+ drawOneLetter(g, base_char, x_pos, y_pos);
+ }
+
+
+ /**
+ * Draw a codon mark at the given position. The codon is represented
+ * by a one pixel wide line for scale factor greater than 1 and 3 pixels
+ * wide if the scale factor is one.
+ * @param g The object to draw into.
+ * @param x_pos The x position at which to draw the codon.
+ * @param y_pos The y position at which to draw the codon. The line
+ * is drawn down from the given x,y position.
+ * @param direction If this is FORWARD the line is draw from the y position
+ * to the right, otherwise it is drawn to the left.
+ * @param height The height in pixels of the codon mark.
+ * @param colour The colour to use when drawing the mark.
+ **/
+ private void drawOneCodonMark(final Graphics g,
+ final int x_pos, final int y_pos,
+ final int direction,
+ final int height,
+ final Color colour)
+ {
+ g.setColor(colour);
+
+ if(getScaleFactor() == 1)
+ {
+ // draw a line three pixels/bases wide
+ if(direction == FORWARD)
+ {
+ g.drawLine(x_pos + 1, y_pos,
+ x_pos + 1, y_pos + height - 1);
+ g.drawLine(x_pos + 2, y_pos,
+ x_pos + 2, y_pos + height - 1);
+ }
+ else
+ {
+ g.drawLine(x_pos - 1, y_pos,
+ x_pos - 1, y_pos + height - 1);
+ g.drawLine(x_pos - 2, y_pos,
+ x_pos - 2, y_pos + height - 1);
+ }
+ }
+ g.drawLine(x_pos, y_pos, x_pos, y_pos + height - 1);
+ }
+
+ /**
+ * Draw a one pixel wide line representing a single base on the forward or
+ * reverse strand. The base is coloured according to which base is passed
+ * to the method: blue for C, red for T, green for A and black for G.
+ * @param g The object to draw into.
+ * @param aa_char The character to draw.
+ * @param x_pos The x position at which to draw the line representing the
+ * base.
+ * @param y_pos The y position at which to draw the top of the line
+ * representing the base.
+ **/
+ private void drawOnePixelBase(Graphics g, char base_char,
+ int x_pos, int y_pos)
+ {
+ g.setColor(getColourOfBase(base_char));
+ g.drawLine(x_pos, y_pos, x_pos, y_pos + getLineHeight() - 1);
+ }
+
+ /**
+ * Return the line on the canvas where this feature segment should be drawn.
+ * @param segment The segment in question.
+ * @return The line to draw into.
+ **/
+ private int getSegmentDisplayLine(FeatureSegment segment)
+ {
+ if(getOneLinePerEntryFlag())
+ {
+ final Feature feature = segment.getFeature();
+ if((feature.isProteinFeature() || frame_features_flag) &&
+ (show_forward_lines &&(feature.isForwardFeature() ^
+ isRevCompDisplay()) ||
+ show_reverse_lines &&(!feature.isForwardFeature() ^
+ isRevCompDisplay())))
+ {
+ return getFeatureDisplayLine(feature);
+ }
+ else
+ {
+ if(feature.isForwardFeature() ^ isRevCompDisplay())
+ return getFrameDisplayLine(FORWARD_STRAND);
+ else
+ return getFrameDisplayLine(REVERSE_STRAND);
+ }
+ }
+ else
+ {
+ final int frame_id =
+ maybeFlipFrameDirection(getSegmentFrameID(segment));
+
+ return getFrameDisplayLine(frame_id);
+ }
+ }
+
+ /**
+ * Return the frame ID of to use when drawing the given segment.
+ **/
+ private int getSegmentFrameID(final FeatureSegment segment)
+ {
+ final int frame_id = segment.getFrameID();
+
+ final Feature feature = segment.getFeature();
+
+ if((feature.isProteinFeature() || frame_features_flag) &&
+ (show_forward_lines &&(feature.isForwardFeature() ^
+ isRevCompDisplay())||
+ show_reverse_lines &&(! feature.isForwardFeature() ^
+ isRevCompDisplay())))
+ {
+ return frame_id;
+ }
+ else
+ {
+ switch(frame_id)
+ {
+ case FORWARD_FRAME_1:
+ // fall through
+ case FORWARD_FRAME_2:
+ // fall through
+ case FORWARD_FRAME_3:
+ // fall through
+ case FORWARD_STRAND:
+ return FORWARD_STRAND;
+ case REVERSE_FRAME_1:
+ // fall through
+ case REVERSE_FRAME_2:
+ // fall through
+ case REVERSE_FRAME_3:
+ // fall through
+ case REVERSE_STRAND:
+ return REVERSE_STRAND;
+ default:
+ return frame_id;
+ }
+ }
+ }
+
+ /**
+ * Return the line on the canvas where the given feature should be drawn
+ * when one_line_per_entry is true. Call getLineCount() to find out the
+ * total number of lines. Each line is getLineHeight() pixels high.
+ * @return The line to draw into.
+ **/
+ private int getFeatureDisplayLine(final Feature feature)
+ {
+ final int entry_index = getEntryGroup().indexOf(feature.getEntry());
+ return getDisplayLineOfEntryIndex(entry_index,
+ feature.isForwardFeature() ^
+ isRevCompDisplay());
+ }
+
+ /**
+ * Return the line in the display where features from the entry specified
+ * by the given entry_index should be drawn.
+ * @param is_forward_feature indicates whether the feature of interest is
+ * on the forward or reverse strand.
+ **/
+ private int getDisplayLineOfEntryIndex(final int entry_index,
+ final boolean is_forward_feature)
+ {
+ if(is_forward_feature)
+ {
+ if(getShowForwardFrameLines())
+ {
+ if(getShowLabels())
+ return entry_index * 2;
+ else
+ return entry_index;
+ }
+ else
+ return 0;
+ }
+ else
+ {
+ int return_value = 0;
+ if(getShowLabels())
+ {
+ return_value = getEntryGroup().size() * 2 + 3 - entry_index * 2;
+
+ if(getShowForwardFrameLines())
+ return_value += getEntryGroup().size() * 2;
+ }
+ else
+ {
+ return_value = getEntryGroup().size() + 2 - entry_index;
+
+ if(getShowForwardFrameLines())
+ return_value += getEntryGroup().size();
+ }
+ return return_value;
+ }
+ }
+
+ /**
+ * If rev_comp_display is true return the corresponding frame_id from the
+ * opposite strand(eg. FORWARD_FRAME_1 gives REVERSE_FRAME_3) otherwise
+ * return the frame_id unchanged.
+ **/
+ private int maybeFlipFrameDirection(final int frame_id)
+ {
+ if(isRevCompDisplay())
+ {
+ // flip the frame so that forward becomes reverse and reverse becomes
+ // forward
+ switch(frame_id)
+ {
+ case FORWARD_FRAME_1:
+ return REVERSE_FRAME_1;
+ case FORWARD_FRAME_2:
+ return REVERSE_FRAME_2;
+ case FORWARD_FRAME_3:
+ return REVERSE_FRAME_3;
+ case FORWARD_STRAND:
+ return REVERSE_STRAND;
+ case REVERSE_FRAME_1:
+ return FORWARD_FRAME_1;
+ case REVERSE_FRAME_2:
+ return FORWARD_FRAME_2;
+ case REVERSE_FRAME_3:
+ return FORWARD_FRAME_3;
+ case REVERSE_STRAND:
+ return FORWARD_STRAND;
+ default:
+ return frame_id;
+ }
+ }
+ return frame_id;
+ }
+
+ /**
+ * Return the line on the canvas where this frame ID should be drawn. Call
+ * getLineCount() to find out the total number of lines. Each line is
+ * getLineHeight() pixels high.
+ * @param frame_id The frame ID.
+ * @return The line to draw into.
+ **/
+ private int getFrameDisplayLine(int frame_id)
+ {
+ if(getOneLinePerEntryFlag())
+ {
+ int return_value;
+ switch(frame_id)
+ {
+ case FORWARD_STRAND:
+ return_value = 0;
+ break;
+ case REVERSE_STRAND:
+ if(show_labels)
+ return_value = 3;
+ else
+ return_value = 2;
+ break;
+ case SCALE_LINE:
+ if(show_labels)
+ return_value = 2;
+ else
+ return_value = 1;
+ break;
+ default:
+ throw new Error("internal error - unexpected value: " + frame_id);
+ }
+
+ if(show_forward_lines)
+ {
+ if(show_labels)
+ return_value += getEntryGroup().size();
+
+ return return_value + getEntryGroup().size();
+ }
+ else
+ return return_value;
+ }
+
+ final int line_number;
+
+ switch(frame_id)
+ {
+ case FORWARD_FRAME_1:
+ line_number = 0;
+ break;
+ case FORWARD_FRAME_2:
+ if(show_labels)
+ line_number = 2;
+ else
+ line_number = 1;
+ break;
+ case FORWARD_FRAME_3:
+ if(show_labels)
+ line_number = 4;
+ else
+ line_number = 2;
+ break;
+ case FORWARD_STRAND:
+ if(show_forward_lines)
+ {
+ if(show_labels)
+ line_number = 6;
+ else
+ line_number = 3;
+ }
+ else
+ line_number = 0;
+ break;
+ case REVERSE_STRAND:
+ if(show_forward_lines)
+ {
+ if(show_labels)
+ line_number = 9;
+ else
+ line_number = 5;
+ }
+ else
+ {
+ if(show_labels)
+ line_number = 3;
+ else
+ line_number = 2;
+ }
+ break;
+ case REVERSE_FRAME_3:
+ if(show_forward_lines)
+ {
+ if(show_labels)
+ line_number = 11;
+ else
+ line_number = 6;
+ }
+ else
+ {
+ if(show_labels)
+ line_number = 5;
+ else
+ line_number = 3;
+ }
+ break;
+ case REVERSE_FRAME_2:
+ if(show_forward_lines)
+ {
+ if(show_labels)
+ line_number = 13;
+ else
+ line_number = 7;
+ }
+ else
+ {
+ if(show_labels)
+ line_number = 7;
+ else
+ line_number = 4;
+ }
+ break;
+ case REVERSE_FRAME_1:
+ if(show_forward_lines)
+ {
+ if(show_labels)
+ line_number = 15;
+ else
+ line_number = 8;
+ }
+ else
+ {
+ if(show_labels)
+ line_number = 9;
+ else
+ line_number = 5;
+ }
+ break;
+ default:
+ if(show_forward_lines)
+ {
+ if(show_labels)
+ line_number = 8;
+ else
+ line_number = 4;
+ }
+ else
+ {
+ if(show_labels)
+ line_number = 2;
+ else
+ line_number = 1;
+ }
+ break;
+ }
+
+ return line_number;
+ }
+
+ /**
+ * Return the number of lines of text we need to fit on the canvas. This
+ * is used to set the height of the canvas.
+ **/
+ private int getLineCount()
+ {
+ int line_count;
+
+ if(show_labels)
+ line_count = 5;
+ else
+ line_count = 3;
+
+ int extra_line_count;
+
+ if(getOneLinePerEntryFlag())
+ {
+ // some number of entry lines
+ extra_line_count = getEntryGroup().size();
+ }
+ else
+ {
+ // three frame line
+ extra_line_count = 3;
+ }
+
+ if(show_labels)
+ extra_line_count *= 2;
+
+ if(show_forward_lines)
+ line_count += extra_line_count;
+
+ if(show_reverse_lines)
+ line_count += extra_line_count;
+
+ return line_count;
+ }
+
+ /**
+ * Return the vertical offset from the top of the canvas for this feature.
+ * The returned value will be the y-coordinate of the top of the lane that
+ * this feature should be draw into.
+ **/
+ private int getSegmentVerticalOffset(FeatureSegment segment)
+ {
+ // one "line" is font_height pixels high,(the number of lines times the
+ // font_height is the height of the height of canvas)
+ final int line = getSegmentDisplayLine(segment);
+
+ return getLineOffset(line);
+ }
+
+ /**
+ * Given a line return the vertical offset(in pixels) from the top of the
+ * canvas.
+ **/
+ private int getLineOffset(int line)
+ {
+ return line * getLineHeight();
+ }
+
+ /**
+ * Return the lowest on screen(with respect to the canvas) x coordinate of
+ * a base. If the scale_factor is zero then one base will be font_width
+ * wide and this method will return a different value than
+ * getHighXPositionOfBase(). If scale_factor is greater than one then
+ * the two methods will return the same thing.
+ * @param base_number The(forward) base to calculate the position of.
+ **/
+ private int getLowXPositionOfBase(int base_number)
+ {
+ return(int)((base_number - getForwardBaseAtLeftEdge()) *
+ getScaleValue());
+ }
+
+ /**
+ * Return the highest on screen(ie with respect to the canvas) x
+ * coordinate of a base. See comment on getLowXPositionOfBase().
+ * @param base_number The(forward) base to calculate the position of.
+ **/
+ private int getHighXPositionOfBase(int base_number)
+ {
+ if(getScaleFactor() == 0)
+ return getLowXPositionOfBase(base_number) + getFontWidth() - 1;
+ else
+ return getLowXPositionOfBase(base_number);
+ }
+
+ /**
+ * Return the low on screen x coordinate of the base at the given Marker
+ * position. If the scale_factor is zero then one base will be font_width
+ * wide so that this method will return a different position than
+ * getHighXPositionOfMarker().
+ * @param marker The Marker position to return the screen position of.
+ **/
+ private int getLowXPositionOfMarker(Marker marker)
+ {
+ int position = marker.getRawPosition();
+
+ if(isRevCompDisplay())
+ position = getSequenceLength() - position + 1;
+
+ if(marker.getStrand().isForwardStrand() ^ isRevCompDisplay())
+ return getLowXPositionOfBase(position);
+ else
+ return getHighXPositionOfBase(position);
+ }
+
+ /**
+ * Return the high on screen x coordinate of the base at the given Marker
+ * position. If the scale_factor is zero then one base will be font_width
+ * wide so that this method will return a different position than
+ * getLowXPositionOfMarker().
+ * @param marker The Marker position to return the screen position of.
+ **/
+ private int getHighXPositionOfMarker(Marker marker)
+ {
+ int position = marker.getRawPosition();
+
+ if(isRevCompDisplay())
+ position = getSequenceLength() - position + 1;
+
+ if(marker.getStrand().isForwardStrand() ^ isRevCompDisplay())
+ return getHighXPositionOfBase(position);
+ else
+ return getLowXPositionOfBase(position);
+ }
+
+
+ /**
+ * This is the approximate opposite of getLowXPositionOfBase() - it returns
+ * MarkerRange corresponding to the given screen position. It returns a
+ * MarkerRange rather than a Marker because if the user clicks on a FRAME
+ * line then we want to select a whole codon not just one base.
+ * @param position A position on the canvas.
+ * @return A MarkerRange covering the clicked on bases.
+ **/
+ private MarkerRange getMarkerRangeFromPosition(Point position)
+ {
+ return getMarkerRangeFromPosition(position, true);
+ }
+
+ /**
+ * Given a Point and a direction(either FORWARD_STRAND or REVERSE_STRAND),
+ * return a the corresponding base position on that Strand.
+ **/
+ private int getBasePositionOfPoint(final Point position,
+ final int direction)
+ {
+ if(direction == FORWARD_STRAND)
+ {
+ return(int)(1.0 * position.x / getScaleValue() +
+ getForwardBaseAtLeftEdge());
+ }
+ else
+ {
+ if(direction == REVERSE_STRAND)
+ {
+ final int raw_base_position =
+ (int)(1.0 * position.x / getScaleValue() +
+ getForwardBaseAtLeftEdge());
+ return getBases().getComplementPosition(raw_base_position);
+ }
+ else
+ throw new Error("internal error - unexpected value: " + direction);
+ }
+ }
+
+ /**
+ * This is the approximate opposite of getLowXPositionOfBase() - it returns
+ * MarkerRange corresponding to the given screen position. It returns a
+ * MarkerRange rather than a Marker because if the user clicks on a FRAME
+ * line then we want to select a whole codon not just one base.
+ * @param position A position on the canvas.
+ * @param whole_codon If true then return a range that covers a whole codon
+ * if the click was on a frame line.
+ * @return A MarkerRange covering the clicked on bases.
+ **/
+ private MarkerRange getMarkerRangeFromPosition(final Point position,
+ final boolean whole_codon)
+ {
+
+ final int frame_id;
+
+ int base_position;
+ final Strand strand;
+
+ if(getOneLinePerEntryFlag())
+ {
+ final int scale_line = getFrameDisplayLine(SCALE_LINE);
+ final int position_line = getLineFromPoint(position);
+
+ if(position_line < scale_line)
+ {
+ if(isRevCompDisplay())
+ strand = getBases().getReverseStrand();
+ else
+ strand = getBases().getForwardStrand();
+
+ frame_id = FORWARD_STRAND;
+ }
+ else
+ {
+ if(position_line > scale_line)
+ {
+ if(isRevCompDisplay())
+ strand = getBases().getForwardStrand();
+ else
+ strand = getBases().getReverseStrand();
+
+ frame_id = REVERSE_STRAND;
+ }
+ else
+ return null;
+ }
+
+ base_position = getBasePositionOfPoint(position, frame_id);
+ }
+ else
+ {
+ frame_id = getFrameFromPoint(position);
+ // calculate the frame/strand line and base position
+ switch(frame_id)
+ {
+ case FORWARD_FRAME_1:
+ case FORWARD_FRAME_2:
+ case FORWARD_FRAME_3:
+ case FORWARD_STRAND:
+ if(isRevCompDisplay())
+ strand = getBases().getReverseStrand();
+ else
+ strand = getBases().getForwardStrand();
+
+ base_position = getBasePositionOfPoint(position, FORWARD_STRAND);
+ break;
+ case REVERSE_FRAME_1:
+ case REVERSE_FRAME_2:
+ case REVERSE_FRAME_3:
+ case REVERSE_STRAND:
+ if(isRevCompDisplay())
+ strand = getBases().getForwardStrand();
+ else
+ strand = getBases().getReverseStrand();
+
+ base_position = getBasePositionOfPoint(position, REVERSE_STRAND);
+ break;
+ default:
+ base_position = 0;
+ strand = null;
+ }
+ }
+
+ final int start_base_position;
+ final int end_base_position;
+
+ if(whole_codon)
+ {
+ start_base_position =
+ adjustBasePositionForFrame(frame_id, base_position, true);
+ end_base_position =
+ adjustBasePositionForFrame(frame_id, base_position, false);
+ }
+ else
+ {
+ start_base_position = base_position;
+ end_base_position = base_position;
+ }
+
+ if(strand == null)
+ return null;
+ else
+ {
+ try
+ {
+ return strand.makeMarkerRangeFromPositions(start_base_position,
+ end_base_position);
+ }
+ catch(OutOfRangeException e)
+ {
+ // XXX
+ return null;
+ }
+ }
+ }
+
+
+ /**
+ * Helper method for getMarkerRangeFromPosition(). Returns a base
+ * position offset to the start/end of the codon if the given frame id on a
+ * FRAME.
+ * @param get_start If true then the base position returned is base
+ * position of the start of the codon, otherwise the end base is
+ * returned.
+ **/
+ private int adjustBasePositionForFrame(int frame_id,
+ final int base_position,
+ final boolean get_start)
+ {
+ final int return_base_position;
+ final int end_offset;
+
+ if(get_start)
+ end_offset = 0;
+ else
+ {
+ // the end is two bases ahead of the start
+ end_offset = 2;
+ }
+
+ switch(frame_id)
+ {
+ case FORWARD_FRAME_1:
+ case REVERSE_FRAME_1:
+ {
+ final int base_pos_mod3 =(base_position - 1) % 3;
+ return_base_position = base_position + end_offset - base_pos_mod3;
+ }
+ break;
+ case FORWARD_FRAME_2:
+ case REVERSE_FRAME_2:
+ {
+ final int base_pos_mod3 =(base_position - 2) % 3;
+ return_base_position = base_position + end_offset - base_pos_mod3;
+ }
+ break;
+ case FORWARD_FRAME_3:
+ case REVERSE_FRAME_3:
+ {
+ final int base_pos_mod3 =(base_position - 3) % 3;
+ return_base_position = base_position + end_offset - base_pos_mod3;
+ }
+ break;
+ default:
+ return_base_position = base_position;
+ // do nothing
+ }
+
+ return return_base_position;
+ }
+
+ /**
+ * Draw one feature at the correct place in a Graphics object.
+ * @param g The Graphics object on which to draw.
+ * @param draw_feature_fill If true then draw just the solid block of colour
+ * inside the segments. If false then draw just the outline.
+ * @param feature The feature to draw.
+ **/
+ private void drawFeature(final Graphics g,
+ final Feature feature,
+ final boolean draw_feature_fill,
+ final FeatureVector selected_features,
+ final FeatureSegmentVector selected_segments)
+ {
+ final FeatureSegmentVector this_feature_segments = feature.getSegments();
+
+ // don't try to draw a feature with no segments
+ if(this_feature_segments.size() == 0)
+ return;
+
+ // set to true if and only if the whole of this feature should be
+ // highlighted
+ final boolean highlight_feature_flag;
+
+ if(selected_features.contains(feature))
+ {
+ // ignore the possibility that a feature and a segment from the same
+ // feature could be in the selection vector at the same time
+ highlight_feature_flag = true;
+ }
+ else
+ {
+ // if the feature border flag is off and the feature is not selected
+ // then don't draw the border
+ if(!show_feature_borders && !draw_feature_fill)
+ return;
+
+ highlight_feature_flag = false;
+ }
+
+ // draw each segment/exon
+ for(int i = 0 ; i < this_feature_segments.size() ; ++i)
+ {
+ final FeatureSegment current_segment =
+ this_feature_segments.elementAt(i);
+ final boolean highlight_segment_flag;
+
+ if(selected_segments.indexOf(current_segment) == -1)
+ highlight_segment_flag = false;
+ else
+ highlight_segment_flag = true;
+
+ final boolean draw_direction_arrow_flag;
+
+ // draw an arrow only on the last segment
+ if(i == this_feature_segments.size() - 1 && show_feature_arrows)
+ draw_direction_arrow_flag = true;
+ else
+ draw_direction_arrow_flag = false;
+
+ drawSegment(g, current_segment,
+ highlight_feature_flag, highlight_segment_flag,
+ draw_feature_fill,
+ draw_direction_arrow_flag);
+
+ if(i + 1 < this_feature_segments.size())
+ {
+ // draw a line between the segments
+
+ final FeatureSegment next_segment =
+ this_feature_segments.elementAt(i + 1);
+
+ drawSegmentConnection(g, current_segment, next_segment);
+ }
+ }
+
+ // draw the label last if the is no label line because in this case the
+ // label is draw on top of the feature segments
+ if(draw_feature_fill)
+ drawFeatureLabel(g, feature);
+
+ Thread.yield();
+ }
+
+ /**
+ * Draw a bent line between two segments which represents the connection
+ * between exons in feature.
+ * @param g The Graphics object on which to draw.
+ * @param lower_segment The reference of the segment that is closest to the
+ * start of the Strand. The connection line will start at the beginning
+ * of this segment.
+ * @param upper_segment The reference of the segment that is furthest from
+ * the start of the Strand. The connection line will finish at the end
+ * of this segment.
+ **/
+ private void drawSegmentConnection(Graphics g,
+ FeatureSegment lower_segment,
+ FeatureSegment upper_segment)
+ {
+ final Marker upper_segment_start_marker = upper_segment.getStart();
+ final Marker lower_segment_end_marker = lower_segment.getEnd();
+
+ int next_segment_start_coord =
+ getLowXPositionOfMarker(upper_segment_start_marker);
+
+ // make sure we don't wrap around when drawing
+ if(next_segment_start_coord > 16000)
+ next_segment_start_coord = 16000;
+
+ // make sure we don't wrap around when drawing
+ if(next_segment_start_coord < -16000)
+ next_segment_start_coord = -16000;
+
+ int this_segment_end_coord =
+ getHighXPositionOfMarker(lower_segment_end_marker);
+
+ // make sure we don't wrap around when drawing
+ if(this_segment_end_coord > 16000)
+ this_segment_end_coord = 16000;
+
+ // make sure we don't wrap around when drawing
+ if(this_segment_end_coord < -16000)
+ this_segment_end_coord = -16000;
+
+ final int this_segment_vertical_offset =
+ getSegmentVerticalOffset(lower_segment);
+ final int next_segment_vertical_offset =
+ getSegmentVerticalOffset(upper_segment);
+
+ // we draw the line with a bend in the middle - this is the vertical
+ // position of the bend
+ final int line_y_position_for_centre;
+
+ if(this_segment_vertical_offset < next_segment_vertical_offset)
+ line_y_position_for_centre = this_segment_vertical_offset;
+ else
+ line_y_position_for_centre = next_segment_vertical_offset;
+
+ final int line_y_position_for_this =
+ this_segment_vertical_offset + getFeatureHeight() / 2;
+ final int line_y_position_for_next =
+ next_segment_vertical_offset + getFeatureHeight() / 2;
+
+ final int horizontal_position_of_centre =
+ (this_segment_end_coord + next_segment_start_coord) / 2;
+
+ final Feature segment_feature = lower_segment.getFeature();
+ final Color feature_colour = segment_feature.getColour();
+
+ // draw in black if no colour is specified or if the feature is selected
+ if(feature_colour == null ||
+ getSelection().contains(lower_segment.getFeature()))
+ g.setColor(Color.black);
+ else
+ g.setColor(feature_colour);
+
+ g.drawLine(this_segment_end_coord,
+ line_y_position_for_this,
+ horizontal_position_of_centre,
+ line_y_position_for_centre);
+
+ g.drawLine(horizontal_position_of_centre,
+ line_y_position_for_centre,
+ next_segment_start_coord,
+ line_y_position_for_next);
+ }
+
+ /**
+ * Draw a label a feature. This is a helper function for drawFeature().
+ * If show_labels is true the labels will be drawn below the features,
+ * otherwise they will be drawn within the features.
+ * @param g The Graphics object on which to draw.
+ * @param feature The feature to draw the label for.
+ **/
+ private void drawFeatureLabel(Graphics g, Feature feature)
+ {
+
+ // the three frame translation is visible when the scale factor is 0,
+ // don't draw labels over it
+ if(!show_labels && getScaleFactor() == 0)
+ return;
+
+ String label_or_gene = feature.getIDString();
+ final String label = feature.getLabel();
+
+ // special case - don't display a label if the label qualifier is "*"
+ if(label != null && label.equals("*"))
+ label_or_gene = "";
+
+ // don't waste time drawing nothing
+ if(label_or_gene.length() == 0)
+ return;
+
+ final FontMetrics fm = g.getFontMetrics();
+ final int string_width = fm.stringWidth(label_or_gene);
+
+ final FeatureSegment first_segment = feature.getSegments().elementAt(0);
+ final int label_x_coord;
+
+ if(feature.isForwardFeature() ^ isRevCompDisplay())
+ {
+ int segment_start_pos =
+ first_segment.getStart().getRawPosition();
+
+ if(isRevCompDisplay())
+ segment_start_pos = getSequenceLength() - segment_start_pos + 1;
+
+ label_x_coord = getLowXPositionOfBase(segment_start_pos);
+ }
+ else
+ {
+ int segment_end_pos =
+ first_segment.getEnd().getRawPosition();
+
+ if(isRevCompDisplay())
+ segment_end_pos = getSequenceLength() - segment_end_pos + 1;
+
+ // reverse the start and end on the complementary strand
+ label_x_coord = getLowXPositionOfBase(segment_end_pos);
+ }
+
+ if(label_x_coord >= getCanvas().getSize().width)
+ return;
+
+// if(label_x_coord + string_width <= 0) {
+ // don't draw the label if it is not visible on screen
+// }
+
+
+ int vertical_offset =
+ getSegmentVerticalOffset(first_segment);
+
+ if(show_labels)
+ vertical_offset += getLineHeight(); // move to the label line
+
+ // save this so we can restore it later
+ final Shape saved_clip = g.getClip();
+
+ // if we have a labels line draw a white background behind the
+ // label
+ if(show_labels)
+ {
+ g.setColor(Color.white);
+
+ g.fillRect(label_x_coord - getFontWidth(),
+ vertical_offset,
+ string_width + getFontWidth() * 2,
+ getLineHeight());
+ }
+ else
+ {
+ // if there is no label line clip to the size of the first segment
+ // and draw in there
+ final int segment_start_coord =
+ getSegmentStartCoord(first_segment);
+ final int segment_end_coord =
+ getSegmentEndCoord(first_segment);
+
+ if(Math.abs(segment_end_coord - segment_start_coord) > 5)
+ {
+ if(segment_end_coord > segment_start_coord)
+ g.setClip(segment_start_coord, vertical_offset,
+ segment_end_coord - segment_start_coord,
+ getFeatureHeight());
+ else
+ g.setClip(segment_end_coord, vertical_offset,
+ segment_start_coord - segment_end_coord,
+ getFeatureHeight());
+ }
+ else
+ return; // don't draw small labels if there is no room
+ }
+
+ g.setColor(Color.black);
+ g.setFont(getFont());
+ g.drawString(label_or_gene, label_x_coord + 1,
+ vertical_offset + getFontAscent() + 1);
+
+ if(!show_labels)
+ g.setClip(saved_clip);
+ }
+
+ /**
+ * Return the position on the canvas where this segment starts. The
+ * returned value will be -1 if the position is off the left of the screen
+ * and will be(width of the canvas) if the position is off the right of
+ * the screen.
+ **/
+ private int getSegmentStartCoord(FeatureSegment segment)
+ {
+ final Marker segment_start_marker = segment.getStart();
+ int segment_start_coord =
+ getLowXPositionOfMarker(segment_start_marker);
+
+ // make sure we don't wrap around when drawing
+ if(segment_start_coord > getCanvas().getSize().width)
+ segment_start_coord = getCanvas().getSize().width;
+
+ // make sure we don't wrap around when drawing
+ if(segment_start_coord < 0)
+ segment_start_coord = -1;
+
+ return segment_start_coord;
+ }
+
+ /**
+ * Return the position on the canvas where this segment ends. The returned
+ * value will be -1 if the position is off the left of the screen and will
+ * be(width of the canvas) if the position is off the right of the screen.
+ **/
+ private int getSegmentEndCoord(FeatureSegment segment)
+ {
+ final Marker segment_end_marker = segment.getEnd();
+ int segment_end_coord = getHighXPositionOfMarker(segment_end_marker);
+
+ // make sure we don't wrap around when drawing
+ if(segment_end_coord > getCanvas().getSize().width)
+ segment_end_coord = getCanvas().getSize().width;
+
+ // make sure we don't wrap around when drawing
+ if(segment_end_coord < 0)
+ segment_end_coord = -1;
+
+ return segment_end_coord;
+ }
+
+ /**
+ * Return true if the base given by the Marker is visible.
+ **/
+ private boolean baseVisible(Marker marker)
+ {
+ final int first_visible_base = getForwardBaseAtLeftEdge();
+ final int last_visible_base = getLastVisibleForwardBase();
+
+ int marker_position = marker.getRawPosition();
+
+ if(isRevCompDisplay())
+ marker_position = getBases().getComplementPosition(marker_position);
+
+ if(marker_position < first_visible_base ||
+ marker_position > last_visible_base)
+ return false;
+ else
+ return true;
+ }
+
+ /**
+ * Return if and only if the segment is(partly) within the range of bases
+ * we are currently displaying.
+ * @param segment The FeatureSegment to check.
+ **/
+ private boolean segmentVisible(FeatureSegment segment)
+ {
+ int segment_start_coord = getSegmentStartCoord(segment);
+ int segment_end_coord = getSegmentEndCoord(segment);
+
+ if(segment_end_coord < 0 && segment_start_coord < 0 ||
+ segment_start_coord >= getCanvas().getSize().width &&
+ segment_end_coord >= getCanvas().getSize().width)
+ return false;
+ else
+ return true;
+ }
+
+ /**
+ * Return if and only if some part of a feature is(partly) within the
+ * range of bases we are currently displaying.
+ * @param feature The Feature to check.
+ **/
+ private boolean featureVisible(Feature feature)
+ {
+ if(getMinimumScore() > 0)
+ {
+ final int feature_score = feature.getScore();
+
+ if(feature_score != -1 && feature_score < getMinimumScore())
+ return false;
+ }
+
+ final FeatureSegmentVector segments = feature.getSegments();
+
+ for(int i = 0 ; i < segments.size() ; ++i)
+ {
+ if(segmentVisible(segments.elementAt(i)))
+ return true;
+ }
+
+ return false;
+ }
+
+ /**
+ * Draw one FeatureSegment into a Graphics object.
+ * @param g The Graphics object on which to draw.
+ * @param segment The feature segment to draw
+ * @param highlight_feature If true draw an extra thick line
+ * @param highlight_segment If true draw the segment with a doubly thick
+ * line.
+ * @param draw_feature_fill If true then just the solid block of colour
+ * inside the segments will be drawn. If false then only the feature
+ * outline is drawn.
+ * @param draw_arrow If true draw a direction arrow at the end of the
+ * segment.
+ **/
+ private void drawSegment(Graphics g, FeatureSegment segment,
+ boolean highlight_feature,
+ boolean highlight_segment,
+ boolean draw_feature_fill,
+ boolean draw_arrow)
+ {
+ // not on screen
+ if(!segmentVisible(segment))
+ return;
+
+ final Feature segment_feature = segment.getFeature();
+
+ final int vertical_offset = getSegmentVerticalOffset(segment) + 1;
+
+ int segment_start_coord = getSegmentStartCoord(segment);
+ int segment_end_coord = getSegmentEndCoord(segment);
+
+ final int segment_height = getFeatureHeight() - 1;
+
+ // this is 1 if the feature is on the forward strand or on a forward frame
+ // and -1 otherwise. this used to draw the feature arrow in the right
+ // direction.
+ final int feature_direction;
+ if(segment.getFeature().isForwardFeature() ^ isRevCompDisplay())
+ feature_direction = 1;
+ else
+ feature_direction = -1;
+
+ final int [] x_points = {
+ segment_start_coord, segment_end_coord,
+ segment_end_coord, segment_start_coord
+ };
+
+ final int [] y_points = {
+ vertical_offset, vertical_offset,
+ vertical_offset + segment_height, vertical_offset + segment_height
+ };
+
+ if(draw_feature_fill)
+ {
+ final Color feature_colour = segment_feature.getColour();
+
+ // no colour means draw in white
+ if(feature_colour == null)
+ g.setColor(Color.white);
+ else
+ g.setColor(feature_colour);
+
+ if(segment_feature.isForwardFeature() ^ isRevCompDisplay())
+ {
+ final int segment_width = segment_end_coord - segment_start_coord + 1;
+
+ g.fillRect(segment_start_coord, vertical_offset,
+ segment_width, segment_height + 1);
+ }
+ else
+ {
+ final int segment_width = segment_start_coord - segment_end_coord + 1;
+
+ g.fillRect(segment_end_coord, vertical_offset,
+ segment_width, segment_height + 1);
+ }
+ }
+ else
+ {
+ g.setColor(Color.black);
+ g.drawPolygon(x_points, y_points, 4);
+
+ if(highlight_feature) // highlight selected features
+ {
+ // selected - highlight by drawing a thicker line
+
+ x_points[0] -= feature_direction; x_points[1] += feature_direction;
+ x_points[2] += feature_direction; x_points[3] -= feature_direction;
+ y_points[0] -= 1; y_points[1] -= 1;
+ y_points[2] += 1; y_points[3] += 1;
+ g.drawPolygon(x_points, y_points, 4);
+
+ x_points[0] -= feature_direction; x_points[1] += feature_direction;
+ x_points[2] += feature_direction; x_points[3] -= feature_direction;
+ y_points[0] -= 1; y_points[1] -= 1;
+ y_points[2] += 1; y_points[3] += 1;
+ g.drawPolygon(x_points, y_points, 4);
+
+ if(highlight_segment) {
+ x_points[0] -= feature_direction; x_points[1] += feature_direction;
+ x_points[2] += feature_direction; x_points[3] -= feature_direction;
+ y_points[0] -= 1; y_points[1] -= 1;
+ y_points[2] += 1; y_points[3] += 1;
+ g.drawPolygon(x_points, y_points, 4);
+
+ x_points[0] -= feature_direction; x_points[1] += feature_direction;
+ x_points[2] += feature_direction; x_points[3] -= feature_direction;
+ y_points[0] -= 1; y_points[1] -= 1;
+ y_points[2] += 1; y_points[3] += 1;
+ g.drawPolygon(x_points, y_points, 4);
+ }
+ }
+
+ if(draw_arrow)
+ {
+ // now draw the arrow point
+ final int arrow_tip_x =
+ x_points[1] + feature_direction * getFontWidth() * 8 / 10;
+ final int arrow_tip_y =(y_points[1] + y_points[2]) / 2;
+
+ g.drawLine(x_points[1], y_points[1], arrow_tip_x, arrow_tip_y);
+ g.drawLine(arrow_tip_x, arrow_tip_y, x_points[2], y_points[2]);
+ }
+ }
+ }
+
+ /**
+ * Draw/highlight the selected range of bases on the FORWARD_STRAND or
+ * REVERSE_STRAND lines.
+ **/
+ private void drawBaseSelection(Graphics g)
+ {
+ final MarkerRange selection_range = getSelection().getMarkerRange();
+
+ if(selection_range == null)
+ return;
+
+ final Marker raw_start_base;
+ final Marker raw_end_base;
+
+ if(selection_range.getStrand().isForwardStrand())
+ {
+ raw_start_base = selection_range.getRawStart();
+ raw_end_base = selection_range.getRawEnd();
+ }
+ else
+ {
+ raw_start_base = selection_range.getRawEnd();
+ raw_end_base = selection_range.getRawStart();
+ }
+
+ final int start_coord = getLowXPositionOfMarker(raw_start_base);
+ final int end_coord = getHighXPositionOfMarker(raw_end_base);
+
+ // not on screen
+ if(start_coord > getCanvas().getSize().width &&
+ end_coord > getCanvas().getSize().width)
+ return;
+
+ // not on screen
+ if(start_coord < 0 && end_coord < 0)
+ return;
+
+ // the ID of the strand on which to draw the highlighting - this will be
+ // FORWARD_STRAND or REVERSE_STRAND.
+ final int strand_id;
+
+ if(selection_range.getStrand().isForwardStrand() ^
+ isRevCompDisplay())
+ strand_id = FORWARD_STRAND;
+ else
+ strand_id = REVERSE_STRAND;
+
+ if(!getOneLinePerEntryFlag())
+ {
+ // the ID of the frame on which to draw the highlighting - this will be
+ // FORWARD_FRAME_1, 2 or 3 or REVERSE_FRAME_1, 2 or 3.
+ final int frame_id;
+
+ if(selection_range.getStrand().isForwardStrand() ^
+ isRevCompDisplay())
+ {
+ switch((selection_range.getStart().getPosition() - 1) % 3)
+ {
+ case 0:
+ frame_id = FORWARD_FRAME_1;
+ break;
+ case 1:
+ frame_id = FORWARD_FRAME_2;
+ break;
+ case 2:
+ frame_id = FORWARD_FRAME_3;
+ break;
+ default:
+ frame_id = NO_FRAME;
+ }
+ }
+ else
+ {
+ switch((selection_range.getStart().getPosition() - 1) % 3)
+ {
+ case 0:
+ frame_id = REVERSE_FRAME_1;
+ break;
+ case 1:
+ frame_id = REVERSE_FRAME_2;
+ break;
+ case 2:
+ frame_id = REVERSE_FRAME_3;
+ break;
+ default:
+ frame_id = NO_FRAME;
+ }
+ }
+
+ if(show_forward_lines && strand_id == FORWARD_STRAND ||
+ show_reverse_lines && strand_id == REVERSE_STRAND)
+ drawBaseRange(g, start_coord, end_coord, frame_id, Color.pink);
+ }
+
+ drawBaseRange(g, start_coord, end_coord, strand_id, Color.yellow);
+ }
+
+ /**
+ * Draw a rectangle representing the currently selected bases.
+ * @param g The Graphics object on which to draw.
+ * @param start_coord The start x coordinate.
+ * @param start_coord The end x coordinate.
+ * @param frame_id The ID of the frame line where the box should be drawn.
+ * @param fill_colour The colour to use to draw the box(the border will be
+ * black).
+ **/
+ private void drawBaseRange(Graphics g,
+ int start_coord, int end_coord,
+ int frame_id,
+ Color fill_colour)
+ {
+ if(start_coord < -1)
+ start_coord = -1;
+
+ if(end_coord < -1)
+ end_coord = -1;
+
+ if(end_coord > getCanvasWidth())
+ end_coord = getCanvasWidth();
+
+ if(start_coord > getCanvasWidth())
+ start_coord = getCanvasWidth();
+
+ final int frame_line = getFrameDisplayLine(frame_id);
+
+ final int frame_line_y_coord = getLineOffset(frame_line);
+
+ final int [] x_points = {
+ start_coord, end_coord, end_coord, start_coord
+ };
+
+ final int [] y_points = {
+ frame_line_y_coord, frame_line_y_coord,
+ frame_line_y_coord + getFeatureHeight() + 1,
+ frame_line_y_coord + getFeatureHeight() + 1
+ };
+
+ g.setColor(fill_colour);
+
+ if(start_coord > end_coord)
+ g.fillRect(end_coord, frame_line_y_coord + 1,
+ start_coord - end_coord + 1, getFeatureHeight());
+ else
+ g.fillRect(start_coord, frame_line_y_coord + 1,
+ end_coord - start_coord + 1, getFeatureHeight());
+
+ g.setColor(Color.black);
+ g.drawPolygon(x_points, y_points, 4);
+ }
+
+ /**
+ * Return the number of button the user has down.
+ **/
+ private int buttonDownCount(final MouseEvent event)
+ {
+ int count = 0;
+ if((event.getModifiers() & InputEvent.BUTTON1_MASK) > 0)
+ ++count;
+
+ if((event.getModifiers() & InputEvent.BUTTON2_MASK) > 0)
+ ++count;
+
+ if((event.getModifiers() & InputEvent.BUTTON3_MASK) > 0)
+ ++count;
+
+ return count;
+ }
+
+ /**
+ * Add mouse and key listeners to the canvas.
+ **/
+ private void addListeners()
+ {
+ getCanvas().addMouseListener(new MouseAdapter()
+ {
+ /**
+ * Listen for mouse press events so that we can do popup menus and
+ * selection.
+ **/
+ public void mousePressed(MouseEvent event)
+ {
+ // finish dragging if the user presses any other button because
+ // we may not get a mouseReleased() call on some platforms
+ if(click_segment_marker != null)
+ {
+ getEntryGroup().getActionController().endAction();
+ click_segment_marker = null;
+ }
+
+ //ignore
+ if(buttonDownCount(event) > 1)
+ return;
+
+ last_mouse_press_event = event;
+ handleCanvasMousePress(event);
+
+ if(isMenuTrigger(event))
+ {
+ final FeaturePopup popup =
+ new FeaturePopup(FeatureDisplay.this,
+ getEntryGroup(),
+ getSelection(),
+ getGotoEventSource(),
+ getBasePlotGroup());
+ final JComponent parent = (JComponent)event.getSource();
+
+ parent.add(popup);
+ popup.show(parent, event.getX(), event.getY());
+ }
+ }
+
+ /**
+ * Listen for mouse release events so that we can call endAction().
+ **/
+ public void mouseReleased(MouseEvent event)
+ {
+ last_mouse_press_event = null;
+
+ if(click_segment_marker != null)
+ {
+ getEntryGroup().getActionController().endAction();
+ click_segment_marker = null;
+ }
+ }
+ });
+
+ // Listen for mouse motion events so that we can select ranges of bases.
+ getCanvas().addMouseMotionListener(new MouseMotionAdapter() {
+ public void mouseDragged(MouseEvent event)
+ {
+ if(last_mouse_press_event != null &&
+ !isMenuTrigger(last_mouse_press_event))
+ handleCanvasMouseDrag(event);
+ }
+ });
+
+ getCanvas().addKeyListener(new KeyAdapter() {
+ public void keyPressed(final KeyEvent event)
+ {
+ handleKeyPress(FeatureDisplay.this, event);
+ }
+ });
+ }
+
+ /**
+ * Handle a mouse press event on the drawing canvas - select on click,
+ * select and broadcast it on double click.
+ **/
+ private void handleCanvasMousePress(MouseEvent event)
+ {
+ if(event.getID() != MouseEvent.MOUSE_PRESSED)
+ return;
+
+ getCanvas().requestFocus();
+
+ if(event.getClickCount() == 2)
+ handleCanvasDoubleClick(event);
+ else
+ handleCanvasSingleClick(event);
+
+ getCanvas().repaint();
+ }
+
+ /**
+ * Handle a double click on the canvas.
+ **/
+ private void handleCanvasDoubleClick(MouseEvent event)
+ {
+ if(isMenuTrigger(event))
+ return;
+
+ if((event.getModifiers() & InputEvent.BUTTON2_MASK) != 0 ||
+ event.isAltDown())
+ {
+
+ final Selectable clicked_thing = getThingAtPoint(event.getPoint());
+
+ if(clicked_thing == null)
+ {
+ // select the ORF around the click position
+ final MarkerRange new_click_range =
+ getMarkerRangeFromPosition(event.getPoint());
+
+ if(new_click_range == null)
+ return;
+
+ final MarkerRange orf_range =
+ Strand.getORFAroundMarker(new_click_range.getStart(), true);
+
+ // user clicked on a stop codon
+ if(orf_range == null)
+ return;
+ else
+ getSelection().setMarkerRange(orf_range);
+ }
+ else
+ {
+ // edit the selected Feature
+
+ final Feature clicked_feature = getFeatureOf(clicked_thing);
+
+ getSelection().set(clicked_feature);
+
+ if(Options.readWritePossible())
+ new FeatureEdit(clicked_feature, getEntryGroup(),
+ getSelection(),
+ getGotoEventSource()).show();
+ }
+ }
+
+ makeSelectionVisible();
+ }
+
+ /**
+ * Handle a single click on the canvas.
+ **/
+ private void handleCanvasSingleClick(MouseEvent event)
+ {
+ click_segment_marker = null;
+
+ final Selectable clicked_thing = getThingAtPoint(event.getPoint());
+
+ // treate alt modifier like pressing button 2
+ if(clicked_thing == null ||
+ (event.getModifiers() & InputEvent.BUTTON2_MASK) != 0)
+ {
+
+ // if the user presses the mouse button 2 on feature or segment we treat
+ // it like the feature/segment isn't there
+
+ // if the user hasn't clicked on anything then don't change the
+ // selection
+ if(isMenuTrigger(event))
+ return;
+
+ // something is selected but the user clicked on nothing with the
+ // shift key down - do nothing
+ if(event.isShiftDown() &&
+ getSelection().getAllFeatures().size() > 0)
+ return;
+
+ final MarkerRange old_selected_range = getSelection().getMarkerRange();
+
+ final MarkerRange new_click_range =
+ getMarkerRangeFromPosition(event.getPoint());
+
+ if(new_click_range == null)
+ {
+ click_range = null;
+ getSelection().clear();
+ return;
+ }
+
+ final MarkerRange new_selection_range;
+
+ if(!event.isShiftDown() || old_selected_range == null)
+ new_selection_range = new_click_range;
+ else
+ {
+ if(old_selected_range.getStrand() ==
+ new_click_range.getStrand())
+ {
+ // extend the selection
+ new_selection_range =
+ old_selected_range.combineRanges(new_click_range, true);
+ }
+ else
+ new_selection_range = old_selected_range;
+ }
+
+ getSelection().setMarkerRange(new_selection_range);
+ click_range = new_selection_range;
+
+ }
+ else
+ {
+ // can't select a feature and a MarkerRange
+ if(getSelection().getMarkerRange() != null &&
+ event.isShiftDown())
+ return;
+
+ // clear the MarkerRange because this isn't the start of a range drag
+ click_range = null;
+
+ getSelection().setMarkerRange(null);
+ final Feature clicked_feature = getFeatureOf(clicked_thing);
+ raiseFeature(clicked_feature);
+
+ if(clicked_thing instanceof Feature)
+ {
+ // toggle the feature in or out of the selection unless this event
+ // is a popup trigger in which case we should just make sure the
+ // feature is in the selection
+ if(getSelection().contains(clicked_feature))
+ {
+ if(! isMenuTrigger(event))
+ {
+ // change the selection only if the user isn't popping up a menu
+ if(event.isShiftDown())
+ getSelection().remove(clicked_feature);
+ else
+ getSelection().set(clicked_feature);
+ }
+ }
+ else
+ {
+ if(event.isShiftDown())
+ getSelection().add(clicked_feature);
+ else
+ getSelection().set(clicked_feature);
+ }
+ }
+ else
+ {
+ // must be a FeatureSegment
+
+ // toggle the feature segment in or out of the selection unless
+ // this event is a popup trigger in which case we should just make
+ // sure the segment is in the selection
+ final FeatureSegment clicked_segment =
+ (FeatureSegment) clicked_thing;
+
+ final FeatureSegmentVector selected_feature_segments =
+ getSelection().getSelectedSegments();
+
+ if(selected_feature_segments.contains(clicked_segment))
+ {
+ if(! isMenuTrigger(event))
+ {
+ if(event.isShiftDown())
+ getSelection().remove(clicked_segment);
+ else
+ getSelection().set(clicked_segment);
+ }
+ }
+ else
+ {
+ if(event.isShiftDown())
+ {
+ final FeatureVector selected_features =
+ getSelection().getSelectedFeatures();
+
+ if(selected_features.contains(clicked_feature))
+ getSelection().remove(clicked_feature);
+ else
+ getSelection().add(clicked_segment);
+ }
+ else
+ getSelection().set(clicked_segment);
+ }
+ }
+
+ if(Options.getOptions().canDirectEdit() &&
+ !clicked_feature.isReadOnly())
+ {
+ // check to see if the click was on a marker, the second argument is
+ // false because we want the range to cover just one base
+
+ final MarkerRange new_click_range =
+ getMarkerRangeFromPosition(event.getPoint(), false);
+
+ // search the feature to find if the start Marker of any of the
+ // segments matches the start Marker of new_click_range or if an end
+ // Marker matches the end Marker of new_click_range
+
+ final FeatureSegmentVector segments = clicked_feature.getSegments();
+
+ for(int i = 0 ; i < segments.size() ; ++i)
+ {
+ final FeatureSegment this_segment = segments.elementAt(i);
+
+ if(new_click_range.getStart().equals(this_segment.getStart()) &&
+ this_segment.canDirectEdit())
+ {
+ click_segment_marker = this_segment.getStart();
+ click_segment_marker_is_start_marker = true;
+ other_end_of_segment_marker = this_segment.getEnd();
+ getEntryGroup().getActionController().startAction();
+ break;
+ }
+
+ if(new_click_range.getEnd().equals(this_segment.getEnd()) &&
+ this_segment.canDirectEdit())
+ {
+ click_segment_marker = this_segment.getEnd();
+ click_segment_marker_is_start_marker = false;
+ other_end_of_segment_marker = this_segment.getStart();
+ getEntryGroup().getActionController().startAction();
+ break;
+ }
+ }
+ }
+ }
+ }
+
+ /**
+ * This is a helper method for handleCanvasSingleClick() and
+ * handleCanvasDoubleClick().
+ * @param object The should be an instance of Feature or FeatureSegment.
+ * @return If the the argument is a Feature it is returned, if it is a
+ * FeatureSegment the owning Feature is returned.
+ **/
+ private Feature getFeatureOf(final Object object)
+ {
+ if(object instanceof Feature)
+ return(Feature) object;
+ else
+ // object must be a FeatureSegment
+ return((FeatureSegment) object).getFeature();
+ }
+
+ /**
+ * Handle a mouse drag that started on a Marker from a FeatureSegment.
+ **/
+ private void handleMarkerDrag(final MouseEvent event)
+ {
+ MarkerRange drag_range =
+ getMarkerRangeFromPosition(event.getPoint(), false);
+
+ if(drag_range == null)
+ return;
+
+ final int new_position;
+
+ if(click_segment_marker_is_start_marker)
+ {
+ // the Marker is at the start of the segment
+ new_position = drag_range.getStart().getPosition();
+
+ // don't go past the other end of the segment
+ if(new_position > other_end_of_segment_marker.getPosition())
+ return;
+ }
+ else
+ {
+ new_position = drag_range.getEnd().getPosition();
+
+ // don't go past the other end of the segment
+ if(new_position < other_end_of_segment_marker.getPosition())
+ return;
+ }
+
+ try
+ {
+ click_segment_marker.setPosition(new_position);
+
+ if(!baseVisible(click_segment_marker))
+ makeBaseVisible(click_segment_marker);
+ }
+ catch(OutOfRangeException e)
+ {
+ throw new Error("internal error - unexpected OutOfRangeException");
+ }
+ }
+
+ /**
+ * Handle a mouse drag event on the drawing canvas.
+ **/
+ private void handleCanvasMouseDrag(final MouseEvent event)
+ {
+ if(event.isShiftDown() &&
+ getSelection().getAllFeatures().size() > 0)
+ return;
+
+ if(click_segment_marker != null)
+ {
+ handleMarkerDrag(event);
+ return;
+ }
+
+ MarkerRange drag_range = getMarkerRangeFromPosition(event.getPoint());
+
+ if(drag_range == null)
+ return;
+
+ final MarkerRange selected_range = getSelection().getMarkerRange();
+
+ // if the start and current positions of the drag are not on the
+ // same Strand then ignore this event
+ if(selected_range != null &&
+ drag_range.getStrand() != selected_range.getStrand())
+ return;
+
+ try
+ {
+ // user has dragged off the screen so use a marker at position 1
+ if(drag_range.getStart().getPosition() < 1)
+ drag_range = new MarkerRange(drag_range.getStrand(), 1, 1);
+
+ // user has dragged off the screen so use a marker at position the
+ // end of the sequence
+ if(drag_range.getEnd().getPosition() > getSequenceLength())
+ drag_range = new MarkerRange(drag_range.getStrand(),
+ getSequenceLength(),
+ getSequenceLength());
+ }
+ catch(OutOfRangeException e)
+ {
+ throw new Error("internal error - unexpected OutOfRangeException");
+ }
+
+ final boolean start_base_is_visible = baseVisible(drag_range.getStart());
+ final boolean end_base_is_visible = baseVisible(drag_range.getEnd());
+
+ if(!start_base_is_visible)
+ makeBaseVisible(drag_range.getStart());
+
+ if(!end_base_is_visible)
+ makeBaseVisible(drag_range.getEnd());
+
+ // scrolling was necessary so update the visible features vector
+ if(!start_base_is_visible || !end_base_is_visible)
+ needVisibleFeatureVectorUpdate();
+
+ final MarkerRange new_marker_range;
+
+ if(click_range == null)
+ new_marker_range = drag_range;
+ else
+ new_marker_range = selected_range.combineRanges(drag_range, true);
+
+ getSelection().setMarkerRange(new_marker_range);
+
+ getCanvas().repaint();
+ }
+
+ /**
+ * Return the reference of the Object at p on the canvas or null if there
+ * is none. The returned Object will be a Feature or a FeatureSegment.
+ **/
+ private Selectable getThingAtPoint(Point p)
+ {
+ final int line_of_point = getLineFromPoint(p);
+
+ // point is not on a forward or reverse frame or strand
+ if(line_of_point == -1)
+ return null;
+
+ // go through the features in reverse order because the feature that is
+ // drawn last will be on top
+ for(int i = getVisibleFeatures().size() - 1 ; i >= 0 ; --i)
+ {
+ final Feature current_feature = getVisibleFeatures().elementAt(i);
+ final FeatureSegmentVector segments = current_feature.getSegments();
+
+ for(int segment_index = 0; segment_index < segments.size();
+ ++segment_index)
+ {
+ final FeatureSegment current_segment =
+ segments.elementAt(segment_index);
+
+ final int line_of_segment = getSegmentDisplayLine(current_segment);
+
+ if(line_of_segment == line_of_point ||
+ show_labels && line_of_segment + 1 == line_of_point)
+ {
+ // this segment is in the right frame so check that it is between
+ // the start and end positions of the segment
+
+ if(p.x >= getSegmentStartCoord(current_segment) &&
+ p.x <= getSegmentEndCoord(current_segment) ||
+ p.x <= getSegmentStartCoord(current_segment) &&
+ p.x >= getSegmentEndCoord(current_segment))
+ {
+ final Feature segment_feature = current_segment.getFeature();
+
+ // special case - if there is only one segment then select the
+ // whole feature
+ if(segment_feature.getSegments().size() == 1)
+ return segment_feature;
+ else
+ return current_segment;
+ }
+ }
+ }
+ }
+
+ return null;
+ }
+
+ /**
+ * Create and add a new scroll bar to this FeatureDisplay.
+ **/
+ private void createScrollbar(final boolean scrollbar_at_top)
+ {
+ scrollbar = new JScrollBar(Scrollbar.HORIZONTAL);
+ scrollbar.addAdjustmentListener(new AdjustmentListener()
+ {
+ public void adjustmentValueChanged(AdjustmentEvent e)
+ {
+ if(left_edge_base != e.getValue())
+ {
+ if(e.getValue() < getSequenceLength())
+ left_edge_base = e.getValue();
+ else
+ {
+ if(left_edge_base == getSequenceLength())
+ return;
+ else
+ left_edge_base = getSequenceLength();
+ }
+
+ fireAdjustmentEvent(DisplayAdjustmentEvent.SCROLL_ADJUST_EVENT);
+
+ needVisibleFeatureVectorUpdate();
+ getCanvas().repaint();
+ }
+ }
+ });
+
+ if(scrollbar_at_top)
+ getMidPanel().add(scrollbar, "North");
+ else
+ getMidPanel().add(scrollbar, "South");
+
+ fixScrollbar();
+ fireAdjustmentEvent(DisplayAdjustmentEvent.ALL_CHANGE_ADJUST_EVENT);
+ }
+
+ /**
+ * Send a DisplayAdjustmentEvent with the current start and end base to
+ * each of the listeners. This has package scope because EntryEdit
+ * components need to send this event when a new BasePlot component is
+ * added. The BasePlot needs to know the first visible base, last visible
+ * base and the maximum number of visible bases before the plot can be
+ * drawn.
+ * @param type the type of event: DisplayAdjustmentEvent.SCALE_ADJUST_EVENT,
+ * DisplayAdjustmentEvent.SCROLL_ADJUST_EVENT or
+ * DisplayAdjustmentEvent.ALL_CHANGE_ADJUST_EVENT.
+ **/
+ void fireAdjustmentEvent(final int type)
+ {
+ if(disable_display_events)
+ return;
+
+ final DisplayAdjustmentEvent event =
+ new DisplayAdjustmentEvent(this,
+ getForwardBaseAtLeftEdge(),
+ getLastVisibleForwardBase(),
+ getMaxVisibleBases(),
+ getScaleValue(), getScaleFactor(),
+ isRevCompDisplay(), type);
+
+ fireAction(adjustment_listener_list, event);
+ }
+
+ /**
+ * Send an event to those object listening for it.
+ * @param listeners A Vector of the objects that the event should be sent
+ * to.
+ * @param event The event to send
+ **/
+ private void fireAction(Vector listeners, ChangeEvent event)
+ {
+ final Vector targets;
+ // copied from a book - synchronizing the whole method might cause a
+ // deadlock
+ synchronized(this)
+ {
+ targets =(Vector) listeners.clone();
+ }
+
+ for(int i = 0; i < targets.size(); ++i)
+ {
+ ChangeListener change_listener = (ChangeListener)targets.elementAt(i);
+
+ final DisplayAdjustmentListener target =
+ (DisplayAdjustmentListener)change_listener;
+ target.displayAdjustmentValueChanged((DisplayAdjustmentEvent)event);
+ }
+ }
+
+ /**
+ * Create the scroll bar used for changing the scale and add it to the
+ * FeatureDisplay.
+ **/
+ private void createScaleScrollbar()
+ {
+ scale_changer = new JScrollBar(Scrollbar.VERTICAL);
+ // try to arrange for the scrollbar to have a maximum value big enough
+ // that the whole sequence can be visible at once
+ final int MAX_FACTOR =
+ (int)Math.round(Math.log(getSequenceLength()/20) / Math.log(3));
+ scale_changer.setValues(getScaleFactor(), 1, 0, MAX_FACTOR);
+ scale_changer.setBlockIncrement(1);
+ scale_changer.setUnitIncrement(1);
+ scale_changer.addAdjustmentListener(new AdjustmentListener()
+ {
+ public void adjustmentValueChanged(AdjustmentEvent e)
+ {
+ setScaleFactor(e.getValue());
+ }
+ });
+
+ add(scale_changer, "East");
+
+ if(scale_factor >= MAX_FACTOR)
+ setScaleFactor(MAX_FACTOR - 1);
+ }
+
+ /**
+ * Update the parameters of the scrollbar taking changes to the entry_group
+ * into account.
+ **/
+ private void fixScrollbar()
+ {
+ if(scrollbar == null)
+ return;
+
+ final int sequence_length = getSequenceLength();
+
+ final int max_visible_bases;
+
+ // make sure max_visible_bases is at least 1 to stop setBlockIncrement()
+ // from complaining
+ if(getMaxVisibleBases() > 0)
+ max_visible_bases = getMaxVisibleBases();
+ else
+ max_visible_bases = 1;
+
+ // initial_value, visible, minimum, maximum
+ scrollbar.setValues(getForwardBaseAtLeftEdge(),
+ max_visible_bases,
+ hard_left_edge ? 1 : -max_visible_bases / 2,
+ sequence_length + max_visible_bases / 2);
+
+ scrollbar.setBlockIncrement(max_visible_bases);
+
+ if(max_visible_bases >= 10 && getScaleFactor() > 0)
+ scrollbar.setUnitIncrement(max_visible_bases / 10);
+ else
+ scrollbar.setUnitIncrement(1);
+ }
+
+ /**
+ * Set the size of the canvas, taking the value of font_height and
+ * show_label into account.
+ **/
+ private void fixCanvasSize()
+ {
+ final int new_width = getCanvas().getSize().width;
+ final int new_height = getLineHeight() * getLineCount();
+
+ if(new_height != getCanvas().getSize().width ||
+ new_width != getCanvas().getSize().height)
+ {
+ final Dimension preferred_size =
+ new Dimension(getCanvas().getSize().width, new_height);
+ getCanvas().setPreferredSize(preferred_size);
+
+ final Dimension minimum_size = new Dimension(1, new_height);
+ getCanvas().setMinimumSize(minimum_size);
+
+ getCanvas().revalidate();
+ getCanvas().repaint();
+ }
+ }
+
+ /**
+ * Returns the base length of the sequence we are displaying in this
+ * component.
+ **/
+ public int getSequenceLength()
+ {
+ return getEntryGroup().getSequenceLength();
+ }
+
+ /**
+ * Set the first visible base in the forward direction (set the base on the
+ * forward strand that is on the left of the canvas). This method will
+ * scroll the display so that this base is is at the very left hand side of
+ * the canvas.
+ **/
+ private void setFirstVisibleForwardBase(int new_position)
+ {
+ if(left_edge_base != new_position)
+ {
+ left_edge_base = new_position;
+ if(scrollbar != null)
+ scrollbar.setValue(new_position);
+
+ needVisibleFeatureVectorUpdate();
+ getCanvas().repaint();
+ }
+ }
+
+ /**
+ * Return the height each line of the display should be. Each frame will
+ * be drawn into one line.
+ **/
+ private int getLineHeight()
+ {
+ return getFontHeight();
+ }
+
+ /**
+ * Return the current scale factor. The scale factor is a number greater
+ * than or equal to zero than controls the number of bases that can appear
+ * on screen. See getScaleValue().
+ **/
+ public int getScaleFactor()
+ {
+ return scale_factor;
+ }
+
+ /**
+ * Return the ID of the first(ie. top) line of the display.
+ **/
+ private int getFirstLineID()
+ {
+ if(show_forward_lines)
+ return FORWARD_FRAME_1;
+ else
+ return FORWARD_STRAND;
+ }
+
+ /**
+ * Return the ID of the last(ie. bottom) line of the display.
+ **/
+ private int getLastLineID()
+ {
+ if(show_reverse_lines)
+ return REVERSE_FRAME_1;
+ else
+ return REVERSE_STRAND;
+ }
+
+ /**
+ * Return the display line that contains the given point, or -1 if
+ * the point is off screen.
+ **/
+ private int getLineFromPoint(final Point point)
+ {
+ if(point.y >= getCanvasHeight())
+ return -1;
+
+ final int return_value = point.y / getLineHeight();
+
+ if(return_value < 0)
+ return -1;
+ else
+ return return_value;
+ }
+
+ /**
+ * Return the ID of the frame at the given Point in the canvas or NO_FRAME
+ * if the Point is not within a frame. If labels are on then points on the
+ * label lines get returned as the frame id of the STRAND or FRAME line
+ * above.
+ **/
+ private int getFrameFromPoint(final Point point)
+ {
+ if(getOneLinePerEntryFlag())
+ {
+ // there are no frame lines so just look at the strand lines
+ final int line_point = getLineFromPoint(point);
+ if(line_point == getFrameDisplayLine(FORWARD_STRAND) ^
+ isRevCompDisplay())
+ return FORWARD_STRAND;
+
+ if(line_point == getFrameDisplayLine(REVERSE_STRAND) ^
+ isRevCompDisplay())
+ return REVERSE_STRAND;
+
+ // fall through
+ }
+ else
+ {
+ final int start_frame = getFirstLineID();
+ final int end_frame = getLastLineID();
+
+ for(int i = start_frame ; i <= end_frame ; ++i) {
+ final int top_of_line = getLineOffset(getFrameDisplayLine(i));
+ final int line_height;
+
+ if(show_labels)
+ line_height = getLineHeight() * 2;
+ else
+ line_height = getLineHeight();
+
+ if(point.y >= top_of_line &&
+ point.y < top_of_line + line_height)
+ return i;
+ }
+ }
+ // the point isn't in any or the frames
+ return NO_FRAME;
+ }
+
+ /**
+ * Return the base number of the first visible base displayed in the
+ * forward direction, ie the base on the forward(or top strand) that is on
+ * the left each of the canvas. Note that the strand that is currently
+ * being display in the forward direction will be the reverse strand if
+ * rev_comp_display is true. The number returned will always be > 1 and <
+ * the sequence length. If hard_left_edge is true this method will always
+ * return the same as getForwardBaseAtLeftEdge*(.
+ **/
+ public int getFirstVisibleForwardBase()
+ {
+ if(left_edge_base < 1)
+ return 1;
+ else
+ return left_edge_base;
+ }
+
+ /**
+ * Return the base number of the first visible base displayed in the
+ * forward direction, ie the base on the forward(or top strand) that is on
+ * the left each of the canvas. Note that the strand that is currently
+ * being display in the forward direction will be the reverse strand if
+ * rev_comp_display is true.
+ **/
+ public int getForwardBaseAtLeftEdge()
+ {
+ return left_edge_base;
+ }
+
+ /**
+ * Return a base marker of the first visible base in the forward
+ * direction, ie the base on the forward strand that is on the left
+ * each of the canvas. See comments on getFirstVisibleForwardBase().
+ **/
+ private Marker getFirstVisibleForwardBaseMarker()
+ {
+ try
+ {
+ final Strand strand;
+ if(isRevCompDisplay())
+ strand = getBases().getReverseStrand();
+ else
+ strand = getBases().getForwardStrand();
+
+ return strand.makeMarker(getFirstVisibleForwardBase());
+ }
+ catch(OutOfRangeException e)
+ {
+ throw new Error("internal error - unexpected OutOfRangeException");
+ }
+ }
+
+ /**
+ * Return the base number of the last visible base in the forward
+ * direction, ie the base on the forward strand that is on the right
+ * edge of the canvas. The number returned will always be > 1 and < the
+ * sequence length.
+ **/
+ public int getLastVisibleForwardBase()
+ {
+ final int possible_last_base =
+ (int)(getForwardBaseAtLeftEdge() + getMaxVisibleBases());
+
+ if(possible_last_base > getSequenceLength())
+ return getSequenceLength();
+ else
+ {
+ if(possible_last_base > 0)
+ return possible_last_base;
+ else
+ return 1;
+ }
+ }
+
+ /**
+ * Return the base number of the first visible base in the reverse
+ * direction , ie the base on the reverse strand that is on the left
+ * each of the canvas.
+ **/
+ private int getFirstVisibleReverseBase()
+ {
+ final int last_forward_base = getLastVisibleForwardBase();
+ return getBases().getComplementPosition(last_forward_base);
+ }
+
+ /**
+ * Return the base number of the last visible base in the reverse
+ * direction, ie the base on the reverse strand that is on the right
+ * edge of the canvas.
+ **/
+ private int getLastVisibleReverseBase()
+ {
+ // XXX
+ final int first_forward_base = getFirstVisibleForwardBase();
+ return getBases().getComplementPosition(first_forward_base);
+ }
+
+ /**
+ * Return the base of the forward Strand of the sequence that is closest to
+ * the centre of the view.
+ **/
+ private int getCentreForwardBase()
+ {
+ int possible_return_position =
+ getForwardBaseAtLeftEdge() + getMaxVisibleBases() / 2;
+
+ int return_position;
+
+ if(possible_return_position < getSequenceLength())
+ return_position = possible_return_position;
+ else
+ return_position = getSequenceLength();
+
+ return return_position;
+ }
+
+ /**
+ * Return the amount display is scaled. The value is 3 to the power of
+ * -(scale_factor - 1), except for a scale_factor of zero which gives a
+ * scale value of font_width.
+ **/
+ float getScaleValue()
+ {
+ return scale_value;
+ }
+
+ /**
+ * Return the height in pixels we should use for drawing features.
+ **/
+ private int getFeatureHeight()
+ {
+ // don't use getLineHeight() because we want a nice space between
+ // frames/lines
+ return getFontAscent() + 2;
+ }
+
+ /**
+ * Return the number of bases we can fit on screen at once, ie the number
+ * that will fit side by side on the canvas.
+ **/
+ public int getMaxVisibleBases()
+ {
+ return(int)(getCanvasWidth() / getScaleValue());
+ }
+
+ /**
+ * Return the Bases object of the EntryGroup that this FeatureDisplay is
+ * displaying.
+ **/
+ public Bases getBases()
+ {
+ return getEntryGroup().getBases();
+ }
+
+ /**
+ * Update the value of scale_value to reflect the current value of
+ * scale_factor.
+ **/
+ private void setScaleValue()
+ {
+ final int scale_factor = getScaleFactor();
+
+ if(scale_factor > 0)
+ scale_value =(float)(1 / Math.pow(3, scale_factor - 1));
+ else
+ scale_value = getFontWidth();
+ }
+
+ /**
+ * Scroll and scale the display so that the given first base is at the left
+ * edge of the screen and the given last base is at the right edge.
+ **/
+ public void setFirstAndLastBase(final int first, final int last)
+ {
+ left_edge_base = first;
+ setScaleValue(1.0F * getCanvasWidth() /(last - first + 1));
+ }
+
+ /**
+ * Scroll the display so that the given first base is at the left edge of
+ * the screen.
+ **/
+ public void setFirstBase(int base_position)
+ {
+ if(base_position > getSequenceLength())
+ base_position = getSequenceLength();
+
+ if(base_position < 1 && hard_left_edge)
+ base_position = 1;
+
+ setFirstVisibleForwardBase(base_position);
+ fireAdjustmentEvent(DisplayAdjustmentEvent.SCROLL_ADJUST_EVENT);
+ }
+
+ /**
+ * Set the scale value to use for this FeatureDisplay. Note that it is
+ * better to call setScaleFactor() which will also set the scale value.
+ **/
+ private void setScaleValue(final float scale_value)
+ {
+ if(scale_value <= 0)
+ throw new Error("internal error in FeatureDisplay.setScaleValue() - " +
+ "scale value must be positive");
+
+ this.scale_value = scale_value;
+
+ if(scale_value > 1)
+ scale_factor = 1;
+ else
+ scale_factor =
+ (int) Math.round(Math.log(1/scale_value) / Math.log(3)) + 1;
+
+ scale_changer.setValue(scale_factor);
+
+ fixScrollbar();
+ needVisibleFeatureVectorUpdate();
+ getCanvas().repaint();
+ fireAdjustmentEvent(DisplayAdjustmentEvent.SCALE_ADJUST_EVENT);
+ }
+
+ /**
+ * Make a new Range and throw a Error is an OutOfRangeException occurs.
+ **/
+ private Range newRange(final int start, final int end)
+ {
+ try
+ {
+ return new Range(start, end);
+ }
+ catch(OutOfRangeException e)
+ {
+ throw new Error("internal error - unexpected exception: " + e);
+ }
+ }
+
+ /**
+ * Arrange for updateVisibleFeatureVector() to be called in the next call
+ * to paint()
+ **/
+ private void needVisibleFeatureVectorUpdate()
+ {
+ update_visible_features = true;
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/FeatureEdit.java b/uk/ac/sanger/artemis/components/FeatureEdit.java
new file mode 100644
index 000000000..bd4988755
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FeatureEdit.java
@@ -0,0 +1,1276 @@
+/* FeatureEdit.java
+ *
+ * created: Tue Dec 1 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000,2001,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/FeatureEdit.java,v 1.1 2004-06-09 09:46:38 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.util.*;
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import uk.ac.sanger.artemis.io.OutOfDateException;
+import uk.ac.sanger.artemis.io.LocationParseException;
+import uk.ac.sanger.artemis.io.InvalidRelationException;
+import uk.ac.sanger.artemis.io.QualifierParseException;
+import uk.ac.sanger.artemis.io.Range;
+import uk.ac.sanger.artemis.io.RangeVector;
+import uk.ac.sanger.artemis.io.Key;
+import uk.ac.sanger.artemis.io.KeyVector;
+import uk.ac.sanger.artemis.io.Location;
+import uk.ac.sanger.artemis.io.Qualifier;
+import uk.ac.sanger.artemis.io.QualifierVector;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.EntryInformationException;
+import uk.ac.sanger.artemis.io.StreamQualifier;
+import uk.ac.sanger.artemis.io.QualifierInfo;
+import uk.ac.sanger.artemis.io.EmblStreamFeature;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.io.*;
+import java.util.Date;
+
+import javax.swing.*;
+
+/**
+ * FeatureEdit class
+ *
+ * @author Kim Rutherford
+ * @version $Id: FeatureEdit.java,v 1.1 2004-06-09 09:46:38 tjc Exp $
+ **/
+
+public class FeatureEdit
+ extends JFrame
+ implements EntryChangeListener, FeatureChangeListener {
+ /**
+ * Create a new FeatureEdit object from the given Feature.
+ * @param entry_group The EntryGroup that contains this Feature.
+ * @param selection The Selection operate on. The operations are "Remove
+ * Range" and "Grab Range"
+ * @param goto_event_source The object the we will call gotoBase () on.
+ **/
+ public FeatureEdit (final Feature edit_feature,
+ final EntryGroup entry_group,
+ final Selection selection,
+ final GotoEventSource goto_event_source) {
+ super ("Artemis Feature Edit: " + edit_feature.getIDString () +
+ (edit_feature.isReadOnly () ?
+ " - (read only)" :
+ ""));
+
+ this.edit_feature = edit_feature;
+ this.edit_entry = edit_feature.getEntry ();
+ this.entry_group = entry_group;
+ this.selection = selection;
+ this.goto_event_source = goto_event_source;
+
+ createComponents ();
+
+ updateFromFeature ();
+
+ orig_qualifier_text = qualifier_text_area.getText ();
+
+ edit_feature.getEntry ().addEntryChangeListener (this);
+ edit_feature.addFeatureChangeListener (this);
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ stopListening ();
+ dispose ();
+ }
+ });
+
+ pack ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+
+ qualifier_text_area.requestFocus();
+ }
+
+ /**
+ * Remove this object as a feature and entry change listener.
+ **/
+ public void stopListening () {
+ getEntry ().removeEntryChangeListener (this);
+ getFeature ().removeFeatureChangeListener (this);
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface. We listen to
+ * EntryChange events so we can notify the user if of this component if the
+ * feature gets deleted.
+ **/
+ public void entryChanged (EntryChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryChangeEvent.FEATURE_DELETED:
+ if (event.getFeature () == edit_feature) {
+ stopListening ();
+ dispose ();
+ }
+ break;
+ default:
+ // do nothing;
+ break;
+ }
+ }
+
+ /**
+ * Add an ActionListener to the Cancel JButton of this FeatureEdit.
+ **/
+ public void addCancelActionListener (final ActionListener l) {
+ cancel_button.addActionListener (l);
+ }
+
+ /**
+ * Remove an ActionListener from the Cancel JButton of this FeatureEdit.
+ **/
+ public void removeCancelActionListener (final ActionListener l) {
+ cancel_button.removeActionListener (l);
+ }
+
+ /**
+ * Add an ActionListener to the Apply JButton of this FeatureEdit.
+ **/
+ public void addApplyActionListener (final ActionListener l) {
+ apply_button.addActionListener (l);
+ }
+
+ /**
+ * Remove an ActionListener from the Apply JButton of this FeatureEdit.
+ **/
+ public void removeApplyActionListener (final ActionListener l) {
+ apply_button.removeActionListener (l);
+ }
+
+ /**
+ * Implementation of the FeatureChangeListener interface. We need to
+ * listen to feature change events from the Features in this object so that
+ * we can update the display.
+ * @param event The change event.
+ **/
+ public void featureChanged (FeatureChangeEvent event) {
+ // re-read the information from the feature
+ switch (event.getType ()) {
+ case FeatureChangeEvent.LOCATION_CHANGED:
+ updateLocation ();
+ break;
+ case FeatureChangeEvent.KEY_CHANGED:
+ updateKey ();
+ break;
+ case FeatureChangeEvent.QUALIFIER_CHANGED:
+ if (qualifier_text_area.getText ().equals (orig_qualifier_text)) {
+ updateFromFeature ();
+ } else {
+ final String message =
+ "warning: the qualifiers have changed outside the editor - " +
+ "view now?";
+
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog (FeatureEdit.this, message);
+
+ if (yes_no_dialog.getResult ()) {
+ new FeatureViewer (getFeature ());
+ }
+ }
+ break;
+ default:
+ updateFromFeature ();
+ break;
+ }
+ }
+
+
+ /**
+ * Create all the components for this FeatureEdit component.
+ **/
+ private void createComponents () {
+ qualifier_text_area = new QualifierTextArea ();
+
+ qualifier_text_area.setWrapStyleWord (true);
+
+ key_choice =
+ new KeyChoice (getEntryInformation (),getFeature ().getKey ());
+
+ final JPanel key_and_qualifier_panel = new JPanel ();
+
+ location_text.setBackground (Color.white);
+
+ final JPanel key_panel = new JPanel ();
+ key_panel.add (new JLabel ("Key:"));
+ key_panel.add (key_choice);
+
+ key_and_qualifier_panel.setLayout (new BorderLayout ());
+ key_and_qualifier_panel.add (key_panel, "West");
+
+ qualifier_choice = new QualifierChoice (getEntryInformation (),
+ key_choice.getSelectedItem (),
+ null);
+
+ final JPanel qualifier_panel = new JPanel ();
+
+ final JButton qualifier_add_button = new JButton ("Add Qualifier:");
+
+ qualifier_panel.add (qualifier_add_button);
+ qualifier_panel.add (qualifier_choice);
+
+ key_and_qualifier_panel.add (qualifier_panel, "East");
+
+ key_choice.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent _) {
+ qualifier_choice.setKey (key_choice.getSelectedItem ());
+ }
+ });
+
+ qualifier_add_button.addActionListener (new ActionListener () {
+ public void actionPerformed(ActionEvent e) {
+ final String qualifier_name =
+ (String) qualifier_choice.getSelectedItem ();
+
+ QualifierInfo qualifier_info =
+ getEntryInformation ().getQualifierInfo (qualifier_name);
+
+ if (qualifier_info == null) {
+ qualifier_info =
+ new QualifierInfo (qualifier_name,
+ QualifierInfo.OPTIONAL_QUOTED_TEXT,
+ null, null, false);
+ }
+
+ qualifier_text_area.append ("/" + qualifier_name);
+
+ switch (qualifier_info.getType ()) {
+ case QualifierInfo.QUOTED_TEXT:
+ if (qualifier_name.equals ("GO")) {
+ // special case for /GO
+ final java.util.Calendar calendar =
+ java.util.Calendar.getInstance ();
+
+ final java.util.Date current_time =
+ calendar.getTime ();
+
+ final java.text.SimpleDateFormat date_format =
+ new java.text.SimpleDateFormat("yyyyMMdd");
+
+ final StringBuffer result_buffer = new StringBuffer ();
+
+ date_format.format(current_time, result_buffer,
+ new java.text.FieldPosition(java.text.DateFormat.DATE_FIELD));
+
+ final String go_string =
+ "aspect=; term=; GOid=GO:; "+
+ "evidence=ISS; db_xref=GOC:unpublished; " +
+ "with=UNIPROT:; date=" + result_buffer;
+ qualifier_text_area.append ("=\"" + go_string + "\"");
+ } else {
+ qualifier_text_area.append ("=\"\"");
+ }
+ break;
+
+ case QualifierInfo.NO_VALUE:
+ case QualifierInfo.OPTIONAL_QUOTED_TEXT:
+ break;
+
+ default:
+ qualifier_text_area.append ("=");
+ }
+
+ qualifier_text_area.append ("\n");
+ }
+ });
+
+ final JPanel middle_panel = new JPanel ();
+ middle_panel.setLayout (new BorderLayout ());
+
+ final JPanel lower_panel = new JPanel ();
+ lower_panel.setLayout (new BorderLayout ());
+
+ final JPanel outer_location_button_panel = new JPanel ();
+ lower_panel.add (outer_location_button_panel, "North");
+ outer_location_button_panel.setLayout (new BorderLayout ());
+
+ final JPanel location_button_panel = new JPanel ();
+ outer_location_button_panel.add (location_button_panel, "West");
+
+ final JPanel location_panel = new JPanel ();
+ location_panel.setLayout (new BorderLayout ());
+ location_panel.add (new JLabel ("location: "), "West");
+ location_panel.add (location_text, "Center");
+
+ final JButton complement_button = new JButton ("Complement");
+ location_button_panel.add (complement_button);
+ complement_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ complementLocation ();
+ }
+ });
+
+ final JButton grab_button = new JButton ("Grab Range");
+ location_button_panel.add (grab_button);
+ grab_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ grabSelectedRange ();
+ }
+ });
+
+ final JButton remove_button = new JButton ("Remove Range");
+ location_button_panel.add (remove_button);
+ remove_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ removeSelectedRange ();
+ }
+ });
+
+ final JButton goto_button = new JButton ("Goto Feature");
+ location_button_panel.add (goto_button);
+ goto_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ goto_event_source.gotoBase (getFeature ().getFirstBaseMarker ());
+ }
+ });
+
+ final JButton select_button = new JButton ("Select Feature");
+ location_button_panel.add (select_button);
+ select_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ getSelection ().set (getFeature ());
+ }
+ });
+
+ final boolean sanger_options =
+ Options.getOptions ().getPropertyTruthValue ("sanger_options");
+
+ if (sanger_options) {
+ // a PSU only hack
+ final JButton tidy_button = new JButton ("Tidy");
+ location_button_panel.add (tidy_button);
+ tidy_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ try {
+ tidy ();
+ } catch (QualifierParseException exception) {
+ final String error_string = exception.getMessage ();
+ new MessageDialog (FeatureEdit.this,
+ "Cannot tidy - qualifier error: " +
+ error_string);
+ }
+ }
+ });
+ }
+
+ if (Options.getOptions ().getProperty ("external_editor") != null) {
+ final JButton external_fasta_edit_button = new JButton ("MESS/FASTA");
+ location_button_panel.add (external_fasta_edit_button);
+ external_fasta_edit_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ try {
+ if (getFeature ().getQualifierByName ("fasta_file") != null) {
+ final String DEFAULT_MAX_EUK_FASTA_HITS = "10";
+
+ final String max_fasta_hits;
+
+ final String max_fasta_hits_from_options =
+ Options.getOptions ().getProperty ("mess_fasta_hits");
+
+ if (Options.getOptions ().isEukaryoticMode ()) {
+ if (max_fasta_hits_from_options == null) {
+ max_fasta_hits = DEFAULT_MAX_EUK_FASTA_HITS;
+ } else {
+ max_fasta_hits = max_fasta_hits_from_options;
+ }
+
+ externalEdit (new String [] {
+ "-fasta",
+ "-maxhits",
+ max_fasta_hits,
+ "-euk"
+ });
+ } else {
+ if (max_fasta_hits_from_options == null) {
+ externalEdit (new String [] {
+ "-fasta"
+ });
+ } else {
+ externalEdit (new String [] {
+ "-fasta",
+ "-maxhits",
+ max_fasta_hits_from_options
+ });
+
+ }
+ }
+ return;
+ }
+ } catch (InvalidRelationException _) {
+ // fall through
+ }
+ new MessageDialog (FeatureEdit.this,
+ "nothing to edit - no /fasta_file qualifier");
+ }
+ });
+
+ final JButton external_blastp_edit_button = new JButton ("MESS/BLASTP");
+ location_button_panel.add (external_blastp_edit_button);
+ external_blastp_edit_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ try {
+ if (getFeature ().getQualifierByName ("blastp_file") != null) {
+ final String DEFAULT_MAX_BLASTP_HITS = "10";
+
+ final String max_blastp_hits;
+
+ final String max_blastp_hits_from_options =
+ Options.getOptions ().getProperty ("mess_blastp_hits");
+
+ if (max_blastp_hits_from_options == null) {
+ max_blastp_hits = DEFAULT_MAX_BLASTP_HITS;
+ } else {
+ max_blastp_hits = max_blastp_hits_from_options;
+ }
+
+ if (Options.getOptions ().isEukaryoticMode ()) {
+ externalEdit (new String [] {
+ "-blastp",
+ "-maxhits",
+ max_blastp_hits,
+ "-euk"
+ });
+ } else {
+ externalEdit (new String [] {
+ "-blastp",
+ "-maxhits",
+ max_blastp_hits
+ });
+ }
+ return;
+ }
+ } catch (InvalidRelationException _) {
+ // fall through
+ }
+ new MessageDialog (FeatureEdit.this,
+ "nothing to edit - no /blastp_file qualifier");
+ }
+ });
+
+ final JButton external_go_edit_button = new JButton ("MESS/GO");
+ location_button_panel.add (external_go_edit_button);
+ external_go_edit_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ try {
+ if (getFeature ().getQualifierByName ("blastp+go_file") != null) {
+ final String DEFAULT_MAX_GO_BLAST_HITS = "10";
+
+ final String max_go_blast_hits;
+
+ final String max_go_blast_hits_from_options =
+ Options.getOptions ().getProperty ("mess_blast_go_hits");
+
+ if (max_go_blast_hits_from_options == null) {
+ max_go_blast_hits = DEFAULT_MAX_GO_BLAST_HITS;
+ } else {
+ max_go_blast_hits = max_go_blast_hits_from_options;
+ }
+
+ if (Options.getOptions ().isEukaryoticMode ()) {
+ externalEdit (new String [] {
+ "-blastp+go",
+ "-maxhits",
+ max_go_blast_hits,
+ "-euk"
+ });
+ } else {
+ externalEdit (new String [] {
+ "-blastp+go",
+ "-maxhits",
+ max_go_blast_hits
+ });
+ }
+ return;
+ }
+ } catch (InvalidRelationException _) {
+ // fall through
+ }
+ new MessageDialog (FeatureEdit.this,
+ "nothing to edit - no /blastp+go_file qualifier");
+ }
+ });
+ }
+
+ middle_panel.add (location_panel, "North");
+
+ getContentPane ().add (key_and_qualifier_panel, "North");
+
+ cancel_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ stopListening ();
+ dispose ();
+ }
+ });
+
+ if (!getFeature ().isReadOnly ()) {
+ ok_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ if (setFeature ()) {
+ stopListening ();
+ dispose ();
+ }
+ }
+ });
+
+ apply_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ setFeature ();
+ }
+ });
+ }
+
+ final FlowLayout flow_layout =
+ new FlowLayout (FlowLayout.CENTER, 18, 5);
+
+ final JPanel ok_cancel_update_panel = new JPanel (flow_layout);
+
+ if (!getFeature ().isReadOnly ()) {
+ ok_cancel_update_panel.add (ok_button);
+ }
+
+ ok_cancel_update_panel.add (cancel_button);
+
+ if (!getFeature ().isReadOnly ()) {
+ ok_cancel_update_panel.add (apply_button);
+ }
+
+ getContentPane ().add (ok_cancel_update_panel, "South");
+
+ middle_panel.add (lower_panel, "Center");
+ lower_panel.add (new JScrollPane (qualifier_text_area), "Center");
+
+ getContentPane ().add (middle_panel, "Center");
+ }
+
+ /**
+ * Read the key, location and qualifier information from the feature and
+ * update the components.
+ **/
+ private void updateFromFeature () {
+ datestamp = getFeature ().getDatestamp ();
+
+ updateKey ();
+
+ updateLocation ();
+
+ updateQualifiers ();
+ }
+
+ /**
+ * Read the location from the feature and update the location field.
+ **/
+ private void updateLocation () {
+ location_text.setText (getFeature ().getLocation ().toStringShort ());
+ }
+
+ /**
+ * Complement the current location_text.
+ **/
+ private void complementLocation () {
+ if (rationalizeLocation ()) {
+ if (location_text.getText ().startsWith ("complement(")) {
+ final String new_text = location_text.getText ().substring (11);
+ if (new_text.endsWith (")")) {
+ final String new_text2 =
+ new_text.substring (0, new_text.length () - 1);
+ location_text.setText (new_text2);
+ } else {
+ location_text.setText (new_text);
+ }
+ } else {
+ final String new_text = location_text.getText ();
+
+ location_text.setText ("complement(" + new_text + ")");
+ }
+ } else {
+ new MessageDialog (this, "complement failed - " +
+ "current location cannot be parsed");
+ }
+ }
+
+ /**
+ * Tidy the qualifiers by removing any indication that the annotation has
+ * been transferred from another gene. Remove the "transferred_" part of
+ * all qualifier names and the "[[FROM sc_001234 abc1]]" bit of each
+ * corresponding qualifier value.
+ **/
+ private void tidy ()
+ throws QualifierParseException {
+ final StringBuffer buffer = new StringBuffer ();
+
+ final QualifierVector qualifiers =
+ qualifier_text_area.getParsedQualifiers (getEntryInformation ());
+
+ for (int qualifier_index = 0 ;
+ qualifier_index < qualifiers.size () ;
+ ++qualifier_index) {
+ final Qualifier this_qualifier = qualifiers.elementAt (qualifier_index);
+
+ final QualifierInfo qualifier_info =
+ getEntryInformation ().getQualifierInfo (this_qualifier.getName ());
+
+ final StringVector qualifier_strings =
+ StreamQualifier.toStringVector (qualifier_info, this_qualifier);
+
+ for (int value_index = 0 ;
+ value_index < qualifier_strings.size () ;
+ ++value_index) {
+
+ final String qualifier_string =
+ qualifier_strings.elementAt (value_index);
+
+ buffer.append (tidyHelper (qualifier_string) + "\n");
+ }
+ }
+
+ qualifier_text_area.setText (buffer.toString ());
+ }
+
+ /**
+ * Perform the action of tidy() on the String version of one qualifier.
+ **/
+ private String tidyHelper (final String qualifier_string) {
+ final String temp_string;
+
+ if (qualifier_string.startsWith ("/transferred_")) {
+ temp_string = "/" + qualifier_string.substring (13);
+ } else {
+ temp_string = qualifier_string;
+ }
+
+ final int start_index = temp_string.indexOf ("<<FROM ");
+ final int end_index = temp_string.indexOf (">>");
+
+ if (start_index != -1 && end_index != -1) {
+ if (temp_string.length () > end_index + 2 &&
+ temp_string.charAt (end_index + 2) == ' ') {
+ return temp_string.substring (0, start_index) +
+ temp_string.substring (end_index + 3);
+ } else {
+ return temp_string.substring (0, start_index) +
+ temp_string.substring (end_index + 2);
+ }
+ } else {
+ return temp_string;
+ }
+ }
+
+ /**
+ * Add the currently selected range to location_text.
+ **/
+ private void grabSelectedRange () {
+ if (!rationalizeLocation ()) {
+ new MessageDialog (this,
+ "grab failed - current location cannot be parsed");
+ return;
+ }
+
+ final Range selected_range = getSelection ().getSelectionRange ();
+
+ if (selected_range == null) {
+ new MessageDialog (this, "grab failed - nothing is selected");
+ return;
+ }
+
+ // save it in case it gets mangled
+ final String old_location_text = location_text.getText ();
+
+ if (old_location_text.endsWith ("))")) {
+ final String new_text =
+ old_location_text.substring (0, old_location_text.length () - 2);
+
+ location_text.setText (new_text + "," + selected_range.getStart () +
+ ".." + selected_range.getEnd () + "))");
+ } else {
+ if (old_location_text.endsWith (")")) {
+ final String new_text =
+ old_location_text.substring (0, old_location_text.length () - 1);
+
+ location_text.setText (new_text + "," + selected_range.getStart () +
+ ".." + selected_range.getEnd () + ")");
+ } else {
+ location_text.setText (old_location_text + "," +
+ selected_range.getStart () +
+ ".." + selected_range.getEnd ());
+ }
+ }
+
+ if (!rationalizeLocation ()) {
+ location_text.setText (old_location_text);
+ new MessageDialog (this,
+ "grab failed - location cannot be parsed after " +
+ "grabbing");
+ }
+ }
+
+ /**
+ * Remove the currently selected range of bases from location_text.
+ **/
+ private void removeSelectedRange () {
+ if (!rationalizeLocation ()) {
+ new MessageDialog (this,
+ "grab failed - current location cannot be parsed");
+ return;
+ }
+
+ final MarkerRange selected_marker_range =
+ getSelection ().getMarkerRange ();
+
+ if (selected_marker_range == null) {
+ new MessageDialog (this, "remove range failed - no bases are selected");
+ return;
+ }
+
+ final Range selected_range = selected_marker_range.getRawRange ();
+
+ if (selected_marker_range.getStrand () != getFeature ().getStrand ()) {
+ new MessageDialog (this, "remove range failed - you need to select " +
+ "some bases on the other strand");
+ return;
+ }
+
+ final Location location;
+
+ try {
+ location = new Location (location_text.getText ());
+ } catch (LocationParseException e) {
+ // this shouldn't happen because we called rationalizeLocation ()
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+
+ final Range location_total_range = location.getTotalRange ();
+
+ if (!selected_range.overlaps (location_total_range)) {
+ new MessageDialog (this, "remove range failed - the range you " +
+ "selected does not overlap the feature");
+ return;
+ }
+
+ if (selected_range.contains (location_total_range)) {
+ new MessageDialog (this, "remove range failed - the range you " +
+ "selected overlaps the whole feature");
+ return;
+ }
+
+ final RangeVector location_ranges = location.getRanges ();
+ final boolean location_is_complemented = location.isComplement ();
+
+ final RangeVector new_ranges = new RangeVector ();
+
+ // if the selected_range completely covers a range remove the
+ // range. otherwise if the selected_range is completely within one of the
+ // ranges two new ranges are created. if the selected_range is not
+ // completely contained then the appropriate end of the range is truncated
+ for (int i = 0 ; i < location_ranges.size () ; ++i) {
+ final Range this_range = location_ranges.elementAt (i);
+
+ if (selected_range.overlaps (this_range)) {
+ try {
+ if (this_range.contains (selected_range) &&
+ this_range.getStart () != selected_range.getStart () &&
+ this_range.getEnd () != selected_range.getEnd ()) {
+ // chop a piece out of the middle and make two new ranges
+ final Range new_start_range =
+ this_range.change (selected_range.getEnd () + 1,
+ this_range.getEnd ());
+ new_ranges.add (new_start_range);
+ final Range new_end_range =
+ this_range.change (this_range.getStart (),
+ selected_range.getStart () - 1);
+ new_ranges.add (new_end_range);
+ } else {
+ if (selected_range.contains (this_range)) {
+ // delete (ie. don't copy) the range
+ } else {
+ if (this_range.getStart () < selected_range.getStart ()) {
+ // truncate the end of the range
+ final Range new_start_range =
+ this_range.change (this_range.getStart (),
+ selected_range.getStart () - 1);
+ new_ranges.add (new_start_range);
+ } else {
+ if (this_range.getEnd () > selected_range.getEnd ()) {
+ // truncate the start of the range
+ final Range new_end_range =
+ this_range.change (selected_range.getEnd () + 1,
+ this_range.getEnd ());
+ new_ranges.add (new_end_range);
+
+ } else {
+ throw new Error ("internal error - can't remove range");
+ }
+ }
+ }
+ }
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ } else {
+ // copy it unchanged
+ new_ranges.add (this_range);
+ }
+ }
+
+ final Location new_location =
+ new Location (new_ranges, location_is_complemented);
+
+ location_text.setText (new_location.toStringShort ());
+ }
+
+ /**
+ * Attempt to parse the current location_text as a Location. If it can be
+ * parsed it will be canonicalized (ie. the complement, if any, will be
+ * outermost). Returns true if and only if the location_text could be
+ * parsed.
+ **/
+ private boolean rationalizeLocation () {
+ try {
+ final Location location = new Location (location_text.getText ());
+
+ location_text.setText (location.toStringShort ());
+
+ return true;
+ } catch (LocationParseException e) {
+ return false;
+ }
+ }
+
+ /**
+ * Used for getting the current time/date in externalEdit ().
+ **/
+ private static java.util.Calendar calendar =
+ java.util.Calendar.getInstance ();
+
+ /**
+ * Edit the qualifiers of this Feature in an external editor. The
+ * qualifiers will be set when the editor finishes. This method works by
+ * writing the qualifiers to a temporary file and the sequence of the
+ * feature to a different file.
+ * @param editor_extra_args Extra arguments to pass to the editor. null
+ * means there are no extra args.
+ **/
+ private void externalEdit (final String [] editor_extra_args) {
+ try {
+ final String pre_edit_text = qualifier_text_area.getText ();
+
+ // write to a temporary file
+ final java.util.Date current_time = calendar.getTime ();
+
+ final String temp_file_name =
+ "/tmp/artemis_temp." + current_time.getTime ();
+
+ final File temp_file = new File (temp_file_name);
+
+ final FileWriter out_writer = new FileWriter (temp_file);
+ final PrintWriter print_writer = new PrintWriter (out_writer);
+
+ print_writer.write (qualifier_text_area.getText ());
+
+ print_writer.close ();
+ out_writer.close ();
+
+
+ final File sequence_temp_file = new File (temp_file_name + ".seq");
+
+ final FileWriter sequence_out_writer =
+ new FileWriter (sequence_temp_file);
+ final PrintWriter sequence_print_writer =
+ new PrintWriter (sequence_out_writer);
+
+ getFeature ().writeBasesOfFeature (sequence_print_writer);
+
+ sequence_print_writer.close ();
+ sequence_out_writer.close ();
+
+
+ final String editor_path =
+ Options.getOptions ().getProperty ("external_editor");
+
+ final String [] process_args;
+
+ if (editor_extra_args == null) {
+ process_args = new String [1];
+ process_args[0] = temp_file.getCanonicalPath ();
+ } else {
+ process_args = new String [editor_extra_args.length + 1];
+ System.arraycopy (editor_extra_args, 0, process_args, 0,
+ editor_extra_args.length);
+ process_args[process_args.length - 1] = temp_file.getCanonicalPath ();
+ }
+
+
+ final Process process =
+ ExternalProgram.startProgram (editor_path, process_args);
+
+ final ProcessWatcher process_watcher =
+ new ProcessWatcher (process, "editor", false);
+
+ final Thread watcher_thread = new Thread (process_watcher);
+
+ watcher_thread.start ();
+
+ final ProcessWatcherListener listener =
+ new ProcessWatcherListener () {
+ public void processFinished (final ProcessWatcherEvent event) {
+ try {
+ final FileReader file_reader = new FileReader (temp_file);
+
+ final BufferedReader buffered_reader =
+ new BufferedReader (file_reader);
+
+ final StringBuffer buffer = new StringBuffer ();
+
+ while (true) {
+ final String line = buffered_reader.readLine ();
+
+ if (line == null) {
+ final String current_qualifier_text =
+ qualifier_text_area.getText ();
+
+ if (!current_qualifier_text.equals (pre_edit_text)) {
+ final String message =
+ "the qualifiers have changed - apply changes from the " +
+ "external editor?";
+
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog (FeatureEdit.this, message);
+
+ if (!yes_no_dialog.getResult ()) {
+ return;
+ }
+ }
+
+ qualifier_text_area.setText (buffer.toString ());
+
+ temp_file.delete ();
+ sequence_temp_file.delete ();
+
+ return;
+ } else {
+ buffer.append (line + "\n");
+ }
+ }
+ } catch (IOException e) {
+ new MessageDialog (FeatureEdit.this, "an error occured while " +
+ "reading from the editor: " + e);
+ }
+ }
+ };
+
+ process_watcher.addProcessWatcherListener (listener);
+ } catch (IOException e) {
+ new MessageDialog (this, "error while starting editor: " + e);
+ } catch (ExternalProgramException e) {
+ new MessageDialog (this, "error while starting editor: " + e);
+ }
+ }
+
+ /**
+ * Read the qualifiers from the feature and update the qualifier JTextArea.
+ **/
+ private void updateQualifiers () {
+ qualifier_text_area.setText (getQualifierString ());
+ }
+
+ /**
+ * Return a string containing one qualifier per line. These are the
+ * original qualifiers, not the qualifiers from the qualifier_text_area.
+ **/
+ private String getQualifierString () {
+ final StringBuffer buffer = new StringBuffer ();
+
+ final QualifierVector qualifiers = getFeature ().getQualifiers ();
+
+ for (int qualifier_index = 0 ;
+ qualifier_index < qualifiers.size () ;
+ ++qualifier_index) {
+ final Qualifier this_qualifier = qualifiers.elementAt (qualifier_index);
+
+ final QualifierInfo qualifier_info =
+ getEntryInformation ().getQualifierInfo (this_qualifier.getName ());
+
+ final StringVector qualifier_strings =
+ StreamQualifier.toStringVector (qualifier_info, this_qualifier);
+
+ for (int value_index = 0 ;
+ value_index < qualifier_strings.size () ;
+ ++value_index) {
+
+ final String qualifier_string =
+ qualifier_strings.elementAt (value_index);
+
+ buffer.append (qualifier_string + "\n");
+ }
+ }
+
+ return buffer.toString ();
+ }
+
+ /**
+ * Set the key, location and qualifiers of the feature to be the same as
+ * what values currently shown in the components.
+ * @return true if and only if action succeeds. It may fail because of an
+ * illegal location or qualifier, in which case a message will be
+ * displayed before returning.
+ **/
+ private boolean setFeature () {
+ final Key key = key_choice.getSelectedItem ();
+
+ final KeyVector possible_keys = getEntryInformation ().getValidKeys ();
+
+ if (possible_keys != null && !possible_keys.contains (key)) {
+ final YesNoDialog dialog =
+ new YesNoDialog (this, "Add this new key: " + key + "?");
+
+ if (dialog.getResult ()) {
+ // yes
+ getEntryInformation ().addKey (key);
+ } else {
+ // no
+ return false;
+ }
+ }
+
+ final Location location;
+
+ try {
+ location = new Location (location_text.getText ());
+ } catch (LocationParseException exception) {
+ final String error_string = exception.getMessage ();
+ System.out.println (error_string);
+ new MessageDialog (this,
+ "Cannot apply changes because of location error: " +
+ error_string);
+
+ return false;
+ }
+
+
+ final QualifierVector qualifiers;
+
+ try {
+ qualifiers =
+ qualifier_text_area.getParsedQualifiers (getEntryInformation ());
+ } catch (QualifierParseException exception) {
+ final String error_string = exception.getMessage ();
+ System.out.println (error_string);
+ new MessageDialog (this,
+ "Cannot apply changes because of a qualifier " +
+ "error: " + error_string);
+
+ return false;
+ }
+
+
+ try {
+ entry_group.getActionController ().startAction ();
+
+ try {
+ getFeature ().set (datestamp, key, location, qualifiers);
+ } catch (OutOfDateException e) {
+ final YesNoDialog dialog =
+ new YesNoDialog (this,
+ "the feature has changed since the edit " +
+ "window was opened, continue?");
+ if (dialog.getResult ()) {
+ // yes - ignore the datestamp
+ getFeature ().set (key, location, qualifiers);
+ } else {
+ // no
+ return false;
+ }
+ }
+ } catch (EntryInformationException e) {
+ final String error_string = e.getMessage ();
+ new MessageDialog (this, "Cannot apply changes: " + error_string);
+
+ return false;
+ } catch (OutOfRangeException e) {
+ new MessageDialog (this,
+ "Cannot apply changes - the location is out of " +
+ "range for this sequence");
+ return false;
+ } catch (ReadOnlyException e) {
+ new MessageDialog (this,
+ "Cannot apply changes - the feature is " +
+ "read only");
+ return false;
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+
+ dribble ();
+
+ return true;
+ }
+
+ /**
+ * Return the Feature we are editing as passed to the constructor.
+ **/
+ public Feature getFeature () {
+ return edit_feature;
+ }
+
+ /**
+ * On Unix machines this method will append the text of the feature to a
+ * file in a current directory called .dribble + <the entry name>
+ **/
+ private void dribble () {
+ if (!Options.isUnixHost ()) {
+ return;
+ }
+
+ final String dribble_file_name;
+
+ if (getEntry ().getName () != null) {
+ dribble_file_name = ".dribble." + getEntry ().getName ();
+ } else {
+ dribble_file_name = ".dribble.no_name";
+ }
+
+ try {
+ final Writer writer = new FileWriter (dribble_file_name, true);
+ getFeature ().writeNative (writer);
+ writer.flush ();
+ writer.close ();
+ } catch (IOException e) {
+ System.err.println ("IO exception while accessing " + dribble_file_name +
+ ": " + e.getMessage ());
+ }
+ }
+
+ /**
+ * Return the Entry that contains the Feature this object is displaying.
+ **/
+ private Entry getEntry () {
+ return edit_entry;
+ }
+
+ /**
+ * Read the key from the feature and update the key chooser.
+ **/
+ private void updateKey () {
+ final Key feature_key = getFeature ().getKey ();
+
+ key_choice.setKey (feature_key);
+ }
+
+ /**
+ * Return the EntryInformation object of the entry containing the feature.
+ **/
+ public EntryInformation getEntryInformation () {
+ return getEntry ().getEntryInformation ();
+ }
+
+ /**
+ * Return the Selection that was passed to the constructor.
+ **/
+ private Selection getSelection () {
+ return selection;
+ }
+
+ /**
+ * The choice of feature keys - created in createComponents().
+ **/
+ private KeyChoice key_choice;
+
+ /**
+ * The choice of qualifiers - created in createComponents().
+ **/
+ private QualifierChoice qualifier_choice = null;
+
+ private final static int LOCATION_TEXT_WIDTH = 80;
+
+ /**
+ * The location text - set by updateLocation().
+ **/
+ private JTextField location_text = new JTextField (LOCATION_TEXT_WIDTH);
+
+ private JButton add_qualifier_button = new JButton ("Add qualifier");
+
+ /**
+ * When pressed - apply changes and dispose of the component.
+ **/
+ private JButton ok_button = new JButton ("OK");
+
+ /**
+ * When pressed - discard changes and dispose of the component.
+ **/
+ private JButton cancel_button = new JButton ("Cancel");
+
+ /**
+ * When pressed - apply changes and keep the component open.
+ **/
+ private JButton apply_button = new JButton ("Apply");
+
+ /**
+ * Edit area for qualifiers - created by createComponents().
+ **/
+ private QualifierTextArea qualifier_text_area;
+
+ /**
+ * The Feature this object is displaying.
+ **/
+ private Feature edit_feature;
+
+ /**
+ * The GotoEventSource that was passed to the constructor - used for the
+ * "Goto Feature" button.
+ **/
+ private GotoEventSource goto_event_source;
+
+ /**
+ * The Entry that contains the Feature this object is displaying.
+ **/
+ private Entry edit_entry;
+
+ /**
+ * The EntryGroup that contains this Feature (passed to the constructor).
+ **/
+ private EntryGroup entry_group;
+
+ /**
+ * The datestamp of the RWCorbaFeature when updateFromFeature () was last
+ * called or null if this is not a RWCorbaFeature.
+ **/
+ private Date datestamp = null;
+
+ /**
+ * The Selection that was passed to the constructor.
+ **/
+ private Selection selection;
+
+ /**
+ * The contents of the QualifierTextArea before the user edits anything.
+ * This is used to work out if anything has changed since the creation of
+ * the FeatureEdit.
+ **/
+ final String orig_qualifier_text;
+}
diff --git a/uk/ac/sanger/artemis/components/FeatureInfo.java b/uk/ac/sanger/artemis/components/FeatureInfo.java
new file mode 100644
index 000000000..3d8e12574
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FeatureInfo.java
@@ -0,0 +1,658 @@
+/* FeatureInfo.java
+ *
+ * created: Sat Dec 19 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/FeatureInfo.java,v 1.1 2004-06-09 09:46:39 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+import uk.ac.sanger.artemis.plot.*;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * This component displays a summary of the statistical information about one
+ * feature (such as correlation score, codon usage and gc content).
+ *
+ * @author Kim Rutherford
+ * @version $Id: FeatureInfo.java,v 1.1 2004-06-09 09:46:39 tjc Exp $
+ **/
+public class FeatureInfo extends JFrame
+ implements EntryChangeListener, FeatureChangeListener {
+ /**
+ * Create a new FeatureInfo component.
+ * @param feature The Feature that this component is showing information
+ * about.
+ **/
+ public FeatureInfo (final Feature feature,
+ final CodonUsageAlgorithm codon_usage_algorithm) {
+ super ("Feature infomation: " + feature.getIDString ());
+
+ this.feature = feature;
+ this.entry = feature.getEntry ();
+ this.codon_usage_algorithm = codon_usage_algorithm;
+
+ setBackground (new Color (210, 210, 210));
+ getContentPane ().setBackground (new Color (210, 210, 210));
+
+ codon_info_areas = new JTextArea [4][4];
+ base_count_info_areas = new JTextArea [4];
+
+ final JPanel centre_panel = new JPanel ();
+ centre_panel.setLayout (new BorderLayout ());
+
+ makeCountList ();
+ getContentPane ().add (aa_count_panel, "West");
+
+ makeMiscInfogrid ();
+ centre_panel.add (misc_info_panel, "South");
+
+ makeCodonInfogrid ();
+ centre_panel.add (codon_info_panel, "Center");
+
+ getContentPane ().add (centre_panel, "Center");
+
+ button_panel = new JPanel ();
+ final JButton close_button = new JButton ("Close");
+
+ close_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ stopListening ();
+ FeatureInfo.this.dispose ();
+ }
+ });
+
+ button_panel.add (close_button);
+
+ getContentPane ().add (button_panel, "South");
+
+ updateComponents ();
+
+ getFeature ().addFeatureChangeListener (this);
+ getFeature ().getEntry ().addEntryChangeListener (this);
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ stopListening ();
+ FeatureInfo.this.dispose ();
+ }
+ });
+
+ pack ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+
+ setVisible (true);
+ }
+
+ /**
+ * Remove this object as a feature change and entry change listener.
+ **/
+ private void stopListening () {
+ getEntry ().removeEntryChangeListener (this);
+ getFeature ().removeFeatureChangeListener (this);
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface. We listen to
+ * EntryChange events so we can notify the user if of this component if the
+ * feature gets deleted.
+ **/
+ public void entryChanged (EntryChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryChangeEvent.FEATURE_DELETED:
+ if (event.getFeature () == getFeature ()) {
+ stopListening ();
+ dispose ();
+ }
+ break;
+ default:
+ // do nothing;
+ break;
+ }
+ }
+
+ /**
+ * Implementation of the FeatureChangeListener interface. We need to
+ * listen to feature change events from the Features in this object.
+ * @param event The change event.
+ **/
+ public void featureChanged (FeatureChangeEvent event) {
+ updateComponents ();
+ }
+
+ /**
+ * Create all the labels in the misc_info_panel.
+ **/
+ private void makeMiscInfogrid () {
+ misc_info_panel = new JPanel ();
+
+ GridLayout grid = new GridLayout (0, 1);
+ misc_info_panel.setLayout (grid);
+
+ molecular_weight_label = new JLabel ();
+ misc_info_panel.add (molecular_weight_label);
+
+ correlation_scores_label = new JLabel ();
+ misc_info_panel.add (correlation_scores_label);
+
+ if (codon_usage_algorithm != null) {
+ usage_scores_label = new JLabel ();
+ misc_info_panel.add (usage_scores_label);
+ }
+ }
+
+ /**
+ * Create a List containing a count of the occurrences of each codon in the
+ * feature.
+ **/
+ private void makeCountList () {
+ aa_count_panel = new JPanel ();
+
+ final JPanel aa_count_sub_panel1 = new JPanel ();
+ aa_count_sub_panel1.setLayout (new GridLayout (0, 1));
+ aa_count_panel.add (aa_count_sub_panel1);
+
+ final JPanel aa_count_sub_panel2 = new JPanel ();
+ aa_count_sub_panel2.setLayout (new GridLayout (0, 1));
+ aa_count_panel.add (aa_count_sub_panel2);
+
+ aa_count_list = new JLabel [AminoAcidSequence.symbol_count];
+
+ for (int i = 0 ; i < AminoAcidSequence.symbol_count / 2 ; ++i) {
+ aa_count_list[i] = new JLabel ();
+ aa_count_sub_panel1.add (aa_count_list[i]);
+ }
+
+ // add a blank label so that the columns balance
+ aa_count_sub_panel1.add (new JLabel (""));
+
+ for (int i = AminoAcidSequence.symbol_count / 2 ;
+ i < AminoAcidSequence.symbol_count ;
+ ++i) {
+ aa_count_list[i] = new JLabel ();
+ aa_count_sub_panel2.add (aa_count_list[i]);
+ }
+ }
+
+ /**
+ * Create all the labels in the codon_info_panel.
+ **/
+ private void makeCodonInfogrid () {
+ codon_info_panel = new JPanel ();
+
+ GridBagLayout gridbag = new GridBagLayout();
+
+ codon_info_panel.setLayout (gridbag);
+
+ GridBagConstraints c = new GridBagConstraints();
+
+ final int GRID_WIDTH = 7;
+
+ c.gridwidth = GRID_WIDTH;
+ c.anchor = GridBagConstraints.NORTH;
+ c.insets = new Insets (1, 1, 1, 1);
+ c.fill = GridBagConstraints.NONE;
+
+
+ // create the first row with some dummy labels to pad it out
+
+ // the first row has the bases T,C,A,G as column titles
+ final JLabel dummy_label1 = new JLabel ("");
+ gridbag.setConstraints (dummy_label1, c);
+ codon_info_panel.add (dummy_label1);
+
+ final JLabel dummy_label2 = new JLabel ("");
+ gridbag.setConstraints (dummy_label2, c);
+ codon_info_panel.add (dummy_label2);
+
+ for (int i = 0 ; i < Bases.letter_index.length ; ++i) {
+ final JLabel new_label =
+ new JLabel (String.valueOf (Bases.letter_index[i]).toUpperCase ());
+ gridbag.setConstraints (new_label, c);
+ codon_info_panel.add (new_label);
+ }
+
+ final JLabel dummy_label3 = new JLabel ("");
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (dummy_label3, c);
+ codon_info_panel.add (dummy_label3);
+
+ c.anchor = GridBagConstraints.WEST;
+ c.gridwidth = GRID_WIDTH;
+
+ final int ROWS = 4;
+
+ // create the main rows
+
+ for (int row = 0 ; row < ROWS ; ++row) {
+ {
+ final JLabel new_label =
+ new JLabel (String.valueOf (Bases.letter_index[row]).toUpperCase ());
+
+ new_label.setBorder (new javax.swing.border.EmptyBorder (1,1,1,1));
+ gridbag.setConstraints (new_label, c);
+ codon_info_panel.add (new_label);
+ }
+
+ {
+ base_count_info_areas[row] = new JTextArea (5, 15);
+ base_count_info_areas[row].setEditable (false);
+
+ final JScrollPane scroll_pane =
+ new JScrollPane (base_count_info_areas[row]);
+ gridbag.setConstraints (scroll_pane, c);
+ codon_info_panel.add (scroll_pane);
+
+ final Color parent_background = getBackground ();
+ base_count_info_areas[row].setBackground (parent_background);
+ }
+
+ for (int column = 2 ; column < GRID_WIDTH - 1 ; ++column) {
+
+ final JTextArea new_text = new JTextArea (5, 12);
+ new_text.setText ("r: " + row + " c: " + column);
+
+ new_text.setEditable (false);
+
+ new_text.setBackground (Color.white);
+
+ final JScrollPane scroll_pane = new JScrollPane (new_text);
+ gridbag.setConstraints (scroll_pane, c);
+ codon_info_panel.add (scroll_pane);
+
+ codon_info_areas[row][column - 2] = new_text;
+ }
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+
+ {
+ final JTextArea new_text = new JTextArea (5, 2);
+ new_text.setText (Bases.letter_index[0] + "\n" +
+ Bases.letter_index[1] + "\n" +
+ Bases.letter_index[2] + "\n" +
+ Bases.letter_index[3]);
+
+ new_text.setEditable (false);
+
+ final JScrollPane scroll_pane = new JScrollPane (new_text);
+ gridbag.setConstraints (scroll_pane, c);
+ codon_info_panel.add (scroll_pane);
+ }
+
+ c.gridwidth = GRID_WIDTH;
+ }
+ }
+
+ /**
+ * Set the List components with the information from the feature.
+ **/
+ private void updateComponents () {
+ updateAACountList ();
+
+ updateCodonInfoAreas ();
+
+ updateMolecularWeightLabel ();
+
+ updateCorrelationScoresLabel ();
+
+ updateUsageScoresLabel ();
+
+ updateBaseCounts ();
+
+ validate ();
+ }
+
+ /**
+ * Update the aa_count_list JTextArea.
+ **/
+ private void updateAACountList () {
+ for (int i = 0 ; i < AminoAcidSequence.symbol_count ; ++i) {
+ if (i == AminoAcidSequence.symbol_count - 1 &&
+ getFeature ().getResidueCount (i) == 0) {
+ // don't include Selenocysteine in the list in the list if there are
+ // none
+ aa_count_list[i].setText ("");
+ continue;
+ }
+
+ final String three_letter_abbreviation =
+ AminoAcidSequence.getThreeLetterAbbreviation (i);
+
+ final char one_letter_abbreviation =
+ Character.toUpperCase (AminoAcidSequence.getSymbolFromIndex (i)) ;
+
+ final String label_string =
+ three_letter_abbreviation + " (" + one_letter_abbreviation +"): " +
+ getFeature ().getResidueCount (i);
+
+ aa_count_list[i].setText (label_string);
+ }
+ }
+
+ /**
+ * Update all the JTextArea objects in codon_info_areas.
+ **/
+ private void updateCodonInfoAreas () {
+ for (int first = 0 ; first < 4 ; ++first) {
+
+ for (int second = 0 ; second < 4 ; ++second) {
+
+ codon_info_areas[first][second].setText ("");
+
+ for (int third = 0 ; third < 4 ; ++third) {
+
+ final char this_codon_symbol =
+ AminoAcidSequence.getCodonTranslation (Bases.letter_index[first],
+ Bases.letter_index[second],
+ Bases.letter_index[third]);
+
+ final String this_codon_string =
+ AminoAcidSequence.getThreeLetterAbbreviation (this_codon_symbol);
+
+ final int this_codon_count =
+ getFeature ().getCodonCount (first,second,third);
+
+ final int this_codon_index =
+ AminoAcidSequence.getSymbolIndex (this_codon_symbol);
+
+ final int this_amino_acid_count =
+ getFeature ().getResidueCount (this_codon_index);
+
+ final String percent_string;
+
+ if (this_amino_acid_count == this_codon_count) {
+ percent_string = "ALL";
+ } else {
+ if (this_amino_acid_count < this_codon_count) {
+ // some of the amino acids aren't coded for by the standard
+ // codon - probably because of the /transl_except qualifier
+ percent_string = "---";
+ } else {
+ final int percentage =
+ 100 * this_codon_count / this_amino_acid_count;
+
+ percent_string = String.valueOf (percentage) + "%";
+ }
+ }
+
+ final String first_part_of_line =
+ this_codon_string + " " + this_codon_count;
+
+ codon_info_areas[first][second].append (first_part_of_line);
+
+ final int line_length_without_spaces =
+ first_part_of_line.length () + percent_string.length ();
+
+ // add some spaces so that everything lines up nicely
+ for (int i = 0 ; i < 11 - line_length_without_spaces ; ++i) {
+ codon_info_areas[first][second].append (" ");
+ }
+
+ codon_info_areas[first][second].append (percent_string);
+
+ if (third != 3) {
+ // insert a newline on all but the last line
+ codon_info_areas[first][second].append ("\n");
+ }
+ }
+ }
+ }
+ }
+
+ /**
+ * Update molecular_weight_label.
+ **/
+ private void updateMolecularWeightLabel () {
+ final String new_text =
+ "Mol weight: " +
+ getFeature ().getTranslation ().getMolecularWeight () + " Start: " +
+ getFeature ().getFirstBase () + " End: " +
+ getFeature ().getLastBase () + " Bases: " +
+ getFeature ().getBaseCount () + " AA length: " +
+ getFeature ().getTranslation ().length ();
+ molecular_weight_label.setText (new_text);
+ }
+
+
+ /**
+ * The method updates the components in base_count_info_areas.
+ **/
+ private void updateBaseCounts () {
+ final int translation_base_count =
+ getFeature ().getTranslationBases ().length ();
+
+ final int amino_acid_count = getFeature ().getTranslation ().length ();
+
+ for (int i = 0 ; i < 4 ; ++i) {
+ base_count_info_areas[i].setText ("");
+ {
+ final String string =
+ "ALL:" + updateBaseCountsFormatter (getFeature ().getBaseCount (i),
+ translation_base_count);
+
+ base_count_info_areas[i].append (string);
+ }
+
+ for (int codon_base_index = 0;
+ codon_base_index < 3 ;
+ ++codon_base_index) {
+ String label = null;
+ switch (codon_base_index) {
+ case 0: label = "\n1st:"; break;
+ case 1: label = "\n2nd:"; break;
+ case 2: label = "\n3rd:"; break;
+ }
+
+ final int base_count =
+ getFeature ().getPositionalBaseCount (codon_base_index, i);
+
+ final String string =
+ label + updateBaseCountsFormatter (base_count, amino_acid_count);
+
+ base_count_info_areas[i].append (string);
+ }
+ }
+ }
+
+ /**
+ * A helper method for updateBaseCounts ().
+ **/
+ private String updateBaseCountsFormatter (int base_count,
+ int total) {
+ final String count_string = " " + base_count;
+
+ final String percent_string;
+
+ if (base_count < total) {
+ percent_string = " " + 100 * base_count / total + "%";
+ } else {
+ percent_string = "ALL";
+ }
+
+ final int count_width = 5;
+
+ final int percent_width = 3;
+
+ return
+ count_string.substring (count_string.length () - count_width) + " " +
+ percent_string.substring (percent_string.length () - percent_width);
+ }
+
+ /**
+ * Update correlation_scores_label.
+ **/
+ private void updateCorrelationScoresLabel () {
+ final int c_total =
+ getFeature ().getBaseCount (Bases.getIndexOfBase ('c'));
+ final int g_total =
+ getFeature ().getBaseCount (Bases.getIndexOfBase ('g'));
+
+ final String c3_score;
+ final String g1_score;
+ final String g3_score;
+
+ final int c3_count =
+ getFeature ().getPositionalBaseCount (2, Bases.getIndexOfBase ('c'));
+ final int g1_count =
+ getFeature ().getPositionalBaseCount (0, Bases.getIndexOfBase ('g'));
+ final int g3_count =
+ getFeature ().getPositionalBaseCount (2, Bases.getIndexOfBase ('g'));
+
+ if (c_total == 0) {
+ c3_score = "ALL";
+ } else {
+ c3_score =
+ String.valueOf (1000 * (3 * c3_count - c_total) / c_total / 10.0);
+ }
+
+ if (g_total == 0) {
+ g1_score = "ALL";
+ } else {
+ g1_score =
+ String.valueOf (1000 * (3 * g1_count - g_total) / g_total / 10.0);
+ }
+
+ if (g_total == 0) {
+ g3_score = "ALL";
+ } else {
+ g3_score =
+ String.valueOf (1000 * (3 * g3_count - g_total) / g_total / 10.0);
+ }
+
+ final double cor1_2_score =
+ ((int) getFeature ().get12CorrelationScore () * 10) / 10.0;
+
+ final double gc_percent =
+ ((int) (getFeature ().getPercentGC () * 100.0)) / 100.0;
+
+ final String new_label =
+ "position 1/2 score = " + cor1_2_score + " " +
+ "C3/G1/G3 (o-e)/e = " + c3_score + " " + g1_score + " " + g3_score +
+ " " + gc_percent + "% GC";
+
+ correlation_scores_label.setText (new_label);
+ }
+
+ /**
+ * Update usage_scores_label.
+ **/
+ private void updateUsageScoresLabel () {
+ if (codon_usage_algorithm != null) {
+ final String new_label =
+ "usage score = " + codon_usage_algorithm.getFeatureScore (feature);
+
+ usage_scores_label.setText (new_label);
+ }
+ }
+
+ /**
+ * Return the feature this component is showing information about.
+ **/
+ private Feature getFeature () {
+ return feature;
+ }
+
+ /**
+ * Return the Entry that contains the Feature this object is displaying.
+ **/
+ private Entry getEntry () {
+ return entry;
+ }
+
+ /**
+ * The Feature that this component is showing information about.
+ **/
+ private Feature feature = null;
+
+ /**
+ * The Entry that contains the Feature this object is displaying.
+ **/
+ private Entry entry;
+
+ /**
+ * A panel containing the labels with the amino acid counts for the
+ * feature.
+ **/
+ private JPanel aa_count_panel = null;
+
+ /**
+ * An array Labels of showing the amino acid counts for the feature. There
+ * is one Label for each symbol (24).
+ **/
+ private JLabel [] aa_count_list = null;
+
+ /**
+ * A panel containing general statistics about the whole sequence.
+ **/
+ private JPanel misc_info_panel = null;
+
+ /**
+ * A Label containing molecular weight of the protein, start and end
+ * positions and length.
+ **/
+ private JLabel molecular_weight_label = null;
+
+ /**
+ * A Label containing the correlation scores for this feature.
+ **/
+ private JLabel correlation_scores_label = null;
+
+ /**
+ * A Label containing the usage scores for this feature.
+ **/
+ private JLabel usage_scores_label = null;
+
+ /**
+ * Statistics about the codon frequency.
+ **/
+ private JPanel codon_info_panel = null;
+
+ /**
+ * A panel to hold the close button.
+ **/
+ private JPanel button_panel = null;
+
+ /**
+ * These components each hold information about 4 codons each.
+ **/
+ private JTextArea [] [] codon_info_areas;
+
+ /**
+ * These components display position information about the base counts.
+ * See positional_base_counts and base_counts.
+ **/
+ private JTextArea [] base_count_info_areas;
+
+ /**
+ * The CodonUsageAlgorithm reference that was passed to the constructor.
+ * (Used by updateUsageScoresLabel ()).
+ **/
+ private final CodonUsageAlgorithm codon_usage_algorithm;
+}
diff --git a/uk/ac/sanger/artemis/components/FeatureList.java b/uk/ac/sanger/artemis/components/FeatureList.java
new file mode 100644
index 000000000..435800716
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FeatureList.java
@@ -0,0 +1,971 @@
+/* FeatureList.java
+ *
+ * created: Fri Oct 9 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000,2001,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/FeatureList.java,v 1.1 2004-06-09 09:46:40 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+import uk.ac.sanger.artemis.plot.*;
+
+import uk.ac.sanger.artemis.io.Key;
+import uk.ac.sanger.artemis.io.Qualifier;
+import uk.ac.sanger.artemis.io.InvalidRelationException;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.QualifierInfo;
+import uk.ac.sanger.artemis.io.QualifierVector;
+import uk.ac.sanger.artemis.io.StreamQualifier;
+import uk.ac.sanger.artemis.util.StringVector;
+
+import java.awt.event.*;
+import java.awt.*;
+import java.text.*;
+import java.util.*;
+
+import javax.swing.*;
+
+/**
+ * This component gives the user a list containing the details the current
+ * Features.
+ *
+ * @author Kim Rutherford
+ * @version $Id: FeatureList.java,v 1.1 2004-06-09 09:46:40 tjc Exp $
+ *
+ **/
+
+public class FeatureList extends EntryGroupPanel
+ implements EntryGroupChangeListener,
+ EntryChangeListener, FeatureChangeListener,
+ SelectionChangeListener, DisplayComponent
+{
+ /**
+ * Create a new FeatureList with the default number of rows.
+ * @param entry_group The EntryGroup that this component will display.
+ * @param selection The Selection object for this component. Selected
+ * objects will be highlighted.
+ * @param goto_event_source The object to use when we need to call
+ * gotoBase ().
+ **/
+ public FeatureList (final EntryGroup entry_group,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final BasePlotGroup base_plot_group) {
+ super (entry_group, selection, goto_event_source, base_plot_group);
+
+ getCanvas ().addMouseListener (new MouseAdapter () {
+ /**
+ * Listen for mouse press events so that we can do popup menus and
+ * selection.
+ **/
+ public void mousePressed (MouseEvent event) {
+ if (isMenuTrigger (event)) {
+ final FeaturePopup popup =
+ new FeaturePopup (FeatureList.this,
+ getEntryGroup (),
+ getSelection (),
+ getGotoEventSource (),
+ getBasePlotGroup ());
+ final JComponent parent = (JComponent) event.getSource ();
+
+ popup.show (parent, event.getX (), event.getY ());
+ } else {
+ handleCanvasMousePress (event);
+ }
+ }
+ });
+
+ createScrollbars ();
+
+ addComponentListener (new ComponentAdapter () {
+ public void componentShown (ComponentEvent e) {
+ repaintCanvas ();
+ }
+ public void componentResized (ComponentEvent e) {
+ repaintCanvas ();
+ }
+ });
+
+ getSelection ().addSelectionChangeListener (this);
+
+ // changes to the EntryGroup will be noticed by listening for EntryChange
+ // and FeatureChange events.
+
+ getEntryGroup ().addEntryGroupChangeListener (this);
+ getEntryGroup ().addEntryChangeListener (this);
+ getEntryGroup ().addFeatureChangeListener (this);
+
+
+ // find the maximum posible width for the high and low positions
+ final int sequence_length = getEntryGroup ().getSequenceLength ();
+ max_base_pos_width = (int)(Math.log (sequence_length)/Math.log (10)) + 1;
+
+ if (max_base_pos_width < 4) {
+ max_base_pos_width = 4;
+ }
+
+ repaintCanvas ();
+ }
+
+ /**
+ * Remove this component from all the listener lists it is on.
+ **/
+ void stopListening () {
+ getSelection ().removeSelectionChangeListener (this);
+
+ getEntryGroup ().removeEntryGroupChangeListener (this);
+ getEntryGroup ().removeEntryChangeListener (this);
+ getEntryGroup ().removeFeatureChangeListener (this);
+ }
+
+ /**
+ * Returns the value of a flag that indicates whether this component can be
+ * traversed using Tab or Shift-Tab keyboard focus traversal - returns true
+ * for FeatureDisplay components
+ **/
+// tjc - deprecated replaced by isFocusable()
+//public boolean isFocusTraversable ()
+//{
+// return true;
+//}
+
+ /**
+ * Set value of the show correlation scores flag.
+ * @param show_correlation_scores Show correlation scores in the list if
+ * and only if this argument is true.
+ **/
+ public void setCorrelationScores (final boolean show_correlation_scores) {
+ if (this.show_correlation_scores != show_correlation_scores) {
+ this.show_correlation_scores = show_correlation_scores;
+ repaintCanvas ();
+ } else {
+ // do nothing
+ }
+ }
+
+ /**
+ * Get the value of the "show correlation scores" flag.
+ **/
+ public boolean getCorrelationScores () {
+ return show_correlation_scores;
+ }
+
+ /**
+ * Set value of the show /gene flag.
+ * @param show_gene_names If true this component will show the /gene (really
+ * Feature.getIDString ()) instead of the key.
+ **/
+ public void setShowGenes (final boolean show_gene_names) {
+ if (this.show_gene_names != show_gene_names) {
+ this.show_gene_names = show_gene_names;
+ repaintCanvas ();
+ } else {
+ // do nothing
+ }
+ }
+
+ /**
+ * Get the value of the "show genes" flag.
+ **/
+ public boolean getShowGenes () {
+ return show_gene_names;
+ }
+
+ /**
+ * Set value of the show qualifiers flag.
+ * @param show_quailfiers If true this component will show all the
+ * qualifiers after the note.
+ **/
+ public void setShowQualifiers (final boolean show_qualifiers) {
+ if (this.show_qualifiers != show_qualifiers) {
+ this.show_qualifiers = show_qualifiers;
+ repaintCanvas ();
+ } else {
+ // do nothing
+ }
+ }
+
+ /**
+ * Get the value of the "show qualifiers" flag.
+ **/
+ public boolean getShowQualifiers () {
+ return show_qualifiers;
+ }
+
+ /**
+ * Set value of the show /product flag.
+ * @param show_products If true this component will show the /product
+ * qualifier instead of the /note.
+ **/
+ public void setShowProducts (final boolean show_products) {
+ if (this.show_products != show_products) {
+ this.show_products = show_products;
+ repaintCanvas ();
+ } else {
+ // do nothing
+ }
+ }
+
+ /**
+ * Get the value of the "show products" flag.
+ **/
+ public boolean getShowProducts () {
+ return show_products;
+ }
+
+ /**
+ * Implementation of the EntryGroupChangeListener interface. We listen to
+ * EntryGroupChange events so that we can update the display if entries
+ * are added or deleted.
+ **/
+ public void entryGroupChanged (EntryGroupChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryGroupChangeEvent.ENTRY_ADDED:
+ case EntryGroupChangeEvent.ENTRY_ACTIVE:
+ case EntryGroupChangeEvent.ENTRY_DELETED:
+ case EntryGroupChangeEvent.ENTRY_INACTIVE:
+ repaintCanvas ();
+ break;
+ }
+ }
+
+ /**
+ * Implementation of the FeatureChangeListener interface.
+ **/
+ public void featureChanged (FeatureChangeEvent event) {
+ if (!isVisible ()) {
+ return;
+ }
+
+ repaintCanvas ();
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface. We listen to
+ * EntryChange events so that we can update the list if features are added
+ * or deleted.
+ **/
+ public void entryChanged (EntryChangeEvent event) {
+ if (!isVisible ()) {
+ return;
+ }
+
+ repaintCanvas ();
+ }
+
+ /**
+ * Implementation of the SelectionChangeListener interface. We listen to
+ * SelectionChange events so that we can update the list to reflect the
+ * current selection.
+ **/
+ public void selectionChanged (SelectionChangeEvent event) {
+ if (!isVisible ()) {
+ return;
+ }
+
+ if (event.getSource () == this) {
+ // don't bother with events we sent ourself
+ return;
+ }
+
+ if (getSelection ().getMarkerRange () != null &&
+ event.getType () == SelectionChangeEvent.OBJECT_CHANGED) {
+ // if the selected range changes we don't care
+ return;
+ }
+
+ selection_changed_flag = true;
+
+ repaintCanvas ();
+ }
+
+ /**
+ * Return a vector containing the text that is shown in the list - one
+ * String per line.
+ **/
+ public StringVector getListStrings () {
+ final StringVector return_vector = new StringVector ();
+
+ final FeatureEnumeration test_enumerator = getEntryGroup ().features ();
+
+ while (test_enumerator.hasMoreFeatures ()) {
+ final Feature this_feature = test_enumerator.nextFeature ();
+
+ return_vector.add (makeFeatureString (this_feature, true));
+ }
+
+ return return_vector;
+ }
+
+ /**
+ * Create the scroll bar.
+ **/
+ private void createScrollbars () {
+ scrollbar = new JScrollBar (Scrollbar.VERTICAL);
+ scrollbar.setValues (0, 1, 0,
+ getEntryGroup ().getAllFeaturesCount ());
+ scrollbar.setUnitIncrement (1);
+ scrollbar.setBlockIncrement (1);
+ scrollbar.addAdjustmentListener (new AdjustmentListener () {
+ public void adjustmentValueChanged(AdjustmentEvent e) {
+ setFirstIndex (e.getValue ());
+ }
+ });
+
+ horiz_scrollbar = new JScrollBar (Scrollbar.HORIZONTAL);
+ horiz_scrollbar.setValues (0, 1, 0,
+ getEntryGroup ().getAllFeaturesCount () - 1);
+ horiz_scrollbar.setUnitIncrement (getFontWidth ());
+ horiz_scrollbar.setBlockIncrement (100);
+ horiz_scrollbar.addAdjustmentListener (new AdjustmentListener () {
+ public void adjustmentValueChanged (AdjustmentEvent e) {
+ repaintCanvas ();
+ }
+ });
+
+ getMidPanel ().add (horiz_scrollbar, "South");
+
+ add (scrollbar, "East");
+ }
+
+ /**
+ * Set the extent, max and value of the horizontal scrollbar
+ **/
+ private void fixHorizScrollBar (final int max_width) {
+ int old_value = horiz_scrollbar.getValue ();
+
+ horiz_scrollbar.setValues (horiz_scrollbar.getValue (),
+ getCanvas ().getSize ().width,
+ 0, max_width * getFontWidth ());
+ horiz_scrollbar.setBlockIncrement (getCanvas ().getSize ().width);
+ }
+
+ /**
+ * Set the first visible index.
+ **/
+ public void setFirstIndex (final int first_index) {
+ this.first_index = first_index;
+ need_to_fix_horiz_scrollbar = true;
+ repaintCanvas ();
+ }
+
+ /**
+ * Handle a mouse press event on the drawing canvas - select on click,
+ * select and broadcast it on double click.
+ **/
+ private void handleCanvasMousePress (final MouseEvent event) {
+ if (event.getID() != MouseEvent.MOUSE_PRESSED) {
+ return;
+ }
+
+ getCanvas ().requestFocus ();
+
+ if (!event.isShiftDown ()) {
+ getSelection ().clear ();
+ }
+
+ final int clicked_feature_index =
+ scrollbar.getValue () + event.getY () / getLineHeight ();
+
+ if (clicked_feature_index < getEntryGroup ().getAllFeaturesCount ()) {
+ final FeatureVector selected_features =
+ getSelection ().getAllFeatures ();
+
+ final Feature clicked_feature =
+ getEntryGroup ().featureAt (clicked_feature_index);
+
+ if (selected_features.contains (clicked_feature)) {
+ getSelection ().remove (clicked_feature);
+ getSelection ().removeSegmentsOf (clicked_feature);
+ } else {
+ getSelection ().add (clicked_feature);
+ }
+
+ if (event.getClickCount () == 2) {
+ makeSelectionVisible ();
+
+ if ((event.getModifiers () & InputEvent.BUTTON2_MASK) != 0 ||
+ event.isAltDown ()) {
+ if (Options.readWritePossible ()) {
+ new FeatureEdit (clicked_feature, getEntryGroup (),
+ getSelection (),
+ getGotoEventSource ()).show ();
+ }
+ }
+ }
+ }
+ }
+
+ /**
+ * The main paint function for the canvas. An off screen image used for
+ * double buffering when drawing the canvas.
+ * @param g The Graphics object of the canvas.
+ **/
+ protected void paintCanvas (Graphics g) {
+ refresh ();
+
+ if (!isVisible ()) {
+ return;
+ }
+
+ if (selection_changed_flag) {
+ selection_changed_flag = false;
+
+ final FeatureVector selected_features =
+ getSelection ().getAllFeatures ();
+
+ if (selected_features.size () > 0) {
+ // set to true if any of the selected features is visible
+ boolean a_selected_feature_is_visible = false;
+
+ int first_line_in_view = scrollbar.getValue ();
+
+ if (first_line_in_view == -1) {
+ first_line_in_view = 0;
+ }
+
+ final int feature_count = getEntryGroup ().getAllFeaturesCount ();
+
+ for (int i = first_line_in_view ;
+ i < feature_count && i < first_line_in_view + linesInView () ;
+ ++i) {
+ final Feature this_feature = getEntryGroup ().featureAt (i);
+ if (selected_features.contains (this_feature)) {
+ a_selected_feature_is_visible = true;
+ break;
+ }
+ }
+
+ if (!a_selected_feature_is_visible) {
+ // make the first selected feature visible
+ final Feature first_selected_feature =
+ selected_features.elementAt (0);
+
+ final int index_of_first_selected_feature =
+ getEntryGroup ().indexOf (first_selected_feature);
+
+ if (index_of_first_selected_feature < scrollbar.getValue () ||
+ index_of_first_selected_feature >=
+ scrollbar.getValue () + linesInView ()) {
+
+ scrollbar.setValue (index_of_first_selected_feature);
+ }
+ }
+ }
+ }
+
+ g.setColor (background_colour);
+
+ g.fillRect (0, 0, getCanvasWidth (), getCanvasHeight ());
+
+ g.setColor (Color.black);
+
+ final int all_feature_count = getEntryGroup ().getAllFeaturesCount ();
+
+ if (all_feature_count == 0) {
+ fixHorizScrollBar (0);
+ } else {
+ final int lines_in_view = linesInView ();
+ int first_index_in_view = scrollbar.getValue ();
+
+ if (first_index_in_view == -1) {
+ first_index_in_view = 0;
+ }
+
+ final int feature_count = getEntryGroup ().getAllFeaturesCount ();
+
+ /* jikes 1.15 bug final */ int last_index_in_view;
+
+ if (lines_in_view < feature_count - first_index_in_view) {
+ last_index_in_view = first_index_in_view + lines_in_view;
+ } else {
+ last_index_in_view = feature_count - 1;
+ }
+
+ final FeatureVector features_in_view =
+ getEntryGroup ().getFeaturesInIndexRange (first_index_in_view,
+ last_index_in_view);
+
+ /**
+ * The maximum width of the strings we have seen - used to set the
+ * horiz_scrollbar maximum.
+ **/
+ int max_width = -1;
+
+ for (int i = 0 ; i <= last_index_in_view - first_index_in_view ; ++i) {
+ final Feature this_feature = features_in_view.elementAt (i);
+ final String feature_string = makeFeatureString (this_feature, false);
+ drawFeatureLine (g, this_feature, feature_string,i);
+
+ if (feature_string.length () > max_width) {
+ max_width = feature_string.length ();
+ }
+ }
+
+ if (need_to_fix_horiz_scrollbar) {
+ fixHorizScrollBar (max_width);
+ }
+ }
+ }
+
+ /**
+ * Return the number of visible text lines on canvas.
+ **/
+ private int linesInView () {
+ return getCanvas ().getSize ().height / getLineHeight ();
+ }
+
+ /**
+ * Update the scrollbar.
+ **/
+ private void refresh () {
+ scrollbar.setMaximum (getEntryGroup ().getAllFeaturesCount ());
+ final int lines_in_view = linesInView ();
+ scrollbar.setBlockIncrement (lines_in_view > 0 ? lines_in_view : 1);
+ scrollbar.setUnitIncrement (1);
+ scrollbar.setVisibleAmount (linesInView ());
+ }
+
+ /**
+ * Draw the given Feature at the given line of the list, taking the
+ * selection into account.
+ **/
+ private void drawFeatureLine (final Graphics g,
+ final Feature feature,
+ final String feature_string,
+ final int line) {
+ final int y_pos = line * getLineHeight ();
+
+ // the width of the coloured blob at the left of the text
+ final int BOX_WIDTH = getLineHeight ();
+
+ final Color feature_colour = feature.getColour ();
+
+ if (feature_colour == null) {
+ // default colour is white
+ g.setColor (Color.white);
+ } else {
+ g.setColor (feature_colour);
+ }
+ g.fillRect (1 - horiz_scrollbar.getValue (), y_pos + 1,
+ BOX_WIDTH, getLineHeight () - 1);
+
+ if (getSelection ().contains (feature)) {
+ // draw in reverse
+ g.setColor (Color.black);
+ g.fillRect (BOX_WIDTH + 4 - horiz_scrollbar.getValue (), y_pos,
+ getCanvas ().getSize ().width + horiz_scrollbar.getValue (),
+ getLineHeight ());
+ g.setColor (background_colour);
+ } else {
+ g.setColor (Color.black);
+ }
+
+ g.setFont (getFont ());
+
+ g.drawString (feature_string,
+ BOX_WIDTH + 5 -
+ horiz_scrollbar.getValue (),
+ y_pos + getFontAscent ());
+
+ g.setPaintMode ();
+ }
+
+ /**
+ * Return the list index of a feature.
+ **/
+ private int indexOf (Feature feature) {
+ return getEntryGroup ().indexOf (feature);
+ }
+
+ /**
+ * Return a String object suitable for displaying in the list of features.
+ * @param dont_truncate if true the gene name / key field won't be
+ * truncated if it is longer than the field width
+ **/
+ private String makeFeatureString (final Feature feature,
+ final boolean dont_truncate) {
+ String key_string;
+
+ final int KEY_FIELD_WIDTH = 15;
+
+ if (show_gene_names) {
+ key_string = feature.getIDString ();
+
+ if (key_string.length () > KEY_FIELD_WIDTH && !dont_truncate) {
+ key_string = key_string.substring (0, KEY_FIELD_WIDTH);
+ }
+ } else {
+ key_string = feature.getKey ().toString ();
+ }
+
+ final Marker low_marker = feature.getFirstBaseMarker ();
+ final Marker high_marker = feature.getLastBaseMarker ();
+
+ final StringBuffer description_string_buffer = new StringBuffer ();
+
+ if (show_products) {
+ final String product_string = feature.getProductString ();
+
+ if (product_string == null) {
+ if (feature.isCDS ()) {
+ description_string_buffer.append ("[no /product]");
+ } else {
+ // description is blank
+ }
+ } else {
+ description_string_buffer.append (product_string);
+ }
+ } else {
+ final String note = feature.getNote ();
+
+ if (note != null && note.length () != 0) {
+ final int QUALIFIER_COLUMN = 10;
+
+ final String note_string =
+ padRightWithSpaces (feature.getNote (), QUALIFIER_COLUMN);
+
+ description_string_buffer.append (note_string);
+ description_string_buffer.append (" ");
+ }
+
+ if (show_qualifiers) {
+ description_string_buffer.append (getQualifierString (feature));
+ }
+ }
+
+ final String low_pos;
+ final String high_pos;
+
+ if (low_marker == null || high_marker == null) {
+ low_pos = "unknown";
+ high_pos = "unknown";
+ } else {
+ if (low_marker.getRawPosition () < high_marker.getRawPosition ()) {
+ low_pos = String.valueOf (low_marker.getRawPosition ());
+ high_pos = String.valueOf (high_marker.getRawPosition ());
+ } else {
+ low_pos = String.valueOf (high_marker.getRawPosition ());
+ high_pos = String.valueOf (low_marker.getRawPosition ());
+ }
+ }
+
+ StringBuffer new_list_line = new StringBuffer ();
+
+ new_list_line.append (padRightWithSpaces (key_string, KEY_FIELD_WIDTH));
+ new_list_line.append (" ");
+
+ new_list_line.append (padLeftWithSpaces (low_pos, max_base_pos_width));
+ new_list_line.append (" ");
+ new_list_line.append (padLeftWithSpaces (high_pos, max_base_pos_width));
+ new_list_line.append (" ");
+
+ if (feature.isForwardFeature ()) {
+ new_list_line.append (" ");
+ } else {
+ new_list_line.append ("c ");
+ }
+
+ if (show_correlation_scores) {
+ if (feature.isCDS ()) {
+ new_list_line.append (getScoresString (feature));
+ new_list_line.append (" ");
+ } else {
+ new_list_line.append (" ");
+ if (getBasePlotGroup ().getCodonUsageAlgorithm () != null) {
+ new_list_line.append (" ");
+ }
+ }
+ }
+
+ new_list_line.append (description_string_buffer);
+
+ return new_list_line.toString ();
+ }
+
+ /**
+ * Return the characters width of the Canvas.
+ **/
+ private int getWidthInChars () {
+ return getCanvas ().getSize ().width / getFontWidth ();
+ }
+
+ /**
+ * Return a String containing the given Qualifier and it's values (in EMBL
+ * format).
+ * @param start_index ignore the values before this index
+ **/
+ private String formatQualifier (final String qualifier_name,
+ final Feature feature,
+ final int start_index) {
+ final StringBuffer buffer = new StringBuffer ();
+
+ try {
+ final Qualifier qualifier = feature.getQualifierByName (qualifier_name);
+
+ if (qualifier != null) {
+ final EntryInformation entry_information =
+ feature.getEntry ().getEntryInformation ();
+
+ final QualifierInfo qualifier_info =
+ entry_information.getQualifierInfo (qualifier_name);
+
+ final StringVector qualifier_strings =
+ StreamQualifier.toStringVector (qualifier_info,
+ qualifier);
+
+ for (int i = start_index ; i < qualifier_strings.size () ; ++i) {
+
+ final String qualifier_string = qualifier_strings.elementAt (i);
+
+ buffer.append (qualifier_string + " ");
+ }
+ }
+ } catch (InvalidRelationException e) {
+ // ignore
+ }
+
+ return buffer.toString ();
+ }
+
+ /**
+ * Return a String containing all the qualifiers of the given Feature
+ * (except /note) in EMBL format. Any /similarity qualifier will come
+ * first.
+ **/
+ private String getQualifierString (final Feature feature) {
+ final StringBuffer buffer = new StringBuffer ();
+
+ final QualifierVector qualifiers = feature.getQualifiers ();
+
+ // if there is a /note and it has more than one value put it next (without
+ // the first value)
+ final Qualifier note_qualifier =
+ qualifiers.getQualifierByName ("note");
+
+ if (note_qualifier != null && note_qualifier.getValues ().size () > 1) {
+ buffer.append (formatQualifier ("note", feature, 1));
+ buffer.append (" ");
+ }
+
+ // put /similarity before all but the /note qualifier
+ final Qualifier similarity_qualifier =
+ qualifiers.getQualifierByName ("similarity");
+
+ if (similarity_qualifier != null) {
+ buffer.append (formatQualifier ("similarity", feature, 0));
+ buffer.append (" ");
+ }
+
+ for (int i = 0 ; i < qualifiers.size () ; ++i) {
+ final Qualifier this_qualifier = qualifiers.elementAt (i);
+
+ final String this_qualifier_name = this_qualifier.getName ();
+
+ if (!this_qualifier_name.equals ("note") &&
+ !this_qualifier_name.equals ("similarity")) {
+ buffer.append (formatQualifier (this_qualifier_name, feature, 0));
+ buffer.append (" ");
+ }
+ }
+
+ return buffer.toString ();
+ }
+
+ /**
+ * Return a String containing the correlation scores.
+ **/
+ public String getScoresString (final Feature feature) {
+ final int base_total = feature.getTranslationBases ().length ();
+
+ final int c_total = feature.getBaseCount (Bases.getIndexOfBase ('c'));
+ final int g_total = feature.getBaseCount (Bases.getIndexOfBase ('g'));
+
+ final int g1_count =
+ feature.getPositionalBaseCount (0, Bases.getIndexOfBase ('g'));
+
+ final int c3_count =
+ feature.getPositionalBaseCount (2, Bases.getIndexOfBase ('c'));
+ final int g3_count =
+ feature.getPositionalBaseCount (2, Bases.getIndexOfBase ('g'));
+
+ final double c3_score = 100.0 * (3 * c3_count - c_total) / c_total;
+ final double g1_score = 100.0 * (3 * g1_count - g_total) / g_total;
+ final double g3_score = 100.0 * (3 * g3_count - g_total) / g_total;
+
+ final double cor1_2_score = feature.get12CorrelationScore ();
+
+ final NumberFormat number_format = NumberFormat.getNumberInstance ();
+
+ number_format.setMaximumFractionDigits (1);
+ number_format.setMinimumFractionDigits (1);
+
+ final String cor1_2_score_string = number_format.format (cor1_2_score);
+ final String c3_score_string;
+ final String g1_score_string;
+ final String g3_score_string;
+
+
+ if (c_total == 0) {
+ c3_score_string = "ALL";
+ } else {
+ c3_score_string = number_format.format (c3_score);
+ }
+
+ if (g_total == 0) {
+ g1_score_string = "ALL";
+ } else {
+ g1_score_string = number_format.format (g1_score);
+ }
+
+ if (g_total == 0) {
+ g3_score_string = "ALL";
+ } else {
+ g3_score_string = number_format.format (g3_score);
+ }
+
+ String codon_usage_score_string = "";
+
+ final CodonUsageAlgorithm codon_usage_alg =
+ getBasePlotGroup ().getCodonUsageAlgorithm ();
+
+ if (codon_usage_alg != null) {
+ number_format.setMaximumFractionDigits (3);
+ number_format.setMinimumFractionDigits (3);
+
+ codon_usage_score_string =
+ number_format.format (codon_usage_alg.getFeatureScore (feature)) + " ";
+ }
+
+ return
+ codon_usage_score_string +
+ padRightWithSpaces (cor1_2_score_string, 5) + " " +
+ padRightWithSpaces (c3_score_string, 5) + " " +
+ padRightWithSpaces (g1_score_string, 5) + " " +
+ padRightWithSpaces (g3_score_string, 5);
+ }
+
+ /**
+ * Return the given string padded with spaces to the given width. The
+ * spaces are added on the right of the string.
+ **/
+ private String padRightWithSpaces (final String string, final int width) {
+ if (string.length () == width) {
+ return string;
+ }
+
+ final StringBuffer buffer = new StringBuffer (string);
+
+ for (int i = 0 ; i < width - string.length () ; ++i) {
+ buffer.append (' ');
+ }
+
+ return buffer.toString ();
+ }
+
+ /**
+ * Return the given string padded with spaces to the given width. The
+ * spaces are added on the left of the string.
+ **/
+ private String padLeftWithSpaces (final String string, final int width) {
+ if (string.length () == width) {
+ return string;
+ }
+
+ final StringBuffer buffer = new StringBuffer ();
+
+ for (int i = 0 ; i < width - string.length () ; ++i) {
+ buffer.append (' ');
+ }
+
+ buffer.append (string);
+
+ return buffer.toString ();
+ }
+
+ /**
+ * Return the height each line of the display should be. Each feature will
+ * be drawn into one line.
+ **/
+ private int getLineHeight () {
+ return getFontAscent () + 2;
+ }
+
+ /**
+ * This variable is true if correlation scores should be shown in the list.
+ **/
+ private boolean show_correlation_scores = false;
+
+ /**
+ * The JScrollBar for this FeatureList object.
+ **/
+ private JScrollBar scrollbar = null;
+
+ /**
+ * The JScrollBar for horizontal scrolling in this FeatureList object.
+ **/
+ private JScrollBar horiz_scrollbar = null;
+
+ /**
+ * The index of the first visible feature in the list.
+ **/
+ private int first_index;
+
+ /**
+ * This is set to true by selectionChanged () and used by paintCanvas ().
+ **/
+ private boolean selection_changed_flag = false;
+
+ /**
+ * The colour used to draw the background.
+ **/
+ private Color background_colour = Color.white;
+
+ /**
+ * If true this component will show Feature.getIDString () (ie /gene or
+ * /label) instead of the key.
+ **/
+ private boolean show_gene_names = false;
+
+ /**
+ * If true this component will show the /product qualifier instead of the
+ * /note field.
+ **/
+ private boolean show_products = false;
+
+ /**
+ * If true this component will show all the qualifiers after the note.
+ **/
+ private boolean show_qualifiers = false;
+
+ /**
+ * The is the maximum width of the strings containing the feature start and
+ * stop positions. Set in the constructor.
+ **/
+ private int max_base_pos_width;
+
+ /**
+ * Set to true when paintCanvas() needs to call fixHorizScrollBar().
+ **/
+ private boolean need_to_fix_horiz_scrollbar = true;
+}
diff --git a/uk/ac/sanger/artemis/components/FeatureListFrame.java b/uk/ac/sanger/artemis/components/FeatureListFrame.java
new file mode 100644
index 000000000..ee31a12b6
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FeatureListFrame.java
@@ -0,0 +1,195 @@
+/* FeatureListFrame.java
+ *
+ * created: Fri Sep 3 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999,2000,2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/FeatureListFrame.java,v 1.1 2004-06-09 09:46:41 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * A JFrame that contains a FeatureList component and an Close button.
+ *
+ * @author Kim Rutherford
+ * @version $Id: FeatureListFrame.java,v 1.1 2004-06-09 09:46:41 tjc Exp $
+ **/
+
+public class FeatureListFrame extends JFrame
+ implements EntryGroupChangeListener {
+ /**
+ * Create a new FeatureListFrame component. The constructor does not call
+ * setVisible (true).
+ * @param title The title to use for the new JFrame.
+ * @param feature_list The FeatureList to show.
+ * @param selection The Selection that the commands in the menus will
+ * operate on.
+ * @param entry_group The EntryGroup object where new features/entries will
+ * be added.
+ * @param goto_event_source The object that the menu item will call
+ * makeBaseVisible () on.
+ **/
+ public FeatureListFrame (final String title,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final EntryGroup entry_group,
+ final BasePlotGroup base_plot_group) {
+ super (title);
+
+ this.entry_group = entry_group;
+
+ feature_list = new FeatureList (entry_group, selection, goto_event_source,
+ base_plot_group);
+
+ final Font default_font = Options.getOptions ().getFont ();
+
+ setFont (default_font);
+
+ final JMenuBar menu_bar = new JMenuBar ();
+
+ menu_bar.setFont (default_font);
+
+ setJMenuBar (menu_bar);
+
+ final JMenu file_menu = new JMenu ("File");
+
+ final JMenuItem close = new JMenuItem ("Close");
+ close.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ setVisible (false);
+ FeatureListFrame.this.dispose ();
+ feature_list.stopListening ();
+ }
+ });
+
+ file_menu.add (close);
+
+ menu_bar.add (file_menu);
+
+ final JMenu select_menu =
+ new SelectMenu (this, selection, goto_event_source, entry_group,
+ base_plot_group);
+ menu_bar.add (select_menu);
+
+ final JMenu view_menu =
+ new ViewMenu (this, selection, goto_event_source, entry_group,
+ base_plot_group);
+ menu_bar.add (view_menu);
+
+ final JMenu goto_menu =
+ new GotoMenu (this, selection, goto_event_source, entry_group);
+ menu_bar.add (goto_menu);
+
+ if (Options.readWritePossible ()) {
+ final JMenu edit_menu =
+ new EditMenu (this, selection, goto_event_source, entry_group,
+ base_plot_group);
+ menu_bar.add (edit_menu);
+
+ final JMenu write_menu = new WriteMenu (this, selection, entry_group);
+ menu_bar.add (write_menu);
+
+ final JMenu run_menu = new RunMenu (this, selection);
+ menu_bar.add (run_menu);
+ }
+
+ getContentPane ().add (feature_list, "Center");
+
+ final JPanel panel = new JPanel ();
+
+ final JButton close_button = new JButton ("Close");
+
+ panel.add (close_button);
+ close_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ setVisible (false);
+ FeatureListFrame.this.dispose ();
+ feature_list.stopListening ();
+ }
+ });
+
+ getContentPane ().add (panel, "South");
+ pack ();
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ setVisible (false);
+ entry_group.removeEntryGroupChangeListener (FeatureListFrame.this);
+ FeatureListFrame.this.dispose ();
+ feature_list.stopListening ();
+ }
+ });
+
+ entry_group.addEntryGroupChangeListener (this);
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+
+ int screen_height = screen.height;
+ int screen_width = screen.width;
+
+ if (screen_width <= 700 || screen_height <= 400) {
+ setSize (screen_width * 9 / 10, screen_height * 9 / 10);
+ } else {
+ setSize (700, 400);
+ }
+
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+ }
+
+ /**
+ * Implementation of the EntryGroupChangeListener interface. We listen to
+ * EntryGroupChange events so that we can get rid of the Navigator when the
+ * EntryGroup is no longer in use (for example when the EntryEdit is
+ * closed).
+ **/
+ public void entryGroupChanged (final EntryGroupChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryGroupChangeEvent.DONE_GONE:
+ entry_group.removeEntryGroupChangeListener (this);
+ dispose ();
+ break;
+ }
+ }
+
+ /**
+ * Return the FeatureList that this JFrame is displaying.
+ **/
+ public FeatureList getFeatureList () {
+ return feature_list;
+ }
+
+ /**
+ * The FeatureList that this JFrame is displaying.
+ **/
+ private FeatureList feature_list;
+
+ /**
+ * The EntryGroup that was passed to the constructor.
+ **/
+ private EntryGroup entry_group;
+}
diff --git a/uk/ac/sanger/artemis/components/FeaturePlot.java b/uk/ac/sanger/artemis/components/FeaturePlot.java
new file mode 100644
index 000000000..1707d46d8
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FeaturePlot.java
@@ -0,0 +1,389 @@
+/* FeaturePlot.java
+ *
+ * created: Wed Dec 16 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/FeaturePlot.java,v 1.1 2004-06-09 09:46:42 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.sequence.*;
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.plot.*;
+import java.awt.*;
+import java.awt.event.*;
+
+/**
+ * The components of this class display a plot of a FeatureAlgorithm for a
+ * particular feature.
+ *
+ * @author Kim Rutherford
+ * @version $Id: FeaturePlot.java,v 1.1 2004-06-09 09:46:42 tjc Exp $
+ **/
+
+public class FeaturePlot extends Plot
+ implements DisplayAdjustmentListener, FeatureChangeListener {
+ /**
+ * Create a new FeatureDisplay object.
+ * @param algorithm The object that will generate the values we plot in
+ * this component.
+ **/
+ public FeaturePlot (FeatureAlgorithm algorithm) {
+ super (algorithm, true); // true means draw a scale at the bottom of
+ // the graph
+
+ getFeature ().addFeatureChangeListener (this);
+
+ recalculate_flag = true;
+ }
+
+ /**
+ * Used by getPreferredSize () and getMinimumSize ();
+ **/
+ private final static int HEIGHT;
+
+ static {
+ final Integer feature_plot_height =
+ Options.getOptions ().getIntegerProperty ("feature_plot_height");
+
+ if (feature_plot_height == null) {
+ HEIGHT = 160;
+ } else {
+ HEIGHT = feature_plot_height.intValue ();
+ }
+ }
+
+ /**
+ * Overridden to set the component height to 150.
+ **/
+ public Dimension getPreferredSize() {
+ return (new Dimension(getSize ().width, HEIGHT));
+ }
+
+ /**
+ * Overridden to set the component height to 150.
+ **/
+ public Dimension getMinimumSize() {
+ return (new Dimension(getSize ().width, HEIGHT));
+ }
+
+ /**
+ * Remove this object as a feature change listener. (Called by
+ * FeaturePlotGroup)
+ **/
+ void stopListening () {
+ getFeature ().removeFeatureChangeListener (this);
+ }
+
+ /**
+ * Implementation of the DisplayAdjustmentListener interface. Invoked when
+ * a component scrolls or changes the scale.
+ **/
+ public void displayAdjustmentValueChanged (DisplayAdjustmentEvent event) {
+ start_base = event.getStart ();
+ end_base = event.getEnd ();
+ width_in_bases = event.getWidthInBases ();
+
+ recalculate_flag = true;
+
+ repaintCanvas ();
+ }
+
+ /**
+ * Implementation of the FeatureChangeListener interface.
+ * @param event The change event.
+ **/
+ public void featureChanged (FeatureChangeEvent event) {
+ recalculate_flag = true;
+ }
+
+ /**
+ * Return the algorithm that was passed to the constructor.
+ **/
+ public FeatureAlgorithm getFeatureAlgorithm () {
+ return (FeatureAlgorithm) super.getAlgorithm ();
+ }
+
+ /**
+ * Return the new start base to display, from the last event.
+ **/
+ private int getStart () {
+ return start_base;
+ }
+
+ /**
+ * Return the new end base to display, from the last event.
+ **/
+ private int getEnd () {
+ return end_base;
+ }
+
+ /**
+ * Return the width in bases of the display, from the last event.
+ **/
+ private int getWidthInBases () {
+ return width_in_bases;
+ }
+
+ /**
+ * This array is used by drawGraph (). It is reallocated when the scale
+ * changes.
+ **/
+ private float [][] value_array_array = null;
+
+ /**
+ * The number of bases to step before each evaluation of the algorithm.
+ * (Set by recalculateValues ()).
+ **/
+ private int step_size = 0;
+
+ /**
+ * The maximum of the values in value_array_array.
+ **/
+ private float min_value = Float.MAX_VALUE;
+
+ /**
+ * The minimum of the values in value_array_array.
+ **/
+ private float max_value = Float.MIN_VALUE;
+
+ /**
+ * Recalculate the values in value_array_array, step_size, min_value and
+ * max_value.
+ **/
+ protected void recalculateValues () {
+ final Float algorithm_minimum = getAlgorithm ().getMinimum ();
+ final Float algorithm_maximum = getAlgorithm ().getMaximum ();
+
+ // use the Algorithm specified maximum if there is one - otherwise
+ // calculate it
+ if (algorithm_maximum == null) {
+ max_value = Float.MIN_VALUE;
+ } else {
+ max_value = algorithm_maximum.floatValue ();
+ }
+
+ // use the Algorithm specified minimum if there is one - otherwise
+ // calculate it
+ if (algorithm_minimum == null) {
+ min_value = Float.MAX_VALUE;
+ } else {
+ min_value = algorithm_minimum.floatValue ();
+ }
+
+ final int window_size = getWindowSize ();
+
+ final Integer default_step_size =
+ getAlgorithm ().getDefaultStepSize (window_size);
+
+ if (default_step_size == null) {
+ step_size = window_size;
+ } else {
+ if (default_step_size.intValue () < window_size) {
+ step_size = default_step_size.intValue ();
+ } else {
+ step_size = window_size;
+ }
+ }
+
+ final int unit_count = getEnd () - getStart ();
+
+ // the number of plot points in the graph
+ final int number_of_values =
+ (unit_count - (window_size - step_size)) / step_size;
+
+ if (number_of_values < 2) {
+ // there is nothing to plot
+ value_array_array = null;
+ return;
+ }
+
+ // the number of values that getValues () will return
+ final int get_values_return_count =
+ getFeatureAlgorithm ().getValueCount ();
+
+ if (value_array_array == null) {
+ value_array_array = new float [get_values_return_count][];
+ }
+
+ if (value_array_array[0] == null ||
+ value_array_array[0].length != number_of_values) {
+ for (int i = 0 ; i < value_array_array.length ; ++i) {
+ value_array_array[i] = new float [number_of_values];
+ }
+ } else {
+ // reuse the previous arrays
+ }
+
+ if (!isVisible ()) {
+ return;
+ }
+
+ float [] temp_values = new float [get_values_return_count];
+
+ for (int i = 0 ; i < number_of_values ; ++i) {
+ getFeatureAlgorithm ().getValues (getStart () + i * step_size,
+ getStart () + i * step_size +
+ window_size - 1,
+ temp_values);
+
+ for (int value_index = 0 ;
+ value_index < get_values_return_count ;
+ ++value_index) {
+ final float current_value = temp_values[value_index];
+
+ value_array_array[value_index][i] = current_value;
+
+ // use the Algorithm specified maximum if there is one - otherwise
+ // calculate it
+ if (algorithm_maximum == null) {
+ if (current_value > max_value) {
+ max_value = current_value;
+ }
+ }
+
+ // use the Algorithm specified minimum if there is one - otherwise
+ // calculate it
+ if (algorithm_minimum == null) {
+ if (current_value < min_value) {
+ min_value = current_value;
+ }
+ }
+ }
+ }
+
+ recalculate_flag = false;
+ }
+
+ /**
+ * Redraw the graph on the canvas using the algorithm, start_base and
+ * end_base. This method plots BaseWindowAlgorithm objects only.
+ * @param g The object to draw into.
+ **/
+ protected void drawMultiValueGraph (Graphics g) {
+ if (recalculate_flag) {
+ recalculateValues ();
+ }
+
+ if (value_array_array == null) {
+ // there is nothing to draw - probably because the sequence is too short
+ drawMinMax (g, 0, 1);
+
+ return;
+ }
+
+ final int window_size = getWindowSize ();
+
+ // the number of values to plot at each x position
+ final int get_values_return_count =
+ getFeatureAlgorithm ().getValueCount ();
+
+ // the number of x positions to plot points at
+ final int number_of_values = value_array_array[0].length;
+
+ if (number_of_values > 1) {
+ drawGlobalAverage (g, min_value, max_value);
+ }
+
+ for (int value_index = 0 ;
+ value_index < get_values_return_count ;
+ ++value_index) {
+ if (get_values_return_count == 1) {
+ g.setColor (Color.black);
+ } else {
+ switch (value_index) {
+ case 0:
+ g.setColor (new Color (255, 0, 0));
+ break;
+ case 1:
+ g.setColor (new Color (100, 255, 100));
+ break;
+ case 2:
+ g.setColor (new Color (0, 0, 255));
+ break;
+ default:
+ g.setColor (Color.black);
+ }
+ }
+
+ drawPoints (g, min_value, max_value, step_size, window_size,
+ getCanvas ().getSize ().width,
+ 0, // no offset.
+ value_array_array[value_index]);
+ }
+
+ drawMinMax (g, min_value, max_value);
+
+ drawScaleLine (g, getStart (), getEnd ());
+
+ final int cross_hair_position = getCrossHairPosition ();
+
+ if (cross_hair_position >= 0) {
+ if (cross_hair_position >= getTranslation ().length ()) {
+ cancelCrossHairs ();
+ } else {
+ drawCrossHair (g, cross_hair_position,
+ String.valueOf (getPointPosition (cross_hair_position +
+ getStart () - 1)),
+ 0);
+ }
+ }
+ }
+
+ /**
+ * Get the position in the Feature of the given canvas x position. This
+ * amino acid position is the label used when the user clicks the mouse in
+ * on the canvas (see drawCrossHair ()).
+ **/
+ protected int getPointPosition (final int canvas_x_position) {
+ return canvas_x_position + 1;
+ }
+
+ /**
+ * Return the feature that this component is plotting.
+ **/
+ private Feature getFeature () {
+ return getFeatureAlgorithm ().getFeature ();
+ }
+
+ /**
+ * Return the translation of the bases of the feature we are plotting.
+ **/
+ private AminoAcidSequence getTranslation () {
+ return getFeature ().getTranslation ();
+ }
+
+ /**
+ * The start base to plot, as obtained from the DisplayAdjustmentEvent.
+ **/
+ private int start_base;
+
+ /**
+ * The end base to plot, as obtained from the DisplayAdjustmentEvent.
+ **/
+ private int end_base;
+
+ /**
+ * The width in bases of the display, as obtained from the
+ * DisplayAdjustmentEvent.
+ **/
+ private int width_in_bases;
+}
diff --git a/uk/ac/sanger/artemis/components/FeaturePlotGroup.java b/uk/ac/sanger/artemis/components/FeaturePlotGroup.java
new file mode 100644
index 000000000..ca1244457
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FeaturePlotGroup.java
@@ -0,0 +1,337 @@
+/* FeaturePlotGroup.java
+ *
+ * created: Wed Dec 16 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/FeaturePlotGroup.java,v 1.1 2004-06-09 09:46:43 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+import uk.ac.sanger.artemis.plot.*;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.util.Vector;
+
+import javax.swing.*;
+
+/**
+ * This is a super-component containing several FeaturePlot components, each
+ * of which can toggled off and on. The component contains a row of toggle
+ * buttons and then the FeaturePlot components below.
+ *
+ * @author Kim Rutherford
+ * @version $Id: FeaturePlotGroup.java,v 1.1 2004-06-09 09:46:43 tjc Exp $
+ **/
+
+public class FeaturePlotGroup extends JFrame
+ implements EntryChangeListener, FeatureChangeListener {
+ /**
+ * Create a new FeaturePlotGroup component for the given feature.
+ **/
+ public FeaturePlotGroup (Feature feature) {
+ super ("Graphs for: " + feature.getIDString ());
+ this.feature = feature;
+ this.entry = feature.getEntry ();
+
+ // don't repeat an algorithm in this array.
+ final FeatureAlgorithm [] plot_value_producers = {
+ new HydrophobicityAlgorithm (getFeature ()),
+ new HydrophilicityAlgorithm (getFeature ()),
+ new CoilFeatureAlgorithm (getFeature ())
+ };
+
+ final Font font = Options.getOptions ().getFont ();
+
+ setFont (font);
+
+ GridBagLayout gridbag = new GridBagLayout();
+ getContentPane ().setLayout (gridbag);
+
+ GridBagConstraints c = new GridBagConstraints();
+
+ c.anchor = GridBagConstraints.NORTH;
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ c.gridheight = 1;
+ c.weightx = 1;
+ c.fill = GridBagConstraints.BOTH;
+ c.weighty = 1;
+// c.insets = new Insets (0,0,5,0);
+
+ for (int i = 0 ; i < plot_value_producers.length ; ++i) {
+ final FeatureAlgorithm this_algorithm = plot_value_producers[i];
+
+ final FeaturePlot new_feature_plot = new FeaturePlot (this_algorithm);
+
+ gridbag.setConstraints (new_feature_plot, c);
+ getContentPane ().add (new_feature_plot);
+ new_feature_plot.setVisible (true);
+ }
+
+ getFeature ().getEntry ().addEntryChangeListener (this);
+ getFeature ().addFeatureChangeListener (this);
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ stopListening ();
+ FeaturePlotGroup.this.dispose ();
+ }
+ });
+
+ addComponentListener (new ComponentAdapter () {
+ public void componentResized (ComponentEvent event) {
+ fixScrollbar ();
+ fireAdjustmentEvent (scrollbar.getValue ());
+ }
+ });
+
+ int new_x_size = feature.getTranslation ().length () + SCROLL_BAR_SIZE;
+
+ if (new_x_size > 1000) {
+ new_x_size = 1000;
+ }
+
+ if (new_x_size < 300) {
+ new_x_size = 300;
+ }
+
+ scrollbar = new JScrollBar (Scrollbar.HORIZONTAL);
+ c.fill = GridBagConstraints.HORIZONTAL;
+ c.weighty = 0;
+ gridbag.setConstraints (scrollbar, c);
+ scrollbar.addAdjustmentListener (new AdjustmentListener () {
+ public void adjustmentValueChanged(AdjustmentEvent e) {
+ fireAdjustmentEvent (e.getValue ());
+ }
+ });
+ getContentPane ().add (scrollbar);
+
+ final Component [] children = getContentPane ().getComponents ();
+
+ for (int i = 0 ; i < children.length ; ++i) {
+ if (children[i] instanceof FeaturePlot) {
+ addDisplayAdjustmentListener ((FeaturePlot)children[i]);
+ }
+ }
+
+
+ bottom_button_panel = new JPanel ();
+ c.fill = GridBagConstraints.HORIZONTAL;
+ c.weighty = 0;
+ gridbag.setConstraints (bottom_button_panel, c);
+ getContentPane ().add (bottom_button_panel);
+
+ close_button = new JButton ("Close");
+ close_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ stopListening ();
+ FeaturePlotGroup.this.dispose ();
+ }
+ });
+
+ bottom_button_panel.add (close_button);
+
+ pack ();
+
+ // give each FeaturePlot component a height of 200
+ setSize (new_x_size, getSize ().height);
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+
+ show ();
+
+ fixScrollbar ();
+
+ fireAdjustmentEvent (1);
+ }
+
+ /**
+ * Fudge factor to take the scroll bar width into account when creating
+ * windows and scrollbars.
+ **/
+ private final int SCROLL_BAR_SIZE = 100;
+
+ /**
+ * Remove this object as a entry change listener and then call
+ * stopListening () on each FeaturePlot component.
+ **/
+ private void stopListening () {
+ getEntry ().removeEntryChangeListener (this);
+
+ final Component [] children = getComponents ();
+
+ for (int i = 0 ; i < children.length ; ++i) {
+ if (children[i] instanceof FeaturePlot) {
+ ((FeaturePlot)children[i]).stopListening ();
+ }
+ }
+
+ getFeature ().getEntry ().removeEntryChangeListener (this);
+ getFeature ().removeFeatureChangeListener (this);
+ }
+
+ /**
+ * Set the scrollbar maximum, minimum and value.
+ **/
+ private void fixScrollbar () {
+ final int feature_length = getFeature ().getTranslation ().length ();
+
+ int scroll_max = feature_length;
+
+ if (scroll_max < 1) {
+ scroll_max = 1;
+ }
+
+ scrollbar.setValues (1, getSize ().width,
+ 1, scroll_max + SCROLL_BAR_SIZE);
+
+ scrollbar.setBlockIncrement (getSize ().width);
+ }
+
+ /**
+ * Adds the specified event adjustemnt listener to receive adjustment
+ * change events from this object.
+ * @param l the event change listener.
+ **/
+ private void addDisplayAdjustmentListener (DisplayAdjustmentListener l) {
+ adjustment_listener_list.addElement (l);
+ }
+
+ /**
+ * Removes the specified event listener so that it no longer receives
+ * adjustment change events from this object.
+ * @param l the event change listener.
+ **/
+ private void removeDisplayAdjustmentListener (DisplayAdjustmentListener l) {
+ adjustment_listener_list.removeElement (l);
+ }
+
+ /**
+ * Implementation of the FeatureChangeListener interface.
+ * @param event The change event.
+ **/
+ public void featureChanged (FeatureChangeEvent event) {
+ fixScrollbar ();
+ fireAdjustmentEvent (scrollbar.getValue ());
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface. We listen to
+ * EntryChange events so we can delete this component if the feature gets
+ * deleted.
+ **/
+ public void entryChanged (EntryChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryChangeEvent.FEATURE_DELETED:
+ if (event.getFeature () == getFeature ()) {
+ stopListening ();
+ dispose ();
+ }
+ break;
+ default:
+ // do nothing;
+ break;
+ }
+ }
+
+ /**
+ * Send a DisplayAdjustmentEvent to the objects that are listening for it.
+ **/
+ private void fireAdjustmentEvent (final int scroll_value) {
+ final int feature_length = getFeature ().getTranslation ().length ();
+
+ int end_value = scroll_value + getSize ().width;
+
+ if (end_value > feature_length) {
+ end_value = feature_length;
+ }
+
+ final DisplayAdjustmentEvent event =
+ new DisplayAdjustmentEvent (this,
+ scroll_value,
+ end_value,
+ getSize ().width,
+ 1,
+ 0,// this arg will be ignored
+ false,
+ DisplayAdjustmentEvent.SCALE_ADJUST_EVENT);
+
+ final Vector targets;
+
+ // copied from a book - synchronising the whole method might cause a
+ // deadlock
+ synchronized (this) {
+ targets = (Vector) adjustment_listener_list.clone ();
+ }
+
+ for ( int i = 0 ; i < targets.size () ; ++i ) {
+ DisplayAdjustmentListener target =
+ (DisplayAdjustmentListener) targets.elementAt (i);
+
+ target.displayAdjustmentValueChanged (event);
+ }
+ }
+
+ /**
+ * Return the feature that this component is plotting.
+ **/
+ private Feature getFeature () {
+ return feature;
+ }
+
+ /**
+ * Return the Entry that contains the Feature this object is displaying.
+ **/
+ private Entry getEntry () {
+ return entry;
+ }
+
+ /**
+ * The feature we are plotting.
+ **/
+ private Feature feature;
+
+ /**
+ * The Entry that contains the Feature this object is displaying.
+ **/
+ private Entry entry;
+
+ /**
+ * Pressing this button will distroy the JFrame.
+ **/
+ private JButton close_button;
+
+ /**
+ * A JPanel to hold the buttons.
+ **/
+ private JPanel bottom_button_panel;
+
+ private JScrollBar scrollbar;
+
+ /**
+ * A vector of those objects listening for adjustment events.
+ **/
+ final private Vector adjustment_listener_list = new Vector ();
+}
diff --git a/uk/ac/sanger/artemis/components/FeaturePopup.java b/uk/ac/sanger/artemis/components/FeaturePopup.java
new file mode 100644
index 000000000..f978e2a63
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FeaturePopup.java
@@ -0,0 +1,758 @@
+/* FeaturePopup.java
+ *
+ * created: Wed Oct 21 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 1998,1999,2000,2001,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/FeaturePopup.java,v 1.1 2004-06-09 09:46:45 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.util.StringVector;
+
+import java.io.*;
+import java.awt.MenuItem;
+import java.awt.CheckboxMenuItem;
+import java.awt.event.*;
+import javax.swing.*;
+
+/**
+ * FeaturePopup class
+ *
+ * @author Kim Rutherford
+ * @version $Id: FeaturePopup.java,v 1.1 2004-06-09 09:46:45 tjc Exp $
+ *
+ **/
+
+public class FeaturePopup extends JPopupMenu
+{
+
+ /**
+ * The reference of the EntryGroup object that was passed to the
+ * constructor.
+ **/
+ private EntryGroup entry_group;
+
+ /**
+ * This is the Selection object that was passed to the constructor.
+ **/
+ final private Selection selection;
+
+ /**
+ * This is a reference to the GotoEventSource object that was passed to the
+ * constructor.
+ **/
+ private GotoEventSource goto_event_source;
+
+ /**
+ * The reference of the object that created this popup.
+ **/
+ private DisplayComponent owner;
+
+ /**
+ * If the parent component of this popup is a FeatureDisplay then this will
+ * contain it's reference.
+ **/
+ private FeatureDisplay feature_display = null;
+
+ /**
+ * If the parent component of this popup is a FeatureList then this will
+ * contain it's reference.
+ **/
+ private FeatureList feature_list = null;
+
+ /**
+ * Set by the constructor to be the(possibly) empty vector of selected
+ * features.
+ **/
+ private FeatureVector selection_features;
+
+ /**
+ * Set by the constructor to be the(possibly) empty vector of selected
+ * features.
+ **/
+ private FeatureSegmentVector selection_segments;
+
+ private JCheckBoxMenuItem show_labels_item = null;
+ private JCheckBoxMenuItem one_line_per_entry_item = null;
+ private JCheckBoxMenuItem show_forward_frame_lines_item = null;
+ private JCheckBoxMenuItem show_reverse_frame_lines_item = null;
+ private JCheckBoxMenuItem show_start_codons_item = null;
+ private JCheckBoxMenuItem show_stop_codons_item = null;
+ private JCheckBoxMenuItem show_feature_arrows_item = null;
+ private JCheckBoxMenuItem show_feature_borders_item = null;
+ private JCheckBoxMenuItem frame_features_item = null;
+ private JCheckBoxMenuItem source_features_item = null;
+ private JCheckBoxMenuItem rev_comp_display_item = null;
+ private JCheckBoxMenuItem base_colours_item = null;
+ private JCheckBoxMenuItem correlation_scores_item = null;
+ private JCheckBoxMenuItem show_genes_item = null;
+ private JCheckBoxMenuItem show_products_item = null;
+ private JCheckBoxMenuItem show_qualifiers_item = null;
+ private JMenuItem entry_group_menu_item = null;
+ private JMenuItem select_menu_item = null;
+ private JMenuItem add_menu_item = null;
+ private JMenuItem view_menu_item = null;
+ private JMenuItem edit_menu_item = null;
+ private JMenuItem goto_menu_item = null;
+ private JMenuItem write_menu_item = null;
+ private JMenuItem run_menu_item = null;
+ private JMenuItem broadcast_item = null;
+ private JMenuItem raise_feature_item = null;
+ private JMenuItem lower_feature_item = null;
+ private JMenuItem smallest_to_front_item = null;
+ private JMenuItem zoom_to_selection_item = null;
+ private JMenuItem score_cutoffs_item = null;
+ private JMenuItem select_visible_range = null;
+ private JMenuItem save_feature_list_item = null;
+ private JMenuItem select_visible_features = null;
+
+ private BasePlotGroup base_plot_group = null;
+
+ /**
+ * Create a new FeaturePopup object.
+ * @param owner The component where this popup was popped up from.
+ * @param selection The selection to use for this popup.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public FeaturePopup(final DisplayComponent owner,
+ final EntryGroup entry_group,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final BasePlotGroup base_plot_group)
+ {
+ super(getMenuName(owner));
+
+ this.owner = owner;
+ this.entry_group = entry_group;
+ this.selection = selection;
+ this.goto_event_source = goto_event_source;
+ this.base_plot_group = base_plot_group;
+
+ selection_features = selection.getSelectedFeatures();
+ selection_segments = selection.getSelectedSegments();
+
+ makeSubMenus();
+
+ addGenericItems();
+
+ if(owner instanceof FeatureDisplay)
+ {
+ feature_display =(FeatureDisplay) owner;
+ addFeatureDisplayItems();
+ }
+ else
+ {
+ // must be a FeatureList
+ feature_list =(FeatureList) owner;
+ addFeatureListItems();
+ }
+
+ maybeAdd(raise_feature_item);
+ maybeAdd(lower_feature_item);
+ maybeAdd(smallest_to_front_item);
+ maybeAdd(zoom_to_selection_item);
+ maybeAdd(select_visible_range);
+ maybeAdd(select_visible_features);
+ maybeAdd(score_cutoffs_item);
+ maybeAdd(save_feature_list_item);
+ addSeparator();
+ maybeAdd(entry_group_menu_item);
+ maybeAdd(select_menu_item);
+ maybeAdd(goto_menu_item);
+ maybeAdd(view_menu_item);
+ maybeAdd(edit_menu_item);
+ maybeAdd(add_menu_item);
+ maybeAdd(write_menu_item);
+ maybeAdd(run_menu_item);
+ addSeparator();
+ maybeAdd(show_labels_item);
+ maybeAdd(one_line_per_entry_item);
+ maybeAdd(show_forward_frame_lines_item);
+ maybeAdd(show_reverse_frame_lines_item);
+ maybeAdd(show_start_codons_item);
+ maybeAdd(show_stop_codons_item);
+ maybeAdd(show_feature_arrows_item);
+ maybeAdd(show_feature_borders_item);
+ maybeAdd(frame_features_item);
+ maybeAdd(source_features_item);
+ maybeAdd(rev_comp_display_item);
+ maybeAdd(base_colours_item);
+ maybeAdd(correlation_scores_item);
+ maybeAdd(show_genes_item);
+ maybeAdd(show_qualifiers_item);
+ maybeAdd(show_products_item);
+ addSeparator();
+ maybeAdd(broadcast_item);
+ }
+
+ /**
+ * Rename the name String to use for this JMenu.
+ **/
+ private static String getMenuName(final DisplayComponent owner)
+ {
+ if(owner instanceof FeatureDisplay)
+ return "Feature Viewer JMenu";
+ else
+ return "Feature List JMenu";
+ }
+
+ /**
+ * Add an item only if it isn't null.
+ **/
+ private void maybeAdd(JMenuItem item)
+ {
+ if(item != null)
+ add(item);
+ }
+
+ /**
+ * Create those menu items that are relevant to all components.
+ **/
+ private void addGenericItems()
+ {
+ if(selection_features.size() > 0 || selection_segments.size() > 0) {
+
+ }
+ }
+
+ /**
+ * Create the Edit, Add and View sub menus.
+ **/
+ public void makeSubMenus()
+ {
+ final JFrame frame = owner.getParentFrame();
+ entry_group_menu_item = new EntryGroupMenu(frame, getEntryGroup());
+
+ select_menu_item = new SelectMenu(frame, selection,
+ getGotoEventSource(),
+ getEntryGroup(),
+ base_plot_group);
+
+ view_menu_item = new ViewMenu(frame, selection,
+ getGotoEventSource(),
+ getEntryGroup(),
+ base_plot_group);
+
+ goto_menu_item = new GotoMenu(frame, selection,
+ getGotoEventSource(),
+ getEntryGroup());
+
+ if(Options.readWritePossible())
+ {
+ edit_menu_item = new EditMenu(frame, selection,
+ getGotoEventSource(),
+ getEntryGroup(),
+ base_plot_group);
+ if(entry_group instanceof SimpleEntryGroup)
+ add_menu_item = new AddMenu(frame, selection,
+ getEntryGroup(),
+ getGotoEventSource(),
+ base_plot_group);
+
+ write_menu_item = new WriteMenu(frame, selection,
+ getEntryGroup());
+ if(Options.isUnixHost())
+ run_menu_item = new RunMenu(frame, selection);
+ }
+ }
+
+ /**
+ * Create those menu items that are relevant only to FeatureDisplay objects.
+ **/
+ private void addFeatureDisplayItems()
+ {
+ show_start_codons_item = new JCheckBoxMenuItem("Start Codons");
+ show_start_codons_item.setState(feature_display.getShowStartCodons());
+ show_start_codons_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent event)
+ {
+ feature_display.setShowStartCodons(show_start_codons_item.getState());
+ }
+ });
+
+ show_stop_codons_item = new JCheckBoxMenuItem("Stop Codons");
+ show_stop_codons_item.setState(feature_display.getShowStopCodons());
+ show_stop_codons_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent event)
+ {
+ feature_display.setShowStopCodons(show_stop_codons_item.getState());
+ }
+ });
+
+ show_feature_arrows_item = new JCheckBoxMenuItem("Feature Arrows");
+ show_feature_arrows_item.setState(feature_display.getShowFeatureArrows());
+ show_feature_arrows_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent event)
+ {
+ feature_display.setShowFeatureArrows(show_feature_arrows_item.getState());
+ }
+ });
+
+ show_feature_borders_item = new JCheckBoxMenuItem("Feature Borders");
+ show_feature_borders_item.setState(feature_display.getShowFeatureBorders());
+ show_feature_borders_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent event)
+ {
+ feature_display.setShowFeatureBorders(show_feature_borders_item.getState());
+ }
+ });
+
+ show_labels_item = new JCheckBoxMenuItem("Feature Labels");
+ show_labels_item.setState(feature_display.getShowLabels());
+ show_labels_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent e)
+ {
+ feature_display.setShowLabels(show_labels_item.getState());
+ }
+ });
+
+ one_line_per_entry_item = new JCheckBoxMenuItem("One Line Per Entry");
+ one_line_per_entry_item.setState(feature_display.getOneLinePerEntryFlag());
+ one_line_per_entry_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent e)
+ {
+ final boolean new_state = one_line_per_entry_item.getState();
+ if(new_state && getEntryGroup().size() > 8)
+ feature_display.setShowLabels(false);
+ feature_display.setOneLinePerEntry(new_state);
+ }
+ });
+
+ show_forward_frame_lines_item =
+ new JCheckBoxMenuItem("Forward Frame Lines");
+ show_forward_frame_lines_item.setState(feature_display.getShowForwardFrameLines());
+ show_forward_frame_lines_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent e)
+ {
+ feature_display.setShowForwardFrameLines(show_forward_frame_lines_item.getState());
+ }
+ });
+
+ show_reverse_frame_lines_item =
+ new JCheckBoxMenuItem("Reverse Frame Lines");
+ show_reverse_frame_lines_item.setState(feature_display.getShowReverseFrameLines());
+ show_reverse_frame_lines_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent e)
+ {
+ feature_display.setShowReverseFrameLines(show_reverse_frame_lines_item.getState());
+ }
+ });
+
+ frame_features_item = new JCheckBoxMenuItem("All Features On Frame Lines");
+ frame_features_item.setState(feature_display.getFrameFeaturesFlag());
+ frame_features_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent e)
+ {
+ feature_display.setFrameFeaturesFlag(frame_features_item.getState());
+ }
+ });
+
+ source_features_item = new JCheckBoxMenuItem("Show Source Features");
+ source_features_item.setState(feature_display.getShowSourceFeatures());
+ source_features_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent e)
+ {
+ feature_display.setShowSourceFeatures(source_features_item.getState());
+ }
+ });
+
+ rev_comp_display_item = new JCheckBoxMenuItem("Flip Display");
+
+ rev_comp_display_item.setState(feature_display.isRevCompDisplay());
+ rev_comp_display_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent e)
+ {
+ feature_display.setRevCompDisplay(rev_comp_display_item.getState());
+ }
+ });
+
+ base_colours_item = new JCheckBoxMenuItem("Colourise Bases");
+ base_colours_item.setState(feature_display.getShowBaseColours());
+ base_colours_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent e)
+ {
+ feature_display.setShowBaseColours(base_colours_item.getState());
+ }
+ });
+
+ smallest_to_front_item =
+ new JMenuItem("Smallest Features In Front");
+ smallest_to_front_item.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ // clear the selection because selected features will always be on
+ // top - which is not usually what is wanted
+ selection.clear();
+ feature_display.smallestToFront();
+ }
+ });
+
+ score_cutoffs_item = new JMenuItem("Set Score Cutoffs ...");
+
+ score_cutoffs_item.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ final ScoreChangeListener minimum_listener =
+ new ScoreChangeListener()
+ {
+ public void scoreChanged(final ScoreChangeEvent event)
+ {
+ feature_display.setMinimumScore(event.getValue());
+ }
+ };
+
+ final ScoreChangeListener maximum_listener =
+ new ScoreChangeListener()
+ {
+ public void scoreChanged(final ScoreChangeEvent event)
+ {
+ feature_display.setMaximumScore(event.getValue());
+ }
+ };
+
+ final ScoreChanger score_changer =
+ new ScoreChanger("Score Cutoffs",
+ minimum_listener, maximum_listener,
+ 0, 100);
+
+ score_changer.setVisible(true);
+ }
+ });
+
+ if(selection_features.size() > 0 || selection_segments.size() > 0)
+ {
+ raise_feature_item = new JMenuItem("Raise Selected Features");
+ raise_feature_item.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ raiseSelection();
+ }
+ });
+
+ lower_feature_item = new JMenuItem("Lower Selected Features");
+ lower_feature_item.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ lowerSelection();
+ }
+ });
+ }
+
+ if(!selection.isEmpty())
+ {
+ zoom_to_selection_item = new JMenuItem("Zoom to Selection");
+ zoom_to_selection_item.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ zoomToSelection((FeatureDisplay) owner);
+ }
+ });
+ }
+
+
+ select_visible_range =
+ new JMenuItem("Select Visible Range");
+ select_visible_range.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ selection.setMarkerRange(feature_display.getVisibleMarkerRange());
+ }
+ });
+
+ select_visible_features =
+ new JMenuItem("Select Visible Features");
+ select_visible_features.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ selection.set(feature_display.getCurrentVisibleFeatures());
+ }
+ });
+ }
+
+ /**
+ * Create those menu items that are relevant only to FeatureList objects.
+ **/
+ private void addFeatureListItems()
+ {
+ if(Options.getOptions().readWritePossible())
+ {
+ save_feature_list_item = new JMenuItem("Save List To File ...");
+ save_feature_list_item.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ saveFeatureList();
+ }
+ });
+ }
+
+ correlation_scores_item = new JCheckBoxMenuItem("Show Correlation Scores");
+ correlation_scores_item.setState(feature_list.getCorrelationScores());
+ correlation_scores_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent e)
+ {
+ feature_list.setCorrelationScores(correlation_scores_item.getState());
+ }
+ });
+
+ show_genes_item = new JCheckBoxMenuItem("Show Gene Names");
+ show_genes_item.setState(feature_list.getShowGenes());
+ show_genes_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent e)
+ {
+ feature_list.setShowGenes(show_genes_item.getState());
+ }
+ });
+
+ show_products_item = new JCheckBoxMenuItem("Show Products");
+ show_products_item.setState(feature_list.getShowProducts());
+ show_products_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent e)
+ {
+ if(show_products_item.getState())
+ feature_list.setShowQualifiers(false);
+
+ feature_list.setShowProducts(show_products_item.getState());
+ }
+ });
+
+ show_qualifiers_item = new JCheckBoxMenuItem("Show Qualifiers");
+ show_qualifiers_item.setState(feature_list.getShowQualifiers());
+ show_qualifiers_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent e)
+ {
+ feature_list.setShowQualifiers(show_qualifiers_item.getState());
+ if(show_qualifiers_item.getState())
+ feature_list.setShowProducts(false);
+ }
+ });
+ }
+
+ /**
+ * Save the text of the feature list to a file.
+ **/
+ private void saveFeatureList()
+ {
+ final JFrame frame = owner.getParentFrame();
+ final StickyFileChooser file_dialog = new StickyFileChooser();
+
+ file_dialog.setDialogTitle("Choose save file ...");
+ file_dialog.setDialogType(JFileChooser.SAVE_DIALOG);
+ final int status = file_dialog.showOpenDialog(frame);
+
+ if(status != JFileChooser.APPROVE_OPTION ||
+ file_dialog.getSelectedFile() == null)
+ return;
+
+ final File write_file =
+ new File(file_dialog.getCurrentDirectory(),
+ file_dialog.getSelectedFile().getName());
+
+ if(write_file.exists())
+ {
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog(frame,
+ "this file exists: " + write_file +
+ " overwrite it?");
+ if(yes_no_dialog.getResult())
+ {
+ // yes - continue
+ }
+ else
+ return;
+ }
+
+ try
+ {
+ final PrintWriter writer =
+ new PrintWriter(new FileWriter(write_file));
+
+ final StringVector list_strings = feature_list.getListStrings();
+
+ for(int i = 0 ; i < list_strings.size() ; ++i)
+ writer.println(list_strings.elementAt(i));
+
+ writer.close();
+ }
+ catch(IOException e)
+ {
+ new MessageDialog(frame, "error while writing: " + e.getMessage());
+ }
+ }
+
+ /**
+ * Raise the selected features. (FeatureDisplay only.)
+ **/
+ private void raiseSelection()
+ {
+ final FeatureVector features_to_raise = selection.getAllFeatures();
+
+ for(int i = 0 ; i < features_to_raise.size() ; ++i)
+ {
+ final Feature selection_feature = features_to_raise.elementAt(i);
+ feature_display.raiseFeature(selection_feature);
+ }
+ }
+
+ /**
+ * Lower the selected features. (FeatureDisplay only.)
+ **/
+ private void lowerSelection()
+ {
+ final FeatureVector features_to_lower = selection.getAllFeatures();
+
+ for(int i = 0 ; i < features_to_lower.size() ; ++i)
+ {
+ final Feature selection_feature = features_to_lower.elementAt(i);
+ feature_display.lowerFeature(selection_feature);
+ }
+ }
+
+ /**
+ * Zoom the FeatureDisplay to the selection.
+ **/
+ static void zoomToSelection(final FeatureDisplay feature_display)
+ {
+ final Selection selection = feature_display.getSelection();
+
+ if(selection.isEmpty())
+ return;
+
+ // why bother in this case?
+ if(feature_display.getEntryGroup().getSequenceLength() < 1000)
+ return;
+
+ int first_base;
+ int last_base;
+
+ final FeatureSegmentVector segments = selection.getSelectedSegments();
+
+ if(segments.size() == 1)
+ {
+ // special case - zoom to the feature instead
+ first_base = segments.elementAt(0).getFeature().getRawFirstBase();
+ last_base = segments.elementAt(0).getFeature().getRawLastBase();
+ }
+ else
+ {
+ first_base = selection.getLowestBaseOfSelection().getRawPosition();
+ last_base = selection.getHighestBaseOfSelection().getRawPosition();
+ }
+
+ if(first_base < 250)
+ first_base = 250;
+ else
+ first_base -= 250;
+
+ last_base += 250;
+
+ feature_display.setFirstAndLastBase(first_base, last_base);
+ }
+
+ /**
+ * Return the EntryGroup object that this FeatureDisplay is displaying.
+ **/
+ private EntryGroup getEntryGroup()
+ {
+ return entry_group;
+ }
+
+ /**
+ * Return an object that implements the GotoEventSource interface and is
+ * for the sequence that this DisplayComponent is displaying.
+ **/
+ public GotoEventSource getGotoEventSource()
+ {
+ return goto_event_source;
+ }
+
+ /**
+ * Return a new CheckboxMenuItem unless the VM is 1.2 or worse(ie. 1.3 or
+ * 1.4) on GNU/Linux, in which case return a new ArtemisCheckboxMenuItem
+ **/
+ private MenuItem makeCheckboxMenuItem(final String item_name)
+ {
+ if(Options.getOptions().isBuggyLinuxVM() &&
+ Options.getOptions().getPropertyTruthValue("buggy_linux_vm_fix"))
+ return new ArtemisCheckboxMenuItem(item_name);
+ else
+ return new CheckboxMenuItem(item_name);
+ }
+
+ /**
+ * Add a ItemListener to a ArtemisCheckboxMenuItem or a CheckboxMenuItem.
+ **/
+ private void addMenuItemListener(final MenuItem menu_item,
+ final ItemListener listener)
+ {
+ if(menu_item instanceof ArtemisCheckboxMenuItem)
+ ((ArtemisCheckboxMenuItem)menu_item).addItemListener(listener);
+ else
+ ((CheckboxMenuItem)menu_item).addItemListener(listener);
+ }
+
+ /**
+ * Set the state of a ArtemisCheckboxMenuItem or a CheckboxMenuItem.
+ **/
+ private void setCheckboxMenuItemState(final MenuItem menu_item,
+ final boolean state)
+ {
+ if(menu_item instanceof ArtemisCheckboxMenuItem)
+ ((ArtemisCheckboxMenuItem)menu_item).setState(state);
+ else
+ ((CheckboxMenuItem)menu_item).setState(state);
+ }
+
+ /**
+ * Get the state of a ArtemisCheckboxMenuItem or a CheckboxMenuItem.
+ **/
+ private boolean getCheckboxMenuItemState(final MenuItem menu_item)
+ {
+ if(menu_item instanceof ArtemisCheckboxMenuItem)
+ return((ArtemisCheckboxMenuItem)menu_item).getState();
+ else
+ return((CheckboxMenuItem)menu_item).getState();
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/FeatureViewer.java b/uk/ac/sanger/artemis/components/FeatureViewer.java
new file mode 100644
index 000000000..3a4afd0db
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FeatureViewer.java
@@ -0,0 +1,151 @@
+/* FeatureViewer.java
+ *
+ * created: Thu Nov 19 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/FeatureViewer.java,v 1.1 2004-06-09 09:46:46 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import java.io.*;
+import java.awt.event.*;
+
+/**
+ * A viewer for Feature objects.
+ *
+ * @author Kim Rutherford
+ * @version $Id: FeatureViewer.java,v 1.1 2004-06-09 09:46:46 tjc Exp $
+ *
+ **/
+
+public class FeatureViewer
+ implements EntryChangeListener, FeatureChangeListener {
+ /**
+ * Create a new FeatureViewer object from the given Feature.
+ **/
+ public FeatureViewer (Feature view_feature) {
+ this.view_feature = view_feature;
+ this.entry = view_feature.getEntry ();
+
+ file_viewer = new FileViewer ("Artemis Feature View: " +
+ view_feature.getIDString ());
+ readFeature (view_feature);
+
+ view_feature.getEntry ().addEntryChangeListener (this);
+ view_feature.addFeatureChangeListener (this);
+
+ file_viewer.addWindowListener (new WindowAdapter () {
+ public void windowClosed (WindowEvent event) {
+ stopListening ();
+ }
+ });
+ }
+
+ /**
+ * Remove this object as a feature and entry change listener.
+ **/
+ public void stopListening () {
+ getEntry ().removeEntryChangeListener (this);
+ getFeature ().removeFeatureChangeListener (this);
+ }
+
+ /**
+ * Implementation of the EntryChangeListener interface. We listen to
+ * EntryChange events so we can delete this component if the feature gets
+ * deleted.
+ **/
+ public void entryChanged (EntryChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryChangeEvent.FEATURE_DELETED:
+ if (event.getFeature () == view_feature) {
+ stopListening ();
+ file_viewer.dispose ();
+ }
+ break;
+ default:
+ // do nothing;
+ break;
+ }
+ }
+
+ /**
+ * Implementation of the FeatureChangeListener interface. We need to
+ * listen to feature change events from the Features in this object so that
+ * we can keep the display up to date.
+ * @param event The change event.
+ **/
+ public void featureChanged (FeatureChangeEvent event) {
+ // re-read the information from the feature
+ readFeature (view_feature);
+ }
+
+ /**
+ * Read the given Feature into this FeatureViewer object.
+ **/
+ public void readFeature (Feature feature) {
+ try {
+ file_viewer.clear ();
+ file_viewer.appendFile (view_feature.toReader ());
+ } catch (uk.ac.sanger.artemis.io.ReadFormatException e) {
+ throw new Error ("internal error - unexpected exception: " +
+ e.getMessage () +
+ (e.getLineNumber () > 1 ?
+ " at line " + e.getLineNumber () :
+ ""));
+ } catch (IOException e) {
+ throw new Error ("internal error - unexpected exception: " +
+ e.getMessage ());
+ }
+ }
+
+ /**
+ * Return the Feature we are viewing.
+ **/
+ public Feature getFeature () {
+ return view_feature;
+ }
+
+ /**
+ * Return the Entry that contains the Feature this object is displaying.
+ **/
+ private Entry getEntry () {
+ return entry;
+ }
+
+ /**
+ * The Feature this object is displaying.
+ **/
+ private Feature view_feature;
+
+ /**
+ * The Entry that contains the Feature this object is displaying.
+ **/
+ private Entry entry;
+
+ /**
+ * The FileViewer object that is displaying the feature.
+ **/
+ private FileViewer file_viewer;
+}
+
+
diff --git a/uk/ac/sanger/artemis/components/FileDialogEntrySource.java b/uk/ac/sanger/artemis/components/FileDialogEntrySource.java
new file mode 100644
index 000000000..1a8ea9fd8
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FileDialogEntrySource.java
@@ -0,0 +1,286 @@
+/* FileDialogEntrySource.java
+ *
+ * created: Thu Jun 8 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/FileDialogEntrySource.java,v 1.1 2004-06-09 09:46:49 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+import uk.ac.sanger.artemis.util.*;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.SimpleEntryInformation;
+
+import javax.swing.JFrame;
+
+/**
+ * This is an EntrySource that reads Entry objects from the local filesystem.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: FileDialogEntrySource.java,v 1.1 2004-06-09 09:46:49 tjc Exp $
+ **/
+
+public class FileDialogEntrySource
+ implements EntrySource
+{
+
+ /**
+ * The component that created this FileEntrySource. (Used for requesters.)
+ **/
+ final JFrame frame;
+
+ /** InputStreamProgressEvents are sent to this object. */
+ private final InputStreamProgressListener stream_progress_listener;
+
+ /**
+ * Create a new FileDialogEntrySource.
+ * @param frame The component that created this FileDialogEntrySource.
+ * (Used for requesters.)
+ * @param listener InputStreamProgressEvent objects will be sent to this
+ * listener as progress on reading is made.
+ **/
+ public FileDialogEntrySource (final JFrame frame,
+ final InputStreamProgressListener listener)
+ {
+ this.frame = frame;
+ this.stream_progress_listener = listener;
+ }
+
+ /**
+ * Get an Entry object from this source (by reading from a file).
+ * @param bases The Bases object to pass to the Entry constructor.
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading.
+ * @return null if and only if the user cancels the read.
+ **/
+ public Entry getEntry(final Bases bases,
+ final ProgressThread progress_thread,
+ final boolean show_progress)
+ throws OutOfRangeException
+ {
+ try
+ {
+ return getEntryInternal(bases, progress_thread, show_progress);
+ }
+ catch (NoSequenceException e)
+ {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+
+
+ /**
+ * Get an Entry object from this source (by reading from a file).
+ * @param bases The Bases object to pass to the Entry constructor.
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading.
+ * @return null if and only if the user cancels the read.
+ **/
+ public Entry getEntry (final Bases bases,
+ final boolean show_progress)
+ throws OutOfRangeException
+ {
+ try
+ {
+ return getEntryInternal (bases, null, show_progress);
+ }
+ catch (NoSequenceException e)
+ {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+
+ /**
+ * Get an Entry object from this source (by reading from a file).
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @exception NoSequenceException Thrown if the entry that we read has no
+ * sequence.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading.
+ * @return null if and only if the user cancels the read.
+ **/
+ public Entry getEntry (final boolean show_progress)
+ throws OutOfRangeException, NoSequenceException
+ {
+ return getEntryInternal (null, null, show_progress);
+ }
+
+ /**
+ * Get an Entry object from this source (by reading from a file).
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @exception NoSequenceException Thrown if the entry that we read has no
+ * sequence.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading.
+ * @return null if and only if the user cancels the read.
+ **/
+ public Entry getEntry (final boolean show_progress,
+ final ProgressThread progress_thread)
+ throws OutOfRangeException, NoSequenceException
+ {
+ return getEntryInternal (null, progress_thread, show_progress);
+ }
+
+
+ /**
+ * Returns true if and only if this EntrySource always returns "full"
+ * entries. ie. entries that contain features and sequence. Entries that
+ * are read from a file may contain just features so in this class this
+ * method returns false.
+ **/
+ public boolean isFullEntrySource ()
+ {
+ return false;
+ }
+
+
+//// change ArtemisMain.readArgsAndOptions () to use this?:
+
+// /**
+// * Get an Entry object from this source by name (by reading from a file).
+// * @exception OutOfRangeException Thrown if one of the features in
+// * embl_entry is out of range of the Bases object.
+// * @exception NoSequenceException Thrown if the entry that we read has no
+// * sequence.
+// * @return null if and only if there is no Entry with that name.
+// **/
+// public Entry getEntryByName (final String entry_file_name)
+// throws OutOfRangeException, NoSequenceException, IOException {
+// final Document new_document =
+// new FileProgressDocument (new File (entry_file_name),
+// getInputStreamProgressListener ());
+
+// final EntryInformation new_entry_information =
+// new SimpleEntryInformation (Options.getArtemisEntryInformation ());
+
+// boolean seen_error = false;
+
+// while (true) {
+// try {
+// final uk.ac.sanger.artemis.io.Entry new_entry =
+// DocumentEntryFactory.makeDocumentEntry (new_entry_information,
+// new_document);
+
+// return new Entry (new_entry);
+// } catch (EntryInformationException e) {
+
+// if (!seen_error) {
+// final String message =
+// "warning while reading " + entry_file_name + " - " +
+// e.getMessage ();
+
+// System.err.println (message);
+
+// new MessageDialog (frame, message);
+
+// seen_error = true;
+// }
+
+// EntryFileDialog.handleOpenException (new_entry_information, e);
+
+// // go around the loop again
+// }
+// }
+// }
+
+ /**
+ * Make a new Entry.
+ * @param bases The Bases object to pass to the Entry constructor. If null
+ * a new Bases object will be created.
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @exception NoSequenceException Thrown if bases is null and the Entry that
+ * we read has no sequence.
+ **/
+ private Entry makeEntry (final Bases bases,
+ final uk.ac.sanger.artemis.io.Entry embl_entry)
+ throws OutOfRangeException, NoSequenceException
+ {
+ if (bases == null)
+ return new Entry (embl_entry);
+ else
+ return new Entry (bases, embl_entry);
+ }
+
+ /**
+ * Return the InputStreamProgressListener that was passed to the
+ * constructor.
+ **/
+ public InputStreamProgressListener getInputStreamProgressListener ()
+ {
+ return stream_progress_listener;
+ }
+
+ /**
+ * Return the name of this source (for display to the user in menus).
+ **/
+ public String getSourceName ()
+ {
+ return "Filesystem";
+ }
+
+ /**
+ * Implementation of getEntry ().
+ * @param bases The Bases object to pass to the Entry constructor.
+ * @exception OutOfRangeException Thrown if one of the features in
+ * Entry is out of range of the Bases object.
+ * @exception NoSequenceException Thrown if bases is null and the entry that
+ * we read has no sequence.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading.
+ * @return null if and only if the user cancels the read.
+ **/
+ private Entry getEntryInternal(final Bases bases,
+ final ProgressThread progress_thread,
+ final boolean show_progress)
+ throws OutOfRangeException, NoSequenceException
+ {
+ final EntryInformation new_entry_information =
+ new SimpleEntryInformation(Options.getArtemisEntryInformation());
+
+ EntryFileDialog dialog;
+
+ if(bases == null)
+ dialog = new EntryFileDialog(frame, true);
+ else
+ dialog = new EntryFileDialog(frame, false);
+
+
+ uk.ac.sanger.artemis.io.Entry new_embl_entry =
+ dialog.getEntry(new_entry_information, stream_progress_listener,
+ progress_thread, show_progress);
+
+ if(new_embl_entry == null)
+ return null;
+
+ return makeEntry(bases, new_embl_entry);
+ }
+
+}
+
diff --git a/uk/ac/sanger/artemis/components/FileManager.java b/uk/ac/sanger/artemis/components/FileManager.java
new file mode 100644
index 000000000..54047d835
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FileManager.java
@@ -0,0 +1,401 @@
+/********************************************************************
+*
+* This library is free software; you can redistribute it and/or
+* modify it under the terms of the GNU Library General Public
+* License as published by the Free Software Foundation; either
+* version 2 of the License, or (at your option) any later version.
+*
+* This library is distributed in the hope that it will be useful,
+* but WITHOUT ANY WARRANTY; without even the implied warranty of
+* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+* Library General Public License for more details.
+*
+* You should have received a copy of the GNU Library General Public
+* License along with this library; if not, write to the
+* Free Software Foundation, Inc., 59 Temple Place - Suite 330,
+* Boston, MA 02111-1307, USA.
+*
+* Copyright (C) Genome Research Limited
+*
+********************************************************************/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.util.StringVector;
+import uk.ac.sanger.artemis.Options;
+
+import javax.swing.*;
+import java.io.File;
+import java.io.FileFilter;
+import java.awt.event.*;
+import java.awt.geom.*;
+import java.awt.*;
+
+public class FileManager extends JFrame
+{
+
+ /** busy cursor */
+ private Cursor cbusy = new Cursor(Cursor.WAIT_CURSOR);
+ /** done cursor */
+ private Cursor cdone = new Cursor(Cursor.DEFAULT_CURSOR);
+
+ public FileManager(JFrame frame)
+ {
+ this(frame,getArtemisFilter());
+ }
+
+ /**
+ *
+ * File Manager Frame
+ * @param frame parent frame
+ *
+ */
+ public FileManager(JFrame frame, FileFilter filter)
+ {
+ super("File Manager");
+
+ FileTree ftree = new FileTree(new File(System.getProperty("user.dir")),
+ frame, filter);
+ JScrollPane jsp = new JScrollPane(ftree);
+ JPanel pane = (JPanel)getContentPane();
+ pane.setLayout(new BorderLayout());
+ pane.add(jsp, BorderLayout.CENTER);
+ setJMenuBar(makeMenuBar(pane,ftree));
+ pane.add(getFileFileterComboBox(ftree), BorderLayout.SOUTH);
+
+ Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ jsp.setPreferredSize(new Dimension(210,
+ (int)(screen.getHeight()/2)));
+ pack();
+
+ int yloc = (int)((screen.getHeight()-getHeight())/2);
+ setLocation(0,yloc);
+ setVisible(true);
+ }
+
+ protected JComboBox getFileFileterComboBox(final FileTree ftree)
+ {
+ String[] filters = { "Artemis Files", "Sequence Files",
+ "Feature Files", "All Files" };
+ final JComboBox comboFilter = new JComboBox(filters);
+ comboFilter.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ String select = (String)comboFilter.getSelectedItem();
+ if(select.equals("Artemis Files"))
+ ftree.setFilter(getArtemisFilter());
+ else if(select.equals("Sequence Files"))
+ ftree.setFilter(getSequenceFilter());
+ else if(select.equals("Feature Files"))
+ ftree.setFilter(getFeatureFilter());
+ else if(select.equals("All Files"))
+ {
+ ftree.setFilter(new FileFilter()
+ {
+ public boolean accept(File pathname)
+ {
+ if(pathname.getName().startsWith("."))
+ return false;
+ return true;
+ }
+ });
+ }
+ }
+ });
+ return comboFilter;
+ }
+
+ /**
+ *
+ * Get a file filter for sequence and feature suffixes.
+ * @return file filter
+ */
+ protected static FileFilter getArtemisFilter()
+ {
+ final StringVector sequence_suffixes =
+ Options.getOptions().getOptionValues("sequence_file_suffixes");
+
+ final StringVector feature_suffixes =
+ Options.getOptions().getOptionValues("feature_file_suffixes");
+
+ final FileFilter artemis_filter = new FileFilter()
+ {
+ public boolean accept(File pathname)
+ {
+ if(pathname.isDirectory() &&
+ !pathname.getName().startsWith("."))
+ return true;
+
+ for(int i = 0; i<sequence_suffixes.size(); ++i)
+ {
+ final String suffix = sequence_suffixes.elementAt(i);
+
+ if(pathname.getName().endsWith("." + suffix) ||
+ pathname.getName().endsWith("." + suffix + ".gz"))
+ return true;
+ }
+
+ for(int i = 0; i<feature_suffixes.size(); ++i)
+ {
+ final String suffix = feature_suffixes.elementAt(i);
+
+ if(pathname.getName().endsWith("." + suffix) ||
+ pathname.getName().endsWith("." + suffix + ".gz"))
+ return true;
+ }
+ return false;
+ }
+ };
+ return artemis_filter;
+ }
+
+
+ /**
+ *
+ * Get a file filter for feature suffixes.
+ * @return file filter
+ */
+ protected static FileFilter getFeatureFilter()
+ {
+ final StringVector feature_suffixes =
+ Options.getOptions().getOptionValues("feature_file_suffixes");
+
+ final FileFilter feature_filter = new FileFilter()
+ {
+ public boolean accept(File pathname)
+ {
+ if(pathname.isDirectory() &&
+ !pathname.getName().startsWith("."))
+ return true;
+
+ for(int i = 0; i<feature_suffixes.size(); ++i)
+ {
+ final String suffix = feature_suffixes.elementAt(i);
+
+ if(pathname.getName().endsWith("." + suffix) ||
+ pathname.getName().endsWith("." + suffix + ".gz"))
+ return true;
+ }
+ return false;
+ }
+ };
+ return feature_filter;
+ }
+
+ /**
+ *
+ * Get a file filter for sequence suffixes.
+ * @return file filter
+ */
+ protected static FileFilter getSequenceFilter()
+ {
+ final StringVector sequence_suffixes =
+ Options.getOptions().getOptionValues("sequence_file_suffixes");
+
+ final FileFilter seq_filter = new FileFilter()
+ {
+ public boolean accept(File pathname)
+ {
+ if(pathname.isDirectory() &&
+ !pathname.getName().startsWith("."))
+ return true;
+
+ for(int i = 0; i<sequence_suffixes.size(); ++i)
+ {
+ final String suffix = sequence_suffixes.elementAt(i);
+
+ if(pathname.getName().endsWith("." + suffix) ||
+ pathname.getName().endsWith("." + suffix + ".gz"))
+ return true;
+ }
+
+ return false;
+ }
+ };
+ return seq_filter;
+ }
+
+ /**
+ *
+ * Set up a menu and tool bar
+ * @param pane panel to add toolbar to
+ * @param ftree file tree display
+ *
+ */
+ private JMenuBar makeMenuBar(JPanel pane, final FileTree ftree)
+ {
+ JMenuBar mBar = new JMenuBar();
+ JMenu fileMenu = new JMenu("File");
+ mBar.add(fileMenu);
+
+ JMenuItem fileMenuGoto = new JMenuItem("Go to Directory ...");
+ fileMenuGoto.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ String dir = ftree.getRoot().getAbsolutePath();
+ String newDir = JOptionPane.showInputDialog(FileManager.this,
+ "Go to Directory:",dir);
+
+ if(newDir == null)
+ return;
+
+ newDir = newDir.trim();
+ File newDirFile = new File(newDir);
+
+ if(newDirFile.exists() &&
+ newDirFile.canRead() &&
+ !newDir.equals(dir))
+ ftree.newRoot(newDir);
+ else
+ {
+ String error = null;
+ if(!newDirFile.exists())
+ error = new String(newDir+" doesn't exist!");
+ else if(!newDirFile.canRead())
+ error = new String(newDir+" cannot be read!");
+ else if(newDir.equals(dir))
+ error = new String("Same directory!");
+
+ if(error != null)
+ JOptionPane.showMessageDialog(FileManager.this,
+ error, "Warning",
+ JOptionPane.WARNING_MESSAGE);
+ }
+ }
+ });
+ fileMenu.add(fileMenuGoto);
+ fileMenu.add(new JSeparator());
+
+ JMenuItem fileMenuClose = new JMenuItem("Close");
+ fileMenuClose.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ setVisible(false);
+ }
+ });
+ fileMenu.add(fileMenuClose);
+
+ // tool bar set up
+ JToolBar toolBar = new JToolBar();
+ Dimension buttonSize = new Dimension(22,24);
+
+ JButton upBt = new JButton()
+ {
+ public void paintComponent(Graphics g)
+ {
+ super.paintComponent(g);
+ Graphics2D g2 = (Graphics2D)g;
+
+ g2.setColor(new Color(0,128,0));
+ float loc1[][] = { {11,18}, {7,18}, {7,14},
+ {3,14}, {11,4} };
+
+ g2.fill(makeShape(loc1));
+ g2.setColor(Color.green);
+
+ float loc2[][] = { {11,18}, {15,18}, {15,14},
+ {19,14}, {11,4} };
+ g2.fill(makeShape(loc2));
+
+ setSize(22,24);
+ }
+ };
+ upBt.setPreferredSize(buttonSize);
+ upBt.setMinimumSize(buttonSize);
+
+ upBt.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ FileManager.this.setCursor(cbusy);
+ File root = ftree.getRoot();
+ String parent = root.getParent();
+ if(parent != null)
+ ftree.newRoot(parent);
+ FileManager.this.setCursor(cdone);
+ }
+ });
+ toolBar.add(upBt);
+
+ JButton shortCut1 = new JButton()
+ {
+ public void paintComponent(Graphics g)
+ {
+ super.paintComponent(g);
+ Graphics2D g2 = (Graphics2D)g;
+ Font font = new Font("Monospaced", Font.BOLD, 14);
+ g2.setFont(font);
+
+ g2.setColor(Color.black);
+ g2.drawString("Y",4,18);
+ g2.setColor(Color.red);
+ g2.drawString("P",10,15);
+ setSize(22,24);
+ }
+ };
+ shortCut1.setPreferredSize(buttonSize);
+ shortCut1.setMinimumSize(buttonSize);
+ shortCut1.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ ftree.newRoot("/nfs/disk222/yeastpub");
+ }
+ });
+ toolBar.add(shortCut1);
+
+ JButton homeBt = new JButton()
+ {
+ public void paintComponent(Graphics g)
+ {
+ super.paintComponent(g);
+ Graphics2D g2 = (Graphics2D)g;
+
+ g2.setColor(Color.gray);
+ float loc1[][] = { {3,14}, {11,3}, {19,14},
+ {17,14}, {17,18}, {5,18}, {5,14} };
+ g2.fill(makeShape(loc1));
+
+ setSize(22,24);
+ }
+ };
+ homeBt.setPreferredSize(buttonSize);
+ homeBt.setMinimumSize(buttonSize);
+ homeBt.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ ftree.newRoot(System.getProperty("user.home"));
+ }
+ });
+ toolBar.add(homeBt);
+
+ toolBar.add(Box.createVerticalStrut(35));
+ pane.add(toolBar, BorderLayout.NORTH);
+
+ return mBar;
+ }
+
+ /**
+ *
+ * Used to draw a Shape.
+ *
+ */
+ public static GeneralPath makeShape(float loc[][])
+ {
+ GeneralPath path = new GeneralPath(GeneralPath.WIND_NON_ZERO);
+
+ path.moveTo(loc[0][0],loc[0][1]);
+
+ for(int i=1; i<loc.length; i++)
+ path.lineTo(loc[i][0],loc[i][1]);
+
+ return path;
+ }
+
+
+}
+
diff --git a/uk/ac/sanger/artemis/components/FileNode.java b/uk/ac/sanger/artemis/components/FileNode.java
new file mode 100644
index 000000000..084ef31b7
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FileNode.java
@@ -0,0 +1,159 @@
+/********************************************************************
+*
+* This library is free software; you can redistribute it and/or
+* modify it under the terms of the GNU Library General Public
+* License as published by the Free Software Foundation; either
+* version 2 of the License, or (at your option) any later version.
+*
+* This library is distributed in the hope that it will be useful,
+* but WITHOUT ANY WARRANTY; without even the implied warranty of
+* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+* Library General Public License for more details.
+*
+* You should have received a copy of the GNU Library General Public
+* License along with this library; if not, write to the
+* Free Software Foundation, Inc., 59 Temple Place - Suite 330,
+* Boston, MA 02111-1307, USA.
+*
+* Copyright (C) Genome Research Limited
+*
+********************************************************************/
+
+package uk.ac.sanger.artemis.components;
+
+import java.awt.datatransfer.*;
+import javax.swing.tree.*;
+import java.io.*;
+import java.util.*;
+
+/**
+*
+* File node for local file tree manager
+*
+*/
+public class FileNode extends DefaultMutableTreeNode
+ implements Transferable, Serializable
+{
+ /** true if explored */
+ private boolean explored = false;
+ /** data flavour of a file node */
+ public static DataFlavor FILENODE =
+ new DataFlavor(FileNode.class, "Local file");
+ /** flavours file node and string */
+ static DataFlavor flavors[] = { FILENODE, DataFlavor.stringFlavor };
+
+ /**
+ *
+ * @param file file node file
+ *
+ */
+ public FileNode(File file)
+ {
+ setUserObject(file);
+ }
+
+ /** Determine if this is a directory */
+ public boolean getAllowsChildren() { return isDirectory(); }
+ /** Determine if this is a file */
+ public boolean isLeaf() { return !isDirectory(); }
+ /** Get the File this node represents */
+ public File getFile() { return (File)getUserObject(); }
+ /** Determine if this node has been explored */
+ public boolean isExplored() { return explored; }
+ /** Determine if this is a directory */
+ public boolean isDirectory()
+ {
+ File file = getFile();
+ return file.isDirectory();
+ }
+
+ /**
+ *
+ * Returns the name of the file
+ *
+ */
+ public String toString()
+ {
+ File file = (File)getUserObject();
+ String filename = file.toString();
+ int index = filename.lastIndexOf(File.separator);
+
+ return (index != -1 && index != filename.length()-1) ?
+ filename.substring(index+1) :
+ filename;
+ }
+
+ /**
+ *
+ * Explores a directory adding a FileNode for each
+ * child
+ *
+ */
+ public void explore(FileFilter filter)
+ {
+ if(!isDirectory())
+ return;
+
+ if(!isExplored())
+ {
+ File file = getFile();
+ explored = true;
+ File[] children;
+// filter files
+ children = file.listFiles(filter);
+
+// sort into alphabetic order
+ java.util.Arrays.sort(children);
+ for(int i=0; i < children.length; ++i)
+ add(new FileNode(children[i]));
+ }
+ }
+
+ /**
+ *
+ * Forces the directory to be re-explored
+ *
+ */
+ public void reExplore(FileFilter filter)
+ {
+ explored = false;
+ removeAllChildren();
+ explore(filter);
+ }
+
+// Transferable
+ public DataFlavor[] getTransferDataFlavors()
+ {
+ return flavors;
+ }
+
+ public boolean isDataFlavorSupported(DataFlavor f)
+ {
+ if(f.equals(FILENODE) || f.equals(DataFlavor.stringFlavor))
+ return true;
+ return false;
+ }
+
+ public Object getTransferData(DataFlavor d)
+ throws UnsupportedFlavorException, IOException
+ {
+ if(d.equals(FILENODE))
+ return this;
+ else if(d.equals(DataFlavor.stringFlavor))
+ return getFile().getAbsolutePath();
+ else throw new UnsupportedFlavorException(d);
+ }
+
+//Serializable
+ private void writeObject(java.io.ObjectOutputStream out) throws IOException
+ {
+ out.defaultWriteObject();
+ }
+
+ private void readObject(java.io.ObjectInputStream in)
+ throws IOException, ClassNotFoundException
+ {
+ in.defaultReadObject();
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/FileTree.java b/uk/ac/sanger/artemis/components/FileTree.java
new file mode 100644
index 000000000..34c646a19
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FileTree.java
@@ -0,0 +1,941 @@
+/********************************************************************
+*
+* This library is free software; you can redistribute it and/or
+* modify it under the terms of the GNU Library General Public
+* License as published by the Free Software Foundation; either
+* version 2 of the License, or (at your option) any later version.
+*
+* This library is distributed in the hope that it will be useful,
+* but WITHOUT ANY WARRANTY; without even the implied warranty of
+* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+* Library General Public License for more details.
+*
+* You should have received a copy of the GNU Library General Public
+* License along with this library; if not, write to the
+* Free Software Foundation, Inc., 59 Temple Place - Suite 330,
+* Boston, MA 02111-1307, USA.
+*
+* Copyright (C) Genome Research Limited
+*
+********************************************************************/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.SimpleEntryInformation;
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.util.FileDocument;
+import uk.ac.sanger.artemis.util.OutOfRangeException;
+import uk.ac.sanger.artemis.sequence.NoSequenceException;
+import uk.ac.sanger.artemis.components.MessageDialog;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.awt.datatransfer.*;
+import java.awt.dnd.*;
+import javax.swing.*;
+import javax.swing.event.*;
+import javax.swing.tree.*;
+import java.io.*;
+import java.util.Vector;
+import java.util.Enumeration;
+import java.util.Hashtable;
+
+
+/**
+*
+* Creates a local file tree manager. This acts as a drag
+* source and sink for files.
+*
+*/
+public class FileTree extends JTree implements DragGestureListener,
+ DragSourceListener, DropTargetListener, ActionListener,
+ Autoscroll
+{
+
+ /** root directory */
+ private File root;
+ /** store of directories that are opened */
+ private Vector openNode;
+ /** file separator */
+ private String fs = new String(System.getProperty("file.separator"));
+ /** popup menu */
+ private JPopupMenu popup;
+ /** busy cursor */
+ private Cursor cbusy = new Cursor(Cursor.WAIT_CURSOR);
+ /** done cursor */
+ private Cursor cdone = new Cursor(Cursor.DEFAULT_CURSOR);
+ /** AutoScroll margin */
+ private static final int AUTOSCROLL_MARGIN = 45;
+ /** used by AutoScroll method */
+ private Insets autoscrollInsets = new Insets( 0, 0, 0, 0 );
+ /** file filter */
+ private FileFilter filter = null;
+
+ /**
+ *
+ * @param rt root directory
+ * @param f frame
+ *
+ */
+ public FileTree(File rt, final JFrame f,
+ FileFilter filter)
+ {
+ this.root = rt;
+ this.filter = filter;
+
+ DragSource dragSource = DragSource.getDefaultDragSource();
+
+ dragSource.createDefaultDragGestureRecognizer(
+ this, // component where drag originates
+ DnDConstants.ACTION_COPY_OR_MOVE, // actions
+ this); // drag gesture recognizer
+
+ setDropTarget(new DropTarget(this,this));
+ DefaultTreeModel model = createTreeModel(root);
+ setModel(model);
+ createTreeModelListener();
+
+ this.getSelectionModel().setSelectionMode
+ (TreeSelectionModel.DISCONTIGUOUS_TREE_SELECTION);
+
+ // Popup menu
+ addMouseListener(new PopupListener());
+ popup = new JPopupMenu();
+
+ JMenuItem menuItem = new JMenuItem("Refresh");
+ menuItem.addActionListener(this);
+ popup.add(menuItem);
+ popup.add(new JSeparator());
+ //open menu
+ JMenu openMenu = new JMenu("Open With");
+ popup.add(openMenu);
+ menuItem = new JMenuItem("Jemboss Alignment Editor");
+ menuItem.addActionListener(this);
+ openMenu.add(menuItem);
+ menuItem = new JMenuItem("Artemis");
+ menuItem.addActionListener(this);
+ openMenu.add(menuItem);
+
+ menuItem = new JMenuItem("Rename...");
+ menuItem.addActionListener(this);
+ popup.add(menuItem);
+ menuItem = new JMenuItem("New Folder...");
+ menuItem.addActionListener(this);
+ popup.add(menuItem);
+ menuItem = new JMenuItem("Delete...");
+ menuItem.addActionListener(this);
+ popup.add(menuItem);
+ popup.add(new JSeparator());
+ menuItem = new JMenuItem("De-select All");
+ menuItem.addActionListener(this);
+ popup.add(menuItem);
+
+ //Listen for when a file is selected
+ MouseListener mouseListener = new MouseAdapter()
+ {
+ public void mouseClicked(MouseEvent me)
+ {
+ if(me.getClickCount() == 2 && isFileSelection() &&
+ !me.isPopupTrigger())
+ {
+ f.setCursor(cbusy);
+ FileNode node = getSelectedNode();
+ String selected = node.getFile().getAbsolutePath();
+ showFilePane(selected);
+ f.setCursor(cdone);
+ }
+ }
+ };
+ this.addMouseListener(mouseListener);
+
+ addTreeExpansionListener(new TreeExpansionListener()
+ {
+ public void treeCollapsed(TreeExpansionEvent e){}
+ public void treeExpanded(TreeExpansionEvent e)
+ {
+ TreePath path = e.getPath();
+ if(path != null)
+ {
+ FileNode node = (FileNode)path.getLastPathComponent();
+
+ if(!node.isExplored())
+ {
+ f.setCursor(cbusy);
+ exploreNode(node);
+ f.setCursor(cdone);
+ }
+ }
+ }
+ });
+
+ }
+
+
+ /**
+ *
+ * Popup menu actions
+ * @param e action event
+ *
+ */
+ public void actionPerformed(ActionEvent e)
+ {
+
+ JMenuItem source = (JMenuItem)(e.getSource());
+ final FileNode node = getSelectedNode();
+
+ if(source.getText().equals("Refresh"))
+ {
+ if(node == null)
+ newRoot(root.getAbsolutePath());
+ else if(node.isLeaf())
+ refresh((FileNode)node.getParent());
+ else
+ refresh(node);
+ return;
+ }
+
+ if(node == null)
+ {
+ JOptionPane.showMessageDialog(null,"No file selected.",
+ "Warning",
+ JOptionPane.WARNING_MESSAGE);
+ return;
+ }
+
+ final File f = node.getFile();
+
+ if(source.getText().equals("Jemboss Alignment Editor"))
+ {
+// org.emboss.jemboss.editor.AlignJFrame ajFrame =
+// new org.emboss.jemboss.editor.AlignJFrame(f);
+// ajFrame.setVisible(true);
+ }
+ else if(source.getText().equals("Text Editor"))
+ showFilePane(f.getAbsolutePath());
+ else if(source.getText().equals("New Folder..."))
+ {
+ String path = null;
+ if(node.isLeaf())
+ path = f.getParent();
+ else
+ path = f.getAbsolutePath();
+
+ String inputValue = JOptionPane.showInputDialog(null,
+ "Folder Name","Create New Folder in "+path,
+ JOptionPane.QUESTION_MESSAGE);
+
+ if(inputValue != null && !inputValue.equals("") )
+ {
+ String fullname = path+fs+inputValue;
+ File dir = new File(fullname);
+
+ if(dir.exists())
+ JOptionPane.showMessageDialog(null, fullname+" alread exists!",
+ "Error", JOptionPane.ERROR_MESSAGE);
+ else
+ {
+ if(dir.mkdir())
+ addObject(inputValue,path,node);
+ else
+ JOptionPane.showMessageDialog(null,
+ "Cannot make the folder\n"+fullname,
+ "Error", JOptionPane.ERROR_MESSAGE);
+ }
+ }
+ }
+ else if(source.getText().equals("Delete..."))
+ {
+ File fn[] = getSelectedFiles();
+ String names = "";
+ for(int i=0; i<fn.length;i++)
+ names = names.concat(fn[i].getAbsolutePath()+"\n");
+ int n = JOptionPane.showConfirmDialog(null,
+ "Delete \n"+names+"?",
+ "Delete Files",
+ JOptionPane.YES_NO_OPTION);
+
+ FileNode nodes[] = getSelectedNodes();
+ if(n == JOptionPane.YES_OPTION)
+ for(int i=0; i<nodes.length;i++)
+ deleteFile(nodes[i]);
+ }
+ else if(source.getText().equals("De-select All"))
+ clearSelection();
+ else if(isFileSelection() && source.getText().equals("Rename..."))
+ {
+ String inputValue = (String)JOptionPane.showInputDialog(null,
+ "New File Name","Rename "+f.getName(),
+ JOptionPane.QUESTION_MESSAGE,null,null,f.getName());
+
+ if(inputValue != null && !inputValue.equals("") )
+ {
+ String path = f.getParent();
+ String fullname = path+fs+inputValue;
+ File newFile = new File(fullname);
+
+ try
+ {
+ renameFile(f,node,newFile.getCanonicalPath());
+ }
+ catch(IOException ioe){}
+ }
+ }
+ }
+
+
+ /**
+ *
+ * Delete a file from the tree
+ * @param node node to delete
+ *
+ */
+ public void deleteFile(final FileNode node)
+ {
+ File f = node.getFile();
+ if(f.delete())
+ {
+ Runnable deleteFileFromTree = new Runnable()
+ {
+ public void run () { deleteObject(node); };
+ };
+ SwingUtilities.invokeLater(deleteFileFromTree);
+ }
+ else
+ JOptionPane.showMessageDialog(null,"Cannot delete\n"+
+ f.getAbsolutePath(),"Warning",
+ JOptionPane.ERROR_MESSAGE);
+ }
+
+
+ /**
+ *
+ * Method to rename a file and update the filenode's.
+ * @param oldFile file to rename
+ * @param oldNode filenode to be removed
+ * @param newFullName name of the new file
+ *
+ */
+ private void renameFile(final File oldFile, final FileNode oldNode,
+ String newFullName)
+ {
+ final File fnew = new File(newFullName);
+ if(fnew.exists())
+ JOptionPane.showMessageDialog(null, newFullName+" alread exists!",
+ "Warning", JOptionPane.ERROR_MESSAGE);
+ else
+ {
+ if(oldFile.renameTo(fnew))
+ {
+ Runnable renameFileInTree = new Runnable()
+ {
+ public void run ()
+ {
+ addObject(fnew.getName(),fnew.getParent(),oldNode);
+ deleteObject(oldNode);
+ };
+ };
+ SwingUtilities.invokeLater(renameFileInTree);
+ }
+ else
+ JOptionPane.showMessageDialog(null,
+ "Cannot rename \n"+oldFile.getAbsolutePath()+
+ "\nto\n"+fnew.getAbsolutePath(), "Rename Error",
+ JOptionPane.ERROR_MESSAGE);
+ }
+ return;
+ }
+
+
+ /**
+ *
+ * Define a directory root for the file tree
+ * @param newRoot directory to use as the root for
+ * the tree.
+ *
+ */
+ public void newRoot(String newRoot)
+ {
+ root = new File(newRoot);
+ DefaultTreeModel model = (DefaultTreeModel)getModel();
+ model = createTreeModel(root);
+ setModel(model);
+ }
+
+ /**
+ *
+ * Get the current root node.
+ * @return directory root.
+ *
+ */
+ public File getRoot()
+ {
+ return root;
+ }
+
+ /**
+ *
+ * Refresh
+ * @param FileNode node to refresh
+ *
+ */
+ public void refresh(FileNode node)
+ {
+ node.reExplore(filter);
+ DefaultTreeModel model = (DefaultTreeModel)getModel();
+ model.nodeStructureChanged(node);
+ }
+
+ /**
+ *
+ * Set the current file filter
+ *
+ */
+ public void setFilter(FileFilter filter)
+ {
+ this.filter = filter;
+ Enumeration en = openNode.elements();
+
+ while(en.hasMoreElements())
+ refresh((FileNode)en.nextElement());
+ }
+
+ /**
+ *
+ * Get FileNode of selected node
+ * @return node that is currently selected
+ *
+ */
+ public FileNode getSelectedNode()
+ {
+ TreePath path = getLeadSelectionPath();
+ if(path == null)
+ return null;
+ FileNode node = (FileNode)path.getLastPathComponent();
+ return node;
+ }
+
+
+ /**
+ *
+ * Get FileNodes of selected nodes
+ * @return node that is currently selected
+ *
+ */
+ public FileNode[] getSelectedNodes()
+ {
+ TreePath path[] = getSelectionPaths();
+ if(path == null)
+ return null;
+
+ int numberSelected = path.length;
+ FileNode nodes[] = new FileNode[numberSelected];
+ for(int i=0;i<numberSelected;i++)
+ nodes[i] = (FileNode)path[i].getLastPathComponent();
+
+ return nodes;
+ }
+
+
+ /**
+ *
+ * Get selected files
+ * @return node that is currently selected
+ *
+ */
+ public File[] getSelectedFiles()
+ {
+ FileNode[] fn = getSelectedNodes();
+ int numberSelected = fn.length;
+ File files[] = new File[numberSelected];
+ for(int i=0;i<numberSelected;i++)
+ files[i] = fn[i].getFile();
+
+ return files;
+ }
+
+
+ /**
+ *
+ * Return true if selected node is a file
+ * @return true is a file is selected, false if
+ * a directory is selected
+ *
+ */
+ public boolean isFileSelection()
+ {
+ TreePath path = getLeadSelectionPath();
+ if(path == null)
+ return false;
+
+ FileNode node = (FileNode)path.getLastPathComponent();
+ return node.isLeaf();
+ }
+
+
+ /**
+ *
+ * Make the given directory the root and create a new
+ * DefaultTreeModel.
+ * @param root root directory
+ * @param tree model with the root node set
+ * to the given directory
+ *
+ */
+ private DefaultTreeModel createTreeModel(File root)
+ {
+ FileNode rootNode = new FileNode(root);
+ rootNode.explore(filter);
+ openNode = new Vector();
+ openNode.add(rootNode);
+ return new DefaultTreeModel(rootNode);
+ }
+
+
+ /**
+ *
+ * Adding a file (or directory) to the file tree manager.
+ * This looks to see if the directory has already been opened
+ * and updates the filetree if it has.
+ * @param child new child to add in
+ * @param path path to where child is to be added
+ * @param node node to add child to
+ *
+ */
+ public DefaultMutableTreeNode addObject(String child,
+ String path, FileNode node)
+ {
+
+ DefaultTreeModel model = (DefaultTreeModel)getModel();
+ if(node == null)
+ {
+ node = getNode(path);
+ if(node==null)
+ return null;
+ }
+
+ FileNode parentNode = getNode(path);
+ File newleaf = new File(path + fs + child);
+ FileNode childNode = null;
+
+ if(parentNode.isExplored())
+ {
+ childNode = new FileNode(newleaf);
+ int index = getAnIndex(parentNode,child);
+ if(index > -1)
+ model.insertNodeInto(childNode, parentNode, index);
+ }
+ else if(parentNode.isDirectory())
+ {
+ exploreNode(parentNode);
+ childNode = getNode(path + fs + child);
+ }
+
+ // Make sure the user can see the new node.
+ this.scrollPathToVisible(new TreePath(childNode.getPath()));
+ return childNode;
+ }
+
+
+ /**
+ *
+ * Delete a node from the JTree
+ * @param node node for deletion
+ *
+ */
+ public void deleteObject(FileNode node)
+ {
+ DefaultTreeModel model =(DefaultTreeModel)getModel();
+ FileNode parentNode = getNode(node.getFile().getParent());
+ model.removeNodeFromParent(node);
+ }
+
+
+ /**
+ *
+ * Explore a directory node
+ * @param dirNode direcory node to display
+ *
+ */
+ public void exploreNode(FileNode dirNode)
+ {
+ DefaultTreeModel model = (DefaultTreeModel)getModel();
+ dirNode.explore(filter);
+ openNode.add(dirNode);
+ model.nodeStructureChanged(dirNode);
+ }
+
+ /**
+ *
+ * Gets the node from the existing explored nodes and their
+ * children.
+ * @param path path to a file or directory
+ * @return corresponding node if the directory or
+ * file is visible otherwise returns null.
+ *
+ */
+ private FileNode getNode(String path)
+ {
+ Enumeration en = openNode.elements();
+
+ while(en.hasMoreElements())
+ {
+ FileNode node = (FileNode)en.nextElement();
+ String nodeName = node.getFile().getAbsolutePath();
+ if(nodeName.equals(path))
+ return node;
+ }
+
+// check children of explored nodes
+ en = openNode.elements();
+ while(en.hasMoreElements())
+ {
+ FileNode child = getChildNode((FileNode)en.nextElement(),path);
+ if(child != null)
+ return child;
+ }
+
+ return null;
+ }
+
+
+ /**
+ *
+ * Gets the child node of a parent node
+ * @param parent parent node
+ * @param childName name of child
+ * @return the child node
+ *
+ */
+ private FileNode getChildNode(FileNode parent, String childName)
+ {
+ for(Enumeration children = parent.children(); children.hasMoreElements() ;)
+ {
+ FileNode childNode = (FileNode)children.nextElement();
+ String nodeName = childNode.getFile().getAbsolutePath();
+ if(childName.equals(nodeName))
+ return childNode;
+ }
+
+ return null;
+ }
+
+ /**
+ *
+ * Finds a new index for adding a new file to the file manager.
+ * @param parentNode parent directory node
+ * @param child new child node
+ * @return index of the child in the directory
+ *
+ */
+ private int getAnIndex(FileNode parentNode, String child)
+ {
+ //find the index for the child
+ int num = parentNode.getChildCount();
+ int childIndex = num;
+ for(int i=0;i<num;i++)
+ {
+ String nodeName =
+ ((FileNode)parentNode.getChildAt(i)).getFile().getName();
+ if(nodeName.compareTo(child) > 0)
+ {
+ childIndex = i;
+ break;
+ }
+ else if (nodeName.compareTo(child) == 0) //file already exists
+ {
+ childIndex = -1;
+ break;
+ }
+ }
+ return childIndex;
+ }
+
+
+ /**
+ *
+ * Read a file into a byte array.
+ * @param filename file name
+ * @return byte[] contents of file
+ *
+ */
+ protected static byte[] readByteFile(String filename)
+ {
+
+ File fn = new File(filename);
+ byte[] b = null;
+ try
+ {
+ long s = fn.length();
+ if(s == 0)
+ return b;
+ b = new byte[(int)s];
+ FileInputStream fi = new FileInputStream(fn);
+ fi.read(b);
+ fi.close();
+ }
+ catch (IOException ioe)
+ {
+ System.out.println("Cannot read file: " + filename);
+ }
+ return b;
+
+ }
+
+ /**
+ *
+ * Opens a JFrame with the file contents displayed.
+ * @param filename file name to display
+ *
+ */
+ public void showFilePane(final String filename)
+ {
+ final ProgressThread progress_thread = new ProgressThread(null,
+ "Loading Entry...");
+
+ progress_thread.start();
+ SwingWorker entryWorker = new SwingWorker()
+ {
+ EntryEdit entry_edit;
+ public Object construct()
+ {
+ try
+ {
+ EntryInformation new_entry_information =
+ new SimpleEntryInformation(Options.getArtemisEntryInformation());
+
+ final Entry entry = new Entry(EntryFileDialog.getEntryFromFile(
+ null, new FileDocument(new File(filename)),
+ new_entry_information, false));
+ if(entry == null)
+ return null;
+
+ final EntryGroup entry_group =
+ new SimpleEntryGroup(entry.getBases());
+
+ entry_group.add(entry);
+ entry_edit = new EntryEdit(entry_group);
+ return null;
+ }
+ catch(NoSequenceException e)
+ {
+ new MessageDialog(null, "read failed: entry contains no sequence");
+ }
+ catch(OutOfRangeException e)
+ {
+ new MessageDialog(null, "read failed: one of the features in " +
+ " the entry has an out of range " +
+ "location: " + e.getMessage());
+
+ }
+ catch(NullPointerException npe){}
+
+ return null;
+ }
+
+ public void finished()
+ {
+ if(entry_edit != null)
+ entry_edit.setVisible(true);
+ if(progress_thread !=null)
+ progress_thread.finished();
+ }
+ };
+ entryWorker.start();
+
+ }
+
+
+////////////////////
+// DRAG AND DROP
+////////////////////
+// drag source
+ public void dragGestureRecognized(DragGestureEvent e)
+ {
+ // ignore if mouse popup trigger
+ InputEvent ie = e.getTriggerEvent();
+ if(ie instanceof MouseEvent)
+ if(((MouseEvent)ie).isPopupTrigger())
+ return;
+
+ // drag only files
+ if(isFileSelection())
+ e.startDrag(DragSource.DefaultCopyDrop, // cursor
+ (Transferable)getSelectedNode(), // transferable data
+ this); // drag source listener
+ }
+ public void dragDropEnd(DragSourceDropEvent e) {}
+ public void dragEnter(DragSourceDragEvent e) {}
+ public void dragExit(DragSourceEvent e) {}
+ public void dragOver(DragSourceDragEvent e) {}
+ public void dropActionChanged(DragSourceDragEvent e) {}
+
+// drop sink
+ public void dragEnter(DropTargetDragEvent e)
+ {
+ if(e.isDataFlavorSupported(FileNode.FILENODE))
+ e.acceptDrag(DnDConstants.ACTION_COPY_OR_MOVE);
+ }
+
+ public void drop(DropTargetDropEvent e)
+ {
+
+ Transferable t = e.getTransferable();
+ final FileNode dropNode = getSelectedNode();
+ if(dropNode == null)
+ {
+ e.rejectDrop();
+ return;
+ }
+
+ //local drop
+ if(t.isDataFlavorSupported(FileNode.FILENODE))
+ {
+ try
+ {
+ FileNode fn = (FileNode)t.getTransferData(FileNode.FILENODE);
+ fn = getNode(fn.getFile().getAbsolutePath());
+
+ if (dropNode.isLeaf())
+ {
+ e.rejectDrop();
+ return;
+ }
+
+ String dropDir = dropNode.getFile().getAbsolutePath();
+ String newFullName = dropDir+fs+fn.toString();
+ renameFile(fn.getFile(),fn,newFullName);
+ }
+ catch(Exception ufe){}
+ }
+ else
+ {
+ e.rejectDrop();
+ return;
+ }
+
+ }
+
+
+ /**
+ *
+ * When a suitable DataFlavor is offered over a remote file
+ * node the node is highlighted/selected and the drag
+ * accepted. Otherwise the drag is rejected.
+ *
+ */
+ public void dragOver(DropTargetDragEvent e)
+ {
+ if(e.isDataFlavorSupported(FileNode.FILENODE))
+ {
+ Point ploc = e.getLocation();
+ TreePath ePath = getPathForLocation(ploc.x,ploc.y);
+ if (ePath == null)
+ {
+ e.rejectDrag();
+ return;
+ }
+ FileNode node = (FileNode)ePath.getLastPathComponent();
+ if(!node.isDirectory())
+ e.rejectDrag();
+ else
+ {
+ setSelectionPath(ePath);
+ e.acceptDrag(DnDConstants.ACTION_COPY_OR_MOVE);
+ }
+ }
+ else
+ e.rejectDrag();
+
+ return;
+ }
+
+ public void dropActionChanged(DropTargetDragEvent e) {}
+ public void dragExit(DropTargetEvent e){}
+
+
+////////////////////
+// AUTO SCROLLING //
+////////////////////
+ /**
+ *
+ * Handles the auto scrolling of the JTree.
+ * @param location The location of the mouse.
+ *
+ */
+ public void autoscroll( Point location )
+ {
+ int top = 0, left = 0, bottom = 0, right = 0;
+ Dimension size = getSize();
+ Rectangle rect = getVisibleRect();
+ int bottomEdge = rect.y + rect.height;
+ int rightEdge = rect.x + rect.width;
+ if( location.y - rect.y < AUTOSCROLL_MARGIN && rect.y > 0 )
+ top = AUTOSCROLL_MARGIN;
+ if( location.x - rect.x < AUTOSCROLL_MARGIN && rect.x > 0 )
+ left = AUTOSCROLL_MARGIN;
+ if( bottomEdge - location.y < AUTOSCROLL_MARGIN && bottomEdge < size.height )
+ bottom = AUTOSCROLL_MARGIN;
+ if( rightEdge - location.x < AUTOSCROLL_MARGIN && rightEdge < size.width )
+ right = AUTOSCROLL_MARGIN;
+ rect.x += right - left;
+ rect.y += bottom - top;
+ scrollRectToVisible( rect );
+ }
+
+
+ /**
+ *
+ * Gets the insets used for the autoscroll.
+ * @return The insets.
+ *
+ */
+ public Insets getAutoscrollInsets()
+ {
+ Dimension size = getSize();
+ Rectangle rect = getVisibleRect();
+ autoscrollInsets.top = rect.y + AUTOSCROLL_MARGIN;
+ autoscrollInsets.left = rect.x + AUTOSCROLL_MARGIN;
+ autoscrollInsets.bottom = size.height - (rect.y+rect.height) + AUTOSCROLL_MARGIN;
+ autoscrollInsets.right = size.width - (rect.x+rect.width) + AUTOSCROLL_MARGIN;
+ return autoscrollInsets;
+ }
+
+ /**
+ *
+ * Popup menu listener
+ *
+ */
+ class PopupListener extends MouseAdapter
+ {
+ public void mousePressed(MouseEvent e)
+ {
+ maybeShowPopup(e);
+ }
+
+ public void mouseReleased(MouseEvent e)
+ {
+ maybeShowPopup(e);
+ }
+
+ private void maybeShowPopup(MouseEvent e)
+ {
+ if(e.isPopupTrigger())
+ popup.show(e.getComponent(),
+ e.getX(), e.getY());
+ }
+ }
+
+ public static void main(String[] args)
+ {
+ JFrame tree_frame = new JFrame("File Manager");
+ FileTree ftree = new FileTree(new File(System.getProperty("user.home")),
+ tree_frame,null);
+ JScrollPane jsp = new JScrollPane(ftree);
+ tree_frame.getContentPane().add(jsp);
+ tree_frame.pack();
+ tree_frame.setVisible(true);
+ }
+
+}
+
diff --git a/uk/ac/sanger/artemis/components/FileViewer.java b/uk/ac/sanger/artemis/components/FileViewer.java
new file mode 100644
index 000000000..f40fd4e84
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/FileViewer.java
@@ -0,0 +1,293 @@
+/* FileViewer.java
+ *
+ * created: Thu Nov 19 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 1998,1999,2000,2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/FileViewer.java,v 1.1 2004-06-09 09:46:55 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.io.Reader;
+import java.io.BufferedReader;
+import java.io.IOException;
+
+import javax.swing.*;
+
+/**
+ * This class implements a simple file viewer. In fact any Reader object can
+ * be viewed.
+ *
+ * @author Kim Rutherford
+ * @version $Id: FileViewer.java,v 1.1 2004-06-09 09:46:55 tjc Exp $
+ *
+ **/
+
+public class FileViewer
+ extends JFrame
+{
+
+ /** Pressing this button will distroy the JFrame. */
+ private JButton close_button;
+
+ /** A JPanel to hold the close button. */
+ private JPanel button_panel;
+
+ /** The main component we use for displaying the file. */
+ private JTextArea text_area = null;
+
+ /**
+ * The size of the last FileViewer JFrame to be resized. When a new
+ * FileViewer component is created it is given the current value of this
+ * variable. This is updated when any FileViewer frame is resized.
+ **/
+ private static Dimension saved_size = null;
+
+ /**
+ * The position of the last FileViewer JFrame to be moved. When a new
+ * FileViewer component is created it is given the current value of this
+ * variable. This is updated when any FileViewer frame is moved.
+ **/
+ private static Point saved_position = null;
+
+ /**
+ * Create a new FileViewer component and make it visible.
+ * @param label The name to attach to the new JFrame.
+ **/
+ public FileViewer(final String label)
+ {
+ this(label, true);
+ }
+
+ /**
+ * Create a new FileViewer component.
+ * @param label The name to attach to the new JFrame.
+ * @param visible The new FileViewer will be made visible if and only if
+ * this argument is true.
+ **/
+ public FileViewer(final String label, final boolean visible)
+ {
+ super(label);
+
+ getContentPane().setLayout(new BorderLayout());
+
+ final Font font = Options.getOptions().getFont();
+
+ setFont(font);
+
+ text_area = new JTextArea(18, 90);
+ text_area.setEditable(false);
+ text_area.setFont(font);
+ text_area.setBackground(Color.white);
+
+ getContentPane().add(new JScrollPane(text_area), "Center");
+
+ button_panel = new JPanel();
+ getContentPane().add(button_panel, "South");
+
+ close_button = new JButton("Close");
+ close_button.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ dispose();
+ }
+ });
+
+ button_panel.add(close_button);
+
+ addWindowListener(new WindowAdapter()
+ {
+ public void windowClosing(WindowEvent event)
+ {
+ dispose();
+ }
+ });
+
+ addComponentListener(new ComponentAdapter()
+ {
+ public void componentResized(ComponentEvent e)
+ {
+ saved_size = FileViewer.this.getSize();
+ saved_position = FileViewer.this.getLocation();
+ }
+ public void componentMoved(ComponentEvent e)
+ {
+ saved_size = FileViewer.this.getSize();
+ saved_position = FileViewer.this.getLocation();
+ }
+ });
+
+ pack();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+
+ if(saved_position == null)
+ {
+ int screen_height = screen.height;
+ int screen_width = screen.width;
+
+ if(screen_width <= 800 || screen_height <= 700)
+ setSize(screen_width * 9 / 10, screen_height * 9 / 10);
+ else
+ setSize(800, 700);
+
+ setLocation(new Point((screen.width - getSize().width) / 2,
+ (screen.height - getSize().height) / 2));
+ }
+ else
+ {
+ if(saved_position.x < 0 || saved_position.x + 20 > screen.width)
+ saved_position.x = 20;
+
+ if(saved_position.y < 0 || saved_position.y + 20 > screen.height)
+ saved_position.y = 20;
+
+ if(saved_size.width < 50)
+ saved_size.width = 50;
+
+ if(saved_size.height < 50)
+ saved_size.height = 50;
+
+ setLocation(saved_position);
+ setSize(saved_size);
+ }
+
+ setVisible(visible);
+ }
+
+ /**
+ * Clear the viewer window.
+ **/
+ public void clear()
+ {
+ text_area.setText("");
+ }
+
+ /**
+ * Read from the given Reader and append the text to this FileViewer.
+ * @param read_stream The stream to read the contents of the viewer from.
+ **/
+ public void appendFile(Reader read_stream)
+ throws IOException
+ {
+ final BufferedReader buffered_reader = new BufferedReader(read_stream);
+ String line;
+
+ while((line = buffered_reader.readLine()) != null)
+ {
+ appendString(line + "\n");
+ Thread.yield();
+ }
+
+ buffered_reader.close();
+ }
+
+ /**
+ * Clear the viewer window and display the lines from the given Reader.
+ * @param read_stream The stream to read the contents of the viewer from.
+ **/
+ public void readFile(Reader read_stream)
+ throws IOException
+ {
+ final BufferedReader buffered_reader = new BufferedReader(read_stream);
+
+ String line;
+
+ final StringBuffer line_buffer = new StringBuffer();
+
+ while((line = buffered_reader.readLine()) != null)
+ line_buffer.append(line).append('\n');
+
+ buffered_reader.close();
+
+ final String new_text = line_buffer.toString();
+ text_area.setText(new_text);
+// text_area.getCaret().setDot(0);
+ text_area.setCaretPosition(0);
+ }
+
+ /**
+ * Clear the viewer window and display the lines from the given String.
+ * @param read_string The string to read the contents of the viewer from.
+ **/
+ public void setText(String read_string)
+ {
+ if(!read_string.equals(text_area.getText()))
+ {
+ text_area.setText(read_string);
+// text_area.getCaret().setDot(0);
+ text_area.setCaretPosition(0);
+ }
+ }
+
+
+ /**
+ * Clear the viewer window and display the lines from the given String.
+ * @param read_string The string to read the contents of the viewer from.
+ **/
+ public void appendString(String read_string)
+ {
+ text_area.append(read_string);
+ text_area.getCaret().setDot(0);
+ }
+
+ /**
+ * Return a String containing the text that this component is displaying.
+ **/
+ public String getText()
+ {
+ return getTextArea().getText();
+ }
+
+ /**
+ * Destroy this component.
+ **/
+ public void dispose()
+ {
+ setVisible(false);
+
+ saved_size = getSize();
+ saved_position = getLocation();
+
+ super.dispose();
+ }
+
+ /**
+ * return the TextArea component from this FileViewer.
+ **/
+ public JTextArea getTextArea()
+ {
+ return text_area;
+ }
+
+ /**
+ * Return the JPanel containing the close button of this FileViewer.
+ **/
+ protected JPanel getButtonPanel()
+ {
+ return button_panel;
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/GotoMenu.java b/uk/ac/sanger/artemis/components/GotoMenu.java
new file mode 100644
index 000000000..a753fedf8
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/GotoMenu.java
@@ -0,0 +1,510 @@
+/* GotoMenu.java
+ *
+ * created: Thu Jan 7 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/GotoMenu.java,v 1.1 2004-06-09 09:46:56 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import uk.ac.sanger.artemis.util.*;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * A JMenu with commands for moving around the entries.
+ *
+ * @author Kim Rutherford
+ * @version $Id: GotoMenu.java,v 1.1 2004-06-09 09:46:56 tjc Exp $
+ **/
+
+public class GotoMenu extends SelectionMenu {
+ /**
+ * Create a new GotoMenu object.
+ * @param frame The JFrame that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param goto_event_source The object the we will call makeBaseVisible ()
+ * on.
+ * @param entry_group The EntryGroup object used to create the Navigator
+ * component.
+ * @param menu_name The name of the new menu.
+ **/
+ public GotoMenu (final JFrame frame,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final EntryGroup entry_group,
+ final String menu_name) {
+ super (frame, menu_name, selection);
+
+ this.goto_event_source = goto_event_source;
+
+ navigator_item = new JMenuItem ("Navigator ...");
+ navigator_item.setAccelerator (NAVIGATOR_KEY);
+ navigator_item.addActionListener(new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ new Navigator (getSelection (),
+ GotoMenu.this.goto_event_source,
+ entry_group);
+ }
+ });
+
+ goto_selection_start_item = new JMenuItem ("Start of Selection");
+ goto_selection_start_item.setAccelerator (START_OF_SELECTION_KEY);
+ goto_selection_start_item.addActionListener(new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ makeSelectionStartVisible ();
+ }
+ });
+
+ goto_selection_end_item = new JMenuItem ("End of Selection");
+ goto_selection_end_item.setAccelerator (END_OF_SELECTION_KEY);
+ goto_selection_end_item.addActionListener(new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ makeSelectionEndVisible ();
+ }
+ });
+
+ goto_feature_start_item = new JMenuItem ("Feature Start");
+ goto_feature_start_item.addActionListener(new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ gotoFeatureStart ();
+ }
+ });
+
+ goto_feature_end_item = new JMenuItem ("Feature End");
+ goto_feature_end_item.addActionListener(new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ gotoFeatureEnd ();
+ }
+ });
+
+ goto_feature_base = new JMenuItem ("Feature Base Position ...");
+ goto_feature_base.addActionListener(new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ gotoFeaturePosition (false);
+ }
+ });
+
+ goto_feature_aa_position = new JMenuItem ("Feature Amino Acid ...");
+ goto_feature_aa_position.addActionListener(new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ gotoFeaturePosition (true);
+ }
+ });
+
+
+ goto_first_item = new JMenuItem ("Start of Sequence");
+ goto_first_item.setAccelerator (START_OF_SEQUENCE_KEY);
+ goto_first_item.addActionListener(new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ goto_event_source.gotoFirstBase ();
+ }
+ });
+
+ goto_last_item = new JMenuItem ("End of Sequence");
+ goto_last_item.setAccelerator (END_OF_SEQUENCE_KEY);
+ goto_last_item.addActionListener(new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ goto_event_source.gotoLastBase ();
+ }
+ });
+
+ add (navigator_item);
+ addSeparator ();
+ add (goto_selection_start_item);
+ add (goto_selection_end_item);
+ add (goto_feature_start_item);
+ add (goto_feature_end_item);
+ add (goto_first_item);
+ add (goto_last_item);
+ add (goto_feature_base);
+ add (goto_feature_aa_position);
+ }
+
+ /**
+ * The shortcut for the Navigator.
+ **/
+ final static KeyStroke NAVIGATOR_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_G, InputEvent.CTRL_MASK);
+
+ /**
+ * The shortcut to go to the start of the selection.
+ **/
+ final static KeyStroke START_OF_SELECTION_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_LEFT, InputEvent.CTRL_MASK);
+
+ /**
+ * The shortcut to go to the end of the selection.
+ **/
+ final static KeyStroke END_OF_SELECTION_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_RIGHT, InputEvent.CTRL_MASK);
+
+ /**
+ * The shortcut to go to the start of the sequence.
+ **/
+ final static KeyStroke START_OF_SEQUENCE_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_UP, InputEvent.CTRL_MASK);
+
+ /**
+ * The shortcut to go to the end of the sequence.
+ **/
+ final static KeyStroke END_OF_SEQUENCE_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_DOWN, InputEvent.CTRL_MASK);
+
+ /**
+ * Create a new GotoMenu object.
+ * @param frame The JFrame that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param goto_event_source The object the we will call makeBaseVisible ()
+ * on.
+ * @param entry_group The EntryGroup object used to create the Navigator
+ * component.
+ **/
+ public GotoMenu (final JFrame frame,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final EntryGroup entry_group) {
+ this (frame, selection, goto_event_source, entry_group, "Goto");
+ }
+
+ /**
+ * This method sends an GotoEvent to all the GotoEvent listeners that will
+ * make the first base of the selection visible.
+ **/
+ private void makeSelectionStartVisible () {
+ final GotoEvent new_event =
+ new GotoEvent (this, getSelection ().getStartBaseOfSelection ());
+
+ goto_event_source.sendGotoEvent (new_event);
+ }
+
+ /**
+ * This method sends an GotoEvent to all the GotoEvent listeners that will
+ * make the last base of the selection visible.
+ **/
+ private void makeSelectionEndVisible () {
+ final GotoEvent new_event =
+ new GotoEvent (this, getSelection ().getEndBaseOfSelection ());
+
+ goto_event_source.sendGotoEvent (new_event);
+ }
+
+ /**
+ * Goto the start of the (first) selected feature. (FeatureDisplay only.)
+ **/
+ private void gotoFeatureStart () {
+ setInternalVariables ();
+ if (selection_feature == null) {
+ if (selection_segment == null) {
+ // do nothing
+ } else {
+ // go to the start of the parent feature of the first selected segment
+ final Feature segment_feature = selection_segment.getFeature ();
+ makeFeatureStartVisible (segment_feature);
+ }
+ } else {
+ makeFeatureStartVisible (selection_feature);
+ }
+ }
+
+ /**
+ * Goto the end of the (first) selected feature. (FeatureDisplay only.)
+ **/
+ private void gotoFeatureEnd () {
+ setInternalVariables ();
+ if (selection_feature == null) {
+ if (selection_segment == null) {
+ // do nothing
+ } else {
+ // go to the end of the parent feature of the first selected segment
+ final Feature segment_feature = selection_segment.getFeature ();
+ makeFeatureEndVisible (segment_feature);
+ }
+ } else {
+ makeFeatureEndVisible (selection_feature);
+ }
+ }
+
+ /**
+ * Goto the start of the (first) selected segment. (FeatureDisplay only.)
+ **/
+ private void gotoSegmentStart () {
+ setInternalVariables ();
+ if (selection_segment == null) {
+ if (selection_feature == null) {
+ // do nothing
+ } else {
+ makeFeatureStartVisible (selection_feature);
+ }
+ } else {
+ makeSegmentStartVisible (selection_segment);
+ }
+ }
+
+ /**
+ * Goto the end of the (first) selected segment. (FeatureDisplay only.)
+ **/
+ private void gotoSegmentEnd () {
+ setInternalVariables ();
+ if (selection_segment == null) {
+ if (selection_feature == null) {
+ // do nothing
+ } else {
+ makeFeatureEndVisible (selection_feature);
+ }
+ } else {
+ makeSegmentEndVisible (selection_segment);
+ }
+ }
+
+ /**
+ * This method will ask the user for a base or amino acid position within
+ * the first selected feature (using a TextRequester component) and will
+ * then goto that position.
+ * @param goto_aa_position If true goto an amino acid position, otherwise
+ * goto a base position
+ **/
+ private void gotoFeaturePosition (final boolean goto_aa_position) {
+ if (!checkForSelectionFeatures ()) {
+ return;
+ }
+
+ final FeatureVector selected_features = getSelection ().getAllFeatures ();
+
+ if (selected_features.size () > 1) {
+ new MessageDialog (getParentFrame (), "select only one feature");
+ return;
+ }
+
+ final Feature first_feature = selected_features.elementAt (0);
+
+ final TextRequester text_requester =
+ goto_aa_position ?
+ new TextRequester ("amino acid position within selected feature:",
+ 18, "") :
+ new TextRequester ("base position within selected feature:",
+ 18, "");
+
+ text_requester.addTextRequesterListener (new TextRequesterListener () {
+ public void actionPerformed (final TextRequesterEvent event) {
+ final String position_string = event.getRequesterText ().trim ();
+
+ if (position_string.length () == 0) {
+ return;
+ }
+
+ try {
+ final int feature_position =
+ Integer.valueOf (position_string).intValue ();
+
+ final Marker sequence_marker;
+
+ if (goto_aa_position) {
+ // base and aa positions are numbered from 1
+ final int aa_position = (feature_position - 1) * 3 + 1;
+
+ sequence_marker =
+ first_feature.getPositionInSequence (aa_position);
+ } else {
+ sequence_marker =
+ first_feature.getPositionInSequence (feature_position);
+ }
+
+ final MarkerRange range = new MarkerRange (sequence_marker);
+
+ goto_event_source.gotoBase (sequence_marker);
+
+ /*final*/ MarkerRange selection_range;
+
+ if (goto_aa_position) {
+ // we want to select the whole codon if we are going to a amino
+ // acid position
+ try {
+ final MarkerRange codon_end_marker_range =
+ new MarkerRange (sequence_marker.moveBy (2));
+ selection_range =
+ range.combineRanges (codon_end_marker_range, false);
+ } catch (OutOfRangeException e) {
+ // just select one base
+ selection_range = range;
+ }
+ } else {
+ selection_range = range;
+ }
+
+ // select that base (or range)
+ getSelection ().setMarkerRange (selection_range);
+
+ } catch (NumberFormatException e) {
+ new MessageDialog (getParentFrame (),
+ "this is not a number: " + position_string);
+ } catch (OutOfRangeException e) {
+ new MessageDialog (getParentFrame (), "the base position is not " +
+ "within the selection feature: " +
+ position_string);
+ }
+ }
+ });
+
+ text_requester.show ();
+ }
+
+ /**
+ * This method sends an GotoEvent to all the GotoEvent listeners that will
+ * make the given base visible.
+ **/
+ private void makeBaseVisible (final Marker base_marker) {
+ goto_event_source.gotoBase (base_marker);
+ }
+
+ /**
+ * Scroll the display so that the start of the given feature is visible
+ * (it's start will be in the middle of the screen after the call).
+ * @param feature The feature to make visible.
+ **/
+ private void makeFeatureStartVisible (Feature feature) {
+ if (feature == null) {
+ return;
+ }
+
+ makeBaseVisible (feature.getFirstBaseMarker ());
+ }
+
+ /**
+ * Scroll the display so that the start of the given feature is visible
+ * (it's start will be in the middle of the screen after the call).
+ * @param feature The feature to make visible.
+ **/
+ private void makeFeatureEndVisible (Feature feature) {
+ if (feature == null) {
+ return;
+ }
+
+ makeBaseVisible (feature.getLastBaseMarker ());
+
+// System.out.println (feature.getLastBaseMarker ().getPosition ());
+// System.out.println (feature.getLastBaseMarker ().getStrand ());
+ }
+
+ /**
+ * Scroll the display so that the given segment is visible (the first base
+ * in the segment will be the middle of the screen after the call).
+ * @param segment The segment to make visible.
+ **/
+ private void makeSegmentStartVisible (FeatureSegment segment) {
+ if (segment == null) {
+ return;
+ }
+
+ final Marker first_base = segment.getStart ();
+
+ makeBaseVisible (first_base);
+ }
+
+ /**
+ * Scroll the display so that the given segment is visible (the last base
+ * in the segment will be the middle of the screen after the call).
+ * @param segment The segment to make visible.
+ **/
+ private void makeSegmentEndVisible (FeatureSegment segment) {
+ if (segment == null) {
+ return;
+ }
+
+ final Marker last_base = segment.getEnd ();
+
+ makeBaseVisible (last_base);
+ }
+
+ /**
+ * Initialise selection_feature and selection_segment.
+ **/
+ private void setInternalVariables () {
+ final FeatureVector selection_features =
+ getSelection ().getSelectedFeatures ();
+ final FeatureSegmentVector selection_segments =
+ getSelection ().getSelectedSegments ();
+
+ if (selection_features.size () > 0) {
+ selection_feature = selection_features.elementAt (0);
+ } else {
+ selection_feature = null;
+ }
+
+ if (selection_segments.size () > 0) {
+ selection_segment = selection_segments.elementAt (0);
+ } else {
+ selection_segment = null;
+ }
+ }
+
+ /**
+ * Check that the are some Features in the current selection. If there
+ * there are some features then return true. If there are no features
+ * selected then popup a message saying so and return false.
+ **/
+ protected boolean checkForSelection () {
+ final FeatureVector features_to_check =
+ getSelection ().getAllFeatures ();
+
+ if (features_to_check.size () == 0) {
+ new MessageDialog (getParentFrame (), "No features selected");
+ return false;
+ } else {
+ return true;
+ }
+ }
+
+ /**
+ * The GotoEventSource object that was passed to the constructor.
+ **/
+ private GotoEventSource goto_event_source;
+
+ /**
+ * Set by the constructor to the reference of the first feature in
+ * selection_features or null if selection_features is empty.
+ **/
+ private Feature selection_feature;
+
+ /**
+ * Set by the constructor to the reference of the first segment in
+ * selection_segments or null if selection_segments is empty.
+ **/
+ private FeatureSegment selection_segment;
+
+ private JMenuItem navigator_item = null;
+ private JMenuItem goto_feature_start_item = null;
+ private JMenuItem goto_feature_end_item = null;
+ private JMenuItem goto_selection_end_item = null;
+ private JMenuItem goto_selection_start_item = null;
+ private JMenuItem goto_first_item = null;
+ private JMenuItem goto_last_item = null;
+ private JMenuItem goto_feature_base = null;
+ private JMenuItem goto_feature_aa_position = null;
+}
diff --git a/uk/ac/sanger/artemis/components/GraphMenu.java b/uk/ac/sanger/artemis/components/GraphMenu.java
new file mode 100644
index 000000000..ae419651e
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/GraphMenu.java
@@ -0,0 +1,403 @@
+/* GraphMenu.java
+ *
+ * created: Tue Sep 18 2001
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/GraphMenu.java,v 1.1 2004-06-09 09:46:57 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.plot.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.io.IOException;
+import java.io.File;
+import java.io.FileReader;
+import java.util.Vector;
+
+import javax.swing.*;
+
+/**
+ * This menu controls one particular BasePlotGroup.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: GraphMenu.java,v 1.1 2004-06-09 09:46:57 tjc Exp $
+ **/
+
+public class GraphMenu extends JMenu {
+ /**
+ * Create a new GraphMenu object and all it's menu items.
+ * @param frame The JFrame that owns this JMenu.
+ * @param entry_group The EntryGroup containing the sequence to plot.
+ * @param base_plot_group The BasePlotGroup that this menu controls.
+ * @param view_menu This ViewMenu is updated when a usage plot is added.
+ * @param add_menu This AddMenu is updated when a usage plot is added.
+ * @param menu_name The name of the new menu.
+ **/
+ public GraphMenu (final JFrame frame,
+ final EntryGroup entry_group,
+ final BasePlotGroup base_plot_group,
+ final FeatureDisplay feature_display,
+ final String menu_name) {
+ super (menu_name);
+ this.frame = frame;
+ this.entry_group = entry_group;
+ this.base_plot_group = base_plot_group;
+ this.view_menu = view_menu;
+ this.add_menu = add_menu;
+ this.feature_display = feature_display;
+
+ final BaseAlgorithm [] orig_algorithms =
+ base_plot_group.getPlotAlgorithms ();
+
+ final JMenuItem hide_all_graphs_item = new JMenuItem ("Hide All Graphs");
+ hide_all_graphs_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ final BaseAlgorithm [] current_algorithms =
+ base_plot_group.getPlotAlgorithms ();
+
+ for (int i = 0 ; i < current_algorithms.length ; ++i) {
+ final BaseAlgorithm this_algorithm = current_algorithms[i];
+
+ base_plot_group.setVisibleByAlgorithm (this_algorithm, false);
+
+ final JCheckBoxMenuItem this_menu_item =
+ (JCheckBoxMenuItem) algorithm_menu_items.elementAt (i);
+
+ this_menu_item.setState (false);
+ }
+ if (getParent () != null) {
+ // XXX change to revalidate().
+ frame.validate ();
+ }
+ }
+ });
+ add (hide_all_graphs_item);
+
+ addSeparator ();
+
+ if (Options.readWritePossible ()) {
+ final JMenuItem usage_plot_item = new JMenuItem ("Add Usage Plots ...");
+ usage_plot_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ addUsagePlot ();
+ }
+ });
+ add (usage_plot_item);
+
+ final JMenuItem user_plot_item = new JMenuItem ("Add User Plot ...");
+ user_plot_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ addUserPlot ();
+ }
+ });
+
+ add (user_plot_item);
+
+ addSeparator ();
+ }
+
+ for (int i = 0 ; i < orig_algorithms.length ; ++i) {
+ final BaseAlgorithm this_algorithm = orig_algorithms[i];
+
+ addAlgorithm (this_algorithm, false);
+ }
+
+ if (Options.getOptions ().getProperty ("codon_usage_file") != null) {
+ final String codon_usage_file_name =
+ Options.getOptions ().getProperty ("codon_usage_file");
+
+ try {
+ addUsagePlot (new File (codon_usage_file_name), true, false);
+ addUsagePlot (new File (codon_usage_file_name), false, false);
+
+ if (getParent () != null) {
+ // XXX change to revalidate().
+ frame.validate ();
+ }
+ } catch (IOException e) {
+ new MessageDialog (frame, "error while reading usage data: " + e);
+ }
+ }
+ }
+
+ /**
+ * Create a new GraphMenu object and all it's menu items.
+ * @param frame The JFrame that owns this JMenu.
+ * @param entry_group The EntryGroup containing the sequence to plot.
+ * @param base_plot_group The BasePlotGroup that this menu controls.
+ * @param view_menu This ViewMenu is updated when a usage plot is added.
+ * @param add_menu This AddMenu is updated when a usage plot is added.
+ * @param menu_name The name of the new menu.
+ **/
+ public GraphMenu (final JFrame frame,
+ final EntryGroup entry_group,
+ final BasePlotGroup base_plot_group,
+ final FeatureDisplay feature_display) {
+ this (frame, entry_group, base_plot_group, feature_display, "Graph");
+ }
+
+ /**
+ * Add a menu item for the given algorithm to the Display menu.
+ * @param is_visible The JCheckBoxMenuItem starts in the true state if and
+ * only if this is true.
+ * @return The new JCheckBoxMenuItem
+ **/
+ public JCheckBoxMenuItem addAlgorithm (final BaseAlgorithm algorithm,
+ final boolean is_visible) {
+
+ final JCheckBoxMenuItem new_item =
+ new JCheckBoxMenuItem (algorithm.getAlgorithmName ());
+
+ new_item.setState (is_visible);
+
+ new_item.addItemListener (new ItemListener () {
+ public void itemStateChanged(ItemEvent event) {
+ base_plot_group.setVisibleByAlgorithm (algorithm,
+ new_item.getState ());
+ }
+ });
+
+ add (new_item);
+
+ algorithm_menu_items.addElement (new_item);
+
+ return new_item;
+ }
+
+ /**
+ * Ask the user for a file name, then read the codon usage data from that
+ * file, then make and add forward and a reverse BasePlot component using
+ * the data.
+ **/
+ public void addUsagePlot () {
+ final JFrame frame = Utilities.getComponentFrame (base_plot_group);
+
+ final StickyFileChooser dialog = new StickyFileChooser ();
+
+ dialog.setDialogTitle ("Select a codon usage data file name ...");
+ dialog.setDialogType (JFileChooser.OPEN_DIALOG);
+
+ final int status = dialog.showOpenDialog (frame);
+
+ if (status != JFileChooser.APPROVE_OPTION ||
+ dialog.getSelectedFile () == null) {
+ return;
+ }
+
+ final File file =
+ new File (dialog.getCurrentDirectory (),
+ dialog.getSelectedFile ().getName ());
+
+ if (file.length () != 0) {
+ try {
+ final BasePlot new_forward_plot =
+ addUsagePlot (file, true, true);
+ final BasePlot new_reverse_plot =
+ addUsagePlot (file, false, true);
+
+ final Algorithm forward_algorithm = new_forward_plot.getAlgorithm ();
+ final Algorithm reverse_algorithm = new_reverse_plot.getAlgorithm ();
+
+ base_plot_group.setVisibleByAlgorithm (forward_algorithm, true);
+ base_plot_group.setVisibleByAlgorithm (reverse_algorithm, true);
+ } catch (IOException e) {
+ new MessageDialog (Utilities.getComponentFrame (base_plot_group),
+ "error while reading usage data: " + e);
+ }
+ }
+ }
+
+ /**
+ * Read the codon usage data from the given File, then make and add a
+ * BasePlot component using the data.
+ * @param use_forward_strand The plot will be a forward plot if and only if
+ * this is true.
+ * @param is_visible The plot will start off visible if and only if this is
+ * true.
+ * @return The BasePlot that was added.
+ **/
+ private BasePlot addUsagePlot (final File codon_usage_file,
+ final boolean use_forward_strand,
+ final boolean is_visible)
+ throws IOException {
+ final CodonUsageAlgorithm codon_usage_algorithm;
+
+ if (use_forward_strand) {
+ final Strand forward_strand =
+ entry_group.getBases ().getForwardStrand ();
+
+ final CodonUsageWeight usage_weights =
+ new CodonUsageWeight (codon_usage_file, forward_strand);
+
+ codon_usage_algorithm =
+ new CodonUsageAlgorithm (forward_strand, usage_weights);
+ } else {
+ final Strand backward_strand =
+ entry_group.getBases ().getReverseStrand ();
+
+ final CodonUsageWeight usage_weights =
+ new CodonUsageWeight (codon_usage_file, backward_strand);
+
+ codon_usage_algorithm =
+ new CodonUsageAlgorithm (backward_strand, usage_weights);
+ }
+
+ addAlgorithm (codon_usage_algorithm, is_visible);
+
+ final BasePlot new_plot =
+ base_plot_group.addAlgorithm (codon_usage_algorithm);
+
+ base_plot_group.setVisibleByAlgorithm (codon_usage_algorithm, is_visible);
+
+ // XXX hack to force the BasePlot to initialise
+ final DisplayAdjustmentEvent event =
+ new DisplayAdjustmentEvent (this,
+ feature_display.getFirstVisibleForwardBase (),
+ feature_display.getLastVisibleForwardBase (),
+ feature_display.getMaxVisibleBases (),
+ feature_display.getScaleValue (),
+ feature_display.getScaleFactor (),
+ feature_display.isRevCompDisplay (),
+ DisplayAdjustmentEvent.ALL_CHANGE_ADJUST_EVENT);
+
+ base_plot_group.displayAdjustmentValueChanged (event);
+
+ return new_plot;
+ }
+
+ /**
+ * Add a UserDataAlgorithm to the display.
+ **/
+ private void addUserPlot () {
+ final JFrame frame = Utilities.getComponentFrame (base_plot_group);
+
+ final StickyFileChooser dialog = new StickyFileChooser ();
+
+ dialog.setDialogTitle ("Select a data file name ...");
+ dialog.setDialogType (JFileChooser.OPEN_DIALOG);
+
+ final int status = dialog.showOpenDialog (frame);
+
+ if (status != JFileChooser.APPROVE_OPTION ||
+ dialog.getSelectedFile () == null) {
+ return;
+ }
+
+ final File file =
+ new File (dialog.getCurrentDirectory (),
+ dialog.getSelectedFile ().getName ());
+
+ if (file.length () != 0) {
+ final uk.ac.sanger.artemis.util.Document document =
+ new uk.ac.sanger.artemis.util.FileDocument (file);
+
+ final Strand forward_strand =
+ getEntryGroup ().getBases ().getForwardStrand ();
+
+ try {
+ final UserDataAlgorithm new_algorithm =
+ new UserDataAlgorithm (forward_strand, document);
+
+ final BasePlot new_base_plot =
+ base_plot_group.addAlgorithm (new_algorithm);
+
+ base_plot_group.setVisibleByAlgorithm (new_algorithm, true);
+
+ addAlgorithm (new_algorithm, true);
+
+ // XXX hack to force the BasePlot to initialise
+ final DisplayAdjustmentEvent event =
+ new DisplayAdjustmentEvent (this,
+ feature_display.getFirstVisibleForwardBase (),
+ feature_display.getLastVisibleForwardBase (),
+ feature_display.getMaxVisibleBases (),
+ feature_display.getScaleValue (),
+ feature_display.getScaleFactor (),
+ feature_display.isRevCompDisplay (),
+ DisplayAdjustmentEvent.ALL_CHANGE_ADJUST_EVENT);
+
+ base_plot_group.displayAdjustmentValueChanged (event);
+
+ if (getParent () != null) {
+ // XXX change to revalidate().
+ frame.validate ();
+ }
+ } catch (IOException e) {
+ new MessageDialog (Utilities.getComponentFrame (base_plot_group),
+ "error while reading user data: " + e);
+ }
+ }
+ }
+
+ /**
+ * Return the JFrame that was passed to the constructor.
+ **/
+ public JFrame getParentFrame () {
+ return frame;
+ }
+
+ /**
+ * Return the EntryGroup that was passed to the constructor.
+ **/
+ private EntryGroup getEntryGroup () {
+ return entry_group;
+ }
+
+ /**
+ * The JFrame reference that was passed to the constructor.
+ **/
+ private JFrame frame;
+
+ /**
+ * The BasePlotGroup that was passed to the constructor.
+ **/
+ private BasePlotGroup base_plot_group;
+
+ /**
+ * The EntryGroup object that was passed to the constructor.
+ **/
+ private EntryGroup entry_group = null;
+
+ /**
+ * This ViewMenu is updated when a usage plot is added.
+ **/
+ private ViewMenu view_menu;
+
+ /**
+ * This AddMenu is updated when a usage plot is added.
+ **/
+ private AddMenu add_menu;
+
+ /**
+ * The FeatureDisplay that was passed to the constructor.
+ **/
+ private FeatureDisplay feature_display;
+
+ /**
+ * This list of the CheckboxMenuItems for the graphs is stored so that we
+ * can turn them all off with "Hide All Graphs".
+ **/
+ private Vector algorithm_menu_items = new Vector ();
+}
diff --git a/uk/ac/sanger/artemis/components/InputStreamProgressDialog.java b/uk/ac/sanger/artemis/components/InputStreamProgressDialog.java
new file mode 100644
index 000000000..87f0ab26b
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/InputStreamProgressDialog.java
@@ -0,0 +1,126 @@
+/* InputStreamProgressDialog.java
+ *
+ * created: Thu Aug 8 2002
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/InputStreamProgressDialog.java,v 1.1 2004-06-09 09:46:58 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import uk.ac.sanger.artemis.util.InputStreamProgressListener;
+import uk.ac.sanger.artemis.util.InputStreamProgressEvent;
+
+import javax.swing.*;
+
+/**
+ * A JDialog the show the byte count of an InputStream (via
+ * InputStreamProgressEvent objects)
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: InputStreamProgressDialog.java,v 1.1 2004-06-09 09:46:58 tjc Exp $
+ **/
+
+public class InputStreamProgressDialog extends JDialog {
+ /**
+ * Create a blocking InputStreamProgressDialog JFrame.
+ * @param parent The parent window.
+ * @param message The message to display in the JDialog and to use as the
+ * frame title.
+ **/
+ public InputStreamProgressDialog (final JFrame parent,
+ final String message) {
+ this (parent, message, message, true);
+ }
+
+ /**
+ * Create a new InputStreamProgressDialog JFrame.
+ * @param parent The parent window.
+ * @param title The title of the new JDialog.
+ * @param message The message to display in the JDialog.
+ * @param modal If true, dialog blocks input to the parent window when
+ * shown.
+ **/
+ public InputStreamProgressDialog (final JFrame parent_frame,
+ final String title,
+ final String message,
+ final boolean modal) {
+ super (parent_frame, title, modal);
+ getContentPane ().add (new JLabel (message), "North");
+
+ final JLabel bytes_label = new JLabel (" ");
+ getContentPane ().add (bytes_label, "Center");
+
+ final JPanel panel = new JPanel ();
+
+ panel.add (ok_button);
+ ok_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ InputStreamProgressDialog.this.dispose ();
+ }
+ });
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ InputStreamProgressDialog.this.dispose ();
+ }
+ });
+
+ stream_progress_listener = new InputStreamProgressListener () {
+ public void progressMade (final InputStreamProgressEvent event) {
+
+ final int char_count = event.getCharCount ();
+ if (char_count == -1) {
+ bytes_label.setText ("");
+ } else {
+ setVisible (true);
+ bytes_label.setText ("Characters read so far: " + char_count);
+ }
+ }
+ };
+
+ getContentPane ().add (panel, "South");
+ pack ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+
+ setVisible (false);
+ }
+
+ /**
+ * Return an InputStreamProgressListener to pass to FileProgressDocument.
+ **/
+ public InputStreamProgressListener getInputStreamProgressListener () {
+ return stream_progress_listener;
+ }
+
+ /**
+ * An InputStreamProgressListener used to update the label with the
+ * current number of chars read.
+ **/
+ private InputStreamProgressListener stream_progress_listener = null;
+
+ final private JButton ok_button = new JButton ("OK");
+}
diff --git a/uk/ac/sanger/artemis/components/KeyChoice.java b/uk/ac/sanger/artemis/components/KeyChoice.java
new file mode 100644
index 000000000..f3241bd12
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/KeyChoice.java
@@ -0,0 +1,203 @@
+/* KeyChoice.java
+ *
+ * created: Mon Sep 6 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/KeyChoice.java,v 1.1 2004-06-09 09:46:59 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import uk.ac.sanger.artemis.util.StringVector;
+import uk.ac.sanger.artemis.io.Key;
+import uk.ac.sanger.artemis.io.KeyVector;
+import uk.ac.sanger.artemis.io.EntryInformation;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * This component is a Choice component that shows the possible feature keys.
+ *
+ * @author Kim Rutherford
+ * @version $Id: KeyChoice.java,v 1.1 2004-06-09 09:46:59 tjc Exp $
+ **/
+public class KeyChoice extends JPanel {
+ /**
+ * Create a new KeyChoice component with CDS as the default key.
+ * @param entry_information The object to get the list of possible
+ * keys from.
+ **/
+ public KeyChoice (final EntryInformation entry_information) {
+ this (entry_information, Key.CDS);
+ }
+
+ /**
+ * Create a new KeyChoice component with the given key as the default.
+ * @param entry_information The object to get the list of possible
+ * keys from.
+ **/
+ public KeyChoice (final EntryInformation entry_information,
+ final Key default_key) {
+ this.entry_information = entry_information;
+ this.default_key = default_key;
+
+ final Font font = Options.getOptions ().getFont ();
+ setFont (font);
+
+ key_chooser = new JComboBox ();
+
+ final int MAX_VISIBLE_ROWS = 30;
+
+ key_chooser.setMaximumRowCount (MAX_VISIBLE_ROWS);
+
+ updateChoice ();
+ }
+
+ /**
+ * Return the currently selected key.
+ **/
+ public Key getSelectedItem () {
+ final Key key;
+
+ key = new Key ((String) key_chooser.getSelectedItem ());
+
+ return key;
+ }
+
+ /**
+ * Set the selected Key.
+ **/
+ public void setKey (final Key new_key) {
+ final int key_index = keyIndex (new_key);
+
+ if (key_index == -1) {
+ // add the key
+ key_chooser.addItem (new_key.toString ());
+ key_chooser.setSelectedItem (new_key.toString ());
+ } else {
+ key_chooser.setSelectedIndex (key_index);
+ }
+ }
+
+ /**
+ * Adds the specified item listener to receive item events from the Choice
+ * component of this KeyChoice.
+ * @param l The item listener.
+ **/
+ public void addItemListener(ItemListener l) {
+ key_chooser.addItemListener (l);
+ }
+
+
+ /**
+ * Removes the specified item listener so that it no longer receives item
+ * events from the Choice component of this KeyChoice.
+ * @param l The item listener.
+ **/
+ public void removeItemListener(ItemListener l) {
+ key_chooser.removeItemListener (l);
+ }
+
+ /**
+ * Update the key_chooser.
+ **/
+ private void updateChoice () {
+ removeAll ();
+
+ final Font font = Options.getOptions ().getFont ();
+ key_chooser.setFont (font);
+
+ add (key_chooser);
+
+ KeyVector keys = getSortedKeys ();
+
+ if (keys == null) {
+ keys = new KeyVector ();
+ keys.add (Key.CDS);
+ }
+
+ for (int i = 0 ; i < keys.size () ; ++i) {
+ key_chooser.addItem (keys.elementAt (i).toString ());
+ }
+
+ if (keyIndex (default_key) != -1) {
+ setKey (default_key);
+ }
+
+ // XXX change to revalidate().
+ validate ();
+
+ if (getParent () != null) {
+ // XXX change to revalidate().
+ getParent ().validate ();
+ if (getParent ().getParent () != null) {
+ // XXX change to revalidate().
+ getParent ().getParent ().validate ();
+ }
+ }
+ }
+
+ /**
+ * Return a alphanumerically sorted vector containing the String
+ * representations of the common keys (those listed in the common_keys
+ * property of the options file). If there is no common_keys option then
+ * all the legal keys are returned.
+ **/
+ private KeyVector getSortedKeys () {
+ return entry_information.getSortedValidKeys ();
+ }
+
+ /**
+ * Return the index in the key_chooser component of the given Key.
+ **/
+ private int keyIndex (final Key key) {
+ for (int i = 0 ; i < key_chooser.getItemCount () ; ++i) {
+ if (key.toString ().equals ((String)key_chooser.getItemAt (i))) {
+ return i;
+ }
+ }
+ return -1;
+ }
+
+ /**
+ * The Key that was passed to the constructor.
+ **/
+ private Key default_key = null;
+
+ /**
+ * The JComboBox component that will show the feature keys.
+ **/
+ private JComboBox key_chooser = null;
+
+ /**
+ * This toggle sets whether to show common keys or uncommon keys.
+ **/
+ private JCheckBox common_keys_checkbox = null;
+
+ /**
+ * The EntryInformation object that was passed to the constructor.
+ **/
+ private EntryInformation entry_information = null;
+}
diff --git a/uk/ac/sanger/artemis/components/KeyChooser.java b/uk/ac/sanger/artemis/components/KeyChooser.java
new file mode 100644
index 000000000..af9d93849
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/KeyChooser.java
@@ -0,0 +1,118 @@
+/* KeyChooser.java
+ *
+ * created: Mon Sep 6 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/KeyChooser.java,v 1.1 2004-06-09 09:47:00 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import uk.ac.sanger.artemis.io.Key;
+import uk.ac.sanger.artemis.io.EntryInformation;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * This component is a KeyChoice component in a JFrame (see addItemListener ()
+ * and removeItemListener () for details).
+ *
+ * @author Kim Rutherford
+ * @version $Id: KeyChooser.java,v 1.1 2004-06-09 09:47:00 tjc Exp $
+ **/
+public class KeyChooser extends JFrame {
+ /**
+ * Create a new KeyChooser component with CDS as the default key.
+ * @param entry_information The object to get the list of possible
+ * keys from.
+ **/
+ public KeyChooser (final EntryInformation entry_information) {
+ this (entry_information, Key.CDS);
+ }
+
+ /**
+ * Create a new KeyChooser component with the given key as the default.
+ * @param entry_information The object to get the list of possible
+ * keys from.
+ **/
+ public KeyChooser (final EntryInformation entry_information,
+ final Key default_key) {
+ key_choice = new KeyChoice (entry_information, default_key);
+
+ getContentPane ().add (key_choice, "Center");
+
+ final JPanel panel = new JPanel ();
+
+ panel.add (ok_button);
+ ok_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ KeyChooser.this.dispose ();
+ }
+ });
+
+ panel.add (close_button);
+ close_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ KeyChooser.this.dispose ();
+ }
+ });
+
+ getContentPane ().add (panel, "South");
+ pack ();
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ KeyChooser.this.dispose ();
+ }
+ });
+
+ pack ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+ }
+
+ /**
+ * Return the KeyChoice component that is displayed in this JFrame.
+ **/
+ public KeyChoice getKeyChoice () {
+ return key_choice;
+ }
+
+ /**
+ * Return the reference of the OK button of this KeyChooser.
+ **/
+ public JButton getOKButton () {
+ return ok_button;
+ }
+
+ private KeyChoice key_choice;
+
+ final private JButton ok_button = new JButton ("OK");
+
+ final private JButton close_button = new JButton ("Cancel");
+}
+
diff --git a/uk/ac/sanger/artemis/components/ListDialog.java b/uk/ac/sanger/artemis/components/ListDialog.java
new file mode 100644
index 000000000..c84d08dc6
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ListDialog.java
@@ -0,0 +1,128 @@
+/* ListDialog.java
+ *
+ * created: Fri Sep 1 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ListDialog.java,v 1.1 2004-06-09 09:47:01 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * This component is a JDialog that contains a List.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: ListDialog.java,v 1.1 2004-06-09 09:47:01 tjc Exp $
+ **/
+
+public class ListDialog extends JDialog {
+ /**
+ * Create a new ListDialog component.
+ **/
+ public ListDialog (final JFrame parent, final String title) {
+ super (parent, title, true);
+
+ JScrollPane scroll_pane = new JScrollPane (getList ());
+
+ getContentPane ().add (scroll_pane, "Center");
+
+ getList ().setBackground (Color.white);
+
+ button_panel = new JPanel ();
+
+ button_panel.add (ok_button);
+
+ getContentPane ().add (button_panel, "South");
+
+ ok_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ selected_item = getList ().getSelectedValue ();
+ ListDialog.this.dispose ();
+ }
+ });
+
+ button_panel.add (cancel_button);
+ cancel_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ selected_item = null;
+ ListDialog.this.dispose ();
+ }
+ });
+ packme ();
+ }
+
+ /**
+ * This method will call pack () and then move the JDialog to the centre of
+ * the screen.
+ **/
+ private void packme () {
+ pack ();
+
+ setSize (750, 400);
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+
+ final int x_position = (screen.width - getSize ().width) / 2;
+ int y_position = (screen.height - getSize ().height) / 2;
+
+ if (y_position < 10) {
+ y_position = 10;
+ }
+
+ setLocation (new Point (x_position, y_position));
+ }
+
+ /**
+ * Show the dialog and then return the selected item, or null if the user
+ * hits cancel.
+ **/
+ public Object getSelectedValue () {
+ show ();
+ return selected_item;
+ }
+
+ /**
+ * Return the reference of the List.
+ **/
+ public JList getList () {
+ return list;
+ }
+
+ /**
+ * The List.
+ **/
+ final private JList list = new JList ();
+
+ private final JButton ok_button = new JButton ("OK");
+ private final JButton cancel_button = new JButton ("Cancel");
+
+ private JPanel button_panel = null;
+
+ /**
+ * Set to null if and only if the user cancels the dialog, otherwise
+ * contains the selected item.
+ **/
+ private Object selected_item = null;
+}
diff --git a/uk/ac/sanger/artemis/components/LogReadListener.java b/uk/ac/sanger/artemis/components/LogReadListener.java
new file mode 100644
index 000000000..646fc23a9
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/LogReadListener.java
@@ -0,0 +1,76 @@
+/* LogReadListener.java
+ *
+ * created: Fri Nov 28 2003
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2003 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/LogReadListener.java,v 1.1 2004-06-09 09:47:02 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.io.ReadListener;
+import uk.ac.sanger.artemis.io.ReadEvent;
+
+import javax.swing.*;
+
+/**
+ * A class that implements ReadListener by logging all ReadEvents.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: LogReadListener.java,v 1.1 2004-06-09 09:47:02 tjc Exp $
+ **/
+
+public class LogReadListener implements ReadListener {
+ /**
+ * Create a new DialogReadListener.
+ * @param source The source we are reading from - generally a file name or
+ * URL. This file name is prepended to the log entries.
+ **/
+ public LogReadListener (final String source) {
+ this.source = source;
+ }
+
+ /**
+ * Implementation of ReadListener.
+ **/
+ public void notify (final ReadEvent event) {
+ if (source == null) {
+ Splash.getLogger ().log (event.getMessage () + "\n");
+ } else {
+ Splash.getLogger ().log ("while reading from " + source + ": " +
+ event.getMessage () + "\n");
+ }
+ seen_message = true;
+ }
+
+ /**
+ * Return true if and only if notify() has been called at least once.
+ **/
+ public boolean seenMessage () {
+ return seen_message;
+ }
+
+ /**
+ * The name that was passed to the constructor.
+ **/
+ private String source;
+
+ private boolean seen_message = false;
+}
diff --git a/uk/ac/sanger/artemis/components/LogViewer.java b/uk/ac/sanger/artemis/components/LogViewer.java
new file mode 100644
index 000000000..dbbbf1940
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/LogViewer.java
@@ -0,0 +1,102 @@
+/* LogViewer.java
+ *
+ * created: Wed Aug 30 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/LogViewer.java,v 1.1 2004-06-09 09:47:03 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import java.io.*;
+
+/**
+ * A class for viewing log messages in a FileViewer component.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: LogViewer.java,v 1.1 2004-06-09 09:47:03 tjc Exp $
+ **/
+
+public class LogViewer implements Logger
+{
+
+ /** The FileViewer that is used to show the messages. */
+ private FileViewer file_viewer = null;
+
+ /**
+ * Create a new, empty LogViewer component.
+ **/
+ public LogViewer()
+ {
+
+ }
+
+ /**
+ * Send the given String to the log.
+ **/
+ public void log(final String message)
+ {
+ maybeMakeViewer();
+ file_viewer.appendString(message);
+ }
+
+ /**
+ * Read from the given Reader and send it to the log.
+ **/
+ public void log(final Reader reader)
+ throws IOException
+ {
+ maybeMakeViewer();
+ file_viewer.appendFile(reader);
+ }
+
+ /**
+ * Call setVisible() on the FileViewer that this object contains.
+ **/
+ public void setVisible(final boolean flag)
+ {
+ maybeMakeViewer();
+ file_viewer.setVisible(flag);
+ }
+
+ /**
+ * If file_viewer is null make a FileViewer and assign it to file_viewer.
+ **/
+ private void maybeMakeViewer()
+ {
+ if (file_viewer == null)
+ {
+ file_viewer = new FileViewer("Log Viewer", false)
+ {
+ public void dispose()
+ {
+ // if the FileViewer is deleted we want to know
+ file_viewer = null;
+ super.dispose();
+ }
+ };
+
+ file_viewer.pack();
+ }
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/MarkerRangeRequester.java b/uk/ac/sanger/artemis/components/MarkerRangeRequester.java
new file mode 100644
index 000000000..26b033376
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/MarkerRangeRequester.java
@@ -0,0 +1,106 @@
+/* MarkerRangeRequester.java
+ *
+ * created: Mon Jul 10 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/MarkerRangeRequester.java,v 1.1 2004-06-09 09:47:04 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import java.util.Vector;
+
+/**
+ * A requester that gets a MarkerRange or a Range from the user.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: MarkerRangeRequester.java,v 1.1 2004-06-09 09:47:04 tjc Exp $
+ **/
+
+public class MarkerRangeRequester extends TextRequester {
+ /**
+ * Create a new MarkerRangeRequester component with the given prompt. Other
+ * components can listen for MarkerRangeRequesterEvent object.
+ * @param prompt A message that is displayed in the component beside the
+ * TextArea that the user types into. This String is also used as the
+ * JFrame title.
+ * @param width The width of the TextRequester in the new requester.
+ * @param initial_text The initial text to put in the TextRequester.
+ **/
+ public MarkerRangeRequester (final String prompt,
+ final int width,
+ final String initial_text) {
+ super (prompt, width, initial_text);
+ }
+
+ /**
+ * Add the given object as a listen for MarkerRangeRequester events from
+ * this MarkerRangeRequester.
+ **/
+ public void
+ addMarkerRangeRequesterListener (final MarkerRangeRequesterListener l) {
+ listeners.addElement (l);
+ }
+
+ /**
+ * Send a MarkerRangeRequesterEvent of type OK to all the listeners.
+ **/
+ protected void performOK () {
+ final MarkerRangeRequesterEvent new_event =
+ new MarkerRangeRequesterEvent (this, getText (),
+ MarkerRangeRequesterEvent.OK);
+
+ sendEvent (new_event);
+
+ super.performOK ();
+ }
+
+ /**
+ * Send a MarkerRangeRequesterEvent of type CANCEL to all the listeners.
+ **/
+ protected void performCancel () {
+ final MarkerRangeRequesterEvent new_event =
+ new MarkerRangeRequesterEvent (this, getText (),
+ MarkerRangeRequesterEvent.CANCEL);
+
+ sendEvent (new_event);
+
+ super.performCancel ();
+ }
+
+ /**
+ * Send the given MarkerRangeRequesterEvent to all the object that are
+ * listening for the event.
+ **/
+ private void sendEvent (final MarkerRangeRequesterEvent event) {
+ for (int i = 0 ; i < listeners.size () ; ++i) {
+ final MarkerRangeRequesterListener listener =
+ ((MarkerRangeRequesterListener) listeners.elementAt (i));
+
+ listener.actionPerformed (event);
+ }
+ }
+
+ /**
+ * This contains the objects that are listening for MarkerRangeRequester
+ * events from this MarkerRangeRequester.
+ **/
+ private Vector listeners = new Vector ();
+}
diff --git a/uk/ac/sanger/artemis/components/MarkerRangeRequesterEvent.java b/uk/ac/sanger/artemis/components/MarkerRangeRequesterEvent.java
new file mode 100644
index 000000000..afa2db47c
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/MarkerRangeRequesterEvent.java
@@ -0,0 +1,199 @@
+/* MarkerRangeRequesterEvent.java
+ *
+ * created: Mon Jul 10 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/MarkerRangeRequesterEvent.java,v 1.1 2004-06-09 09:47:05 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.sequence.*;
+
+import uk.ac.sanger.artemis.util.OutOfRangeException;
+import uk.ac.sanger.artemis.io.Range;
+import uk.ac.sanger.artemis.io.LocationLexer;
+import uk.ac.sanger.artemis.io.LocationLexer.*;
+import uk.ac.sanger.artemis.util.*;
+
+import javax.swing.*;
+
+/**
+ * This event is sent when the user presses OK or Cancel in a
+ * MarkerRangeRequester component.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: MarkerRangeRequesterEvent.java,v 1.1 2004-06-09 09:47:05 tjc Exp $
+ **/
+
+public class MarkerRangeRequesterEvent extends TextRequesterEvent {
+ /**
+ * Create a new MarkerRangeRequesterEvent object.
+ * @param source The MarkerRangeRequester that generated the event.
+ * @param requester_text The contents of the TextField in the
+ * MarkerRangeRequester.
+ * @param type The type of event.
+ **/
+ public MarkerRangeRequesterEvent (final MarkerRangeRequester source,
+ final String requester_text,
+ final int type) {
+ super (source, requester_text, type);
+ }
+
+
+ /**
+ * Parse a Range and return the start and end positions in an array that is
+ * two elements long.
+ * @return null if and only if there was a parse error. If the range is on
+ * the forward strand the first element will be less than or equal to the
+ * second, otherwise the first will be greater than the second.
+ **/
+ private int [] getRangeInternal () {
+ if (getRequesterText ().length () == 0) {
+ return null;
+ }
+
+ final LocationLexer lexer = new LocationLexer (getRequesterText ());
+
+ final TokenEnumeration enum = lexer.getTokens ();
+
+ boolean complement_flag = false;
+
+ if (enum.peekElement () instanceof String &&
+ ((String)enum.peekElement ()).equals ("complement")) {
+ complement_flag = true;
+ enum.nextElement ();
+ }
+
+ enum.eatToken ('(');
+
+ if (enum.peekElement () instanceof Integer) {
+ int first_base = ((Integer) enum.nextElement ()).intValue ();
+
+ if (enum.peekElement () instanceof Integer ||
+ (enum.eatToken ("..") || enum.eatToken ('.') ||
+ enum.eatToken ("-")) &&
+ enum.peekElement () instanceof Integer) {
+ int last_base = ((Integer) enum.nextElement ()).intValue ();
+
+ enum.eatToken (')');
+
+ if (enum.peekElement () == null) {
+ if (complement_flag) {
+ final int temp = first_base;
+ first_base = last_base;
+ last_base = temp;
+ }
+
+ return new int [] {
+ first_base, last_base
+ };
+ } else {
+ new MessageDialog ((JFrame) getSource (),
+ "garbage at the end of the range: " + enum);
+ return null;
+ }
+ }
+ }
+
+ // if we get to here then there was a parse error
+ new MessageDialog ((JFrame) getSource (),
+ "error in range: the range should have this " +
+ "form: 100..200 - error at: " + enum);
+
+ return null;
+ }
+
+ /**
+ * Parse the contents of the String that was passed to the constructor as a
+ * Range and return it.
+ * @param bases The Bases object to use to find the Strand that is passed
+ * to the MarkerRange constructor.
+ * @return The Range or null if the Range can't be parsed.
+ **/
+ public MarkerRange getMarkerRange (final Bases bases) {
+ try {
+ final MarkerRange marker_range;
+
+ final int [] return_values = getRangeInternal ();
+
+ if (return_values == null) {
+ return null;
+ }
+
+ final int first_base = return_values[0];
+ final int last_base = return_values[1];
+
+ if (first_base <= last_base) {
+ // forward strand
+ final Strand strand;
+
+ strand = bases.getForwardStrand ();
+
+ marker_range =
+ strand.makeMarkerRangeFromPositions (first_base,
+ last_base);
+ } else {
+ // reverse strand
+ final Strand strand = bases.getReverseStrand ();
+ final int raw_first = bases.getComplementPosition (first_base);
+ final int raw_last = bases.getComplementPosition (last_base);
+
+ marker_range =
+ strand.makeMarkerRangeFromPositions (raw_last,
+ raw_first);
+ }
+
+ return marker_range;
+ } catch (OutOfRangeException e) {
+ new MessageDialog ((JFrame) getSource (),
+ "the bases are out of range for this " +
+ "sequence");
+ return null;
+ }
+ }
+
+ /**
+ * Parse and return a raw Range object from the text.
+ * @return The Range or null if the range could not be parsed.
+ **/
+ public Range getRawRange () {
+ final int [] return_values = getRangeInternal ();
+
+ if (return_values == null) {
+ return null;
+ }
+
+ final int first_base = return_values[0];
+ final int last_base = return_values[1];
+
+ try {
+ if (first_base < last_base) {
+ return new Range (first_base, last_base);
+ } else {
+ return new Range (last_base, first_base);
+ }
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+}
+
+
diff --git a/uk/ac/sanger/artemis/components/MarkerRangeRequesterListener.java b/uk/ac/sanger/artemis/components/MarkerRangeRequesterListener.java
new file mode 100644
index 000000000..732421579
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/MarkerRangeRequesterListener.java
@@ -0,0 +1,42 @@
+/* MarkerRangeRequesterListener.java
+ *
+ * created: Mon Jul 10 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/MarkerRangeRequesterListener.java,v 1.1 2004-06-09 09:47:06 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+/**
+ * This interface is implemented by those classes that need to listen for
+ * MarkerRangeRequesterEvents.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: MarkerRangeRequesterListener.java,v 1.1 2004-06-09 09:47:06 tjc Exp $
+ **/
+
+public interface MarkerRangeRequesterListener {
+ /**
+ * Invoked when the user presses the OK or Cancel button on a
+ * MarkerRangeRequester component.
+ **/
+ void actionPerformed (final MarkerRangeRequesterEvent event);
+}
diff --git a/uk/ac/sanger/artemis/components/MessageDialog.java b/uk/ac/sanger/artemis/components/MessageDialog.java
new file mode 100644
index 000000000..18c5a0f52
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/MessageDialog.java
@@ -0,0 +1,143 @@
+/* MessageDialog.java
+ *
+ * created: Mon Dec 14 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/MessageDialog.java,v 1.1 2004-06-09 09:47:07 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.Options;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * A popup dialog box that displays a message and has an OK JButton.
+ *
+ * @author Kim Rutherford
+ * @version $Id: MessageDialog.java,v 1.1 2004-06-09 09:47:07 tjc Exp $
+ **/
+
+public class MessageDialog extends JDialog {
+ /**
+ * Create a blocking MessageDialog component.
+ * @param parent The parent window.
+ * @param message The message to display in the JDialog and to use as the
+ * frame title.
+ **/
+ public MessageDialog (final JFrame parent, final String message) {
+ this (parent, message, message, true);
+ }
+
+ /**
+ * Create a new MessageDialog component.
+ * @param parent The parent window.
+ * @param message The message to display in the JDialog and to use as the
+ * frame title.
+ * @param modal If true, dialog blocks input to the parent window when
+ * shown.
+ **/
+ public MessageDialog (final JFrame parent, final String message,
+ final boolean modal) {
+ this (parent, message, message, modal);
+ }
+
+ /**
+ * Create a blocking MessageDialog component.
+ * @param parent_frame The parent window.
+ * @param title The title of the new dialog JFrame.
+ * @param message The message to display in the JDialog.
+ **/
+ public MessageDialog (final JFrame parent_frame,
+ final String title,
+ final String message) {
+ this (parent_frame, title, message, true);
+ }
+
+ /**
+ * Create a new MessageDialog component.
+ * @param parent_frame The parent window.
+ * @param title The title of the new dialog JFrame.
+ * @param message The message to display in the JDialog.
+ * @param modal If true, dialog blocks input to the parent window when
+ * shown.
+ **/
+ public MessageDialog (final JFrame parent_frame,
+ final String title,
+ final String message,
+ final boolean modal) {
+ super (parent_frame, title, modal);
+
+ final Font font = Options.getOptions ().getFont ();
+ setFont (font);
+
+ if (message.length () < MESSAGE_SPLIT_SIZE) {
+ getContentPane ().add (new JLabel (message), "North");
+ } else {
+ final JTextArea text_area = new JTextArea (18, 90);
+ text_area.setText (message);
+
+ getContentPane().add (new JScrollPane (text_area), "North");
+ text_area.setEditable (false);
+ }
+
+ final JPanel panel = new JPanel ();
+
+ panel.add (ok_button);
+ ok_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ MessageDialog.this.dispose ();
+ }
+ });
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ MessageDialog.this.dispose ();
+ }
+ });
+
+ addKeyListener (new KeyAdapter () {
+ public void keyTyped(final KeyEvent e) {
+ MessageDialog.this.dispose ();
+ }
+ });
+
+ getContentPane ().add (panel, "South");
+ pack ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+
+ setVisible (true);
+ }
+
+ /**
+ * Messages longer than this will be put in a TextArea rather than a Label.
+ **/
+ final private int MESSAGE_SPLIT_SIZE = 100;
+
+ final private JButton ok_button = new JButton ("OK");
+}
+
diff --git a/uk/ac/sanger/artemis/components/MessageFrame.java b/uk/ac/sanger/artemis/components/MessageFrame.java
new file mode 100644
index 000000000..79914703f
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/MessageFrame.java
@@ -0,0 +1,106 @@
+/* MessageFrame.java
+ *
+ * created: Mon Jan 18 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/MessageFrame.java,v 1.1 2004-06-09 09:47:08 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.Options;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * A popup JFrame box that displays a message and has an OK JButton.
+ *
+ * @author Kim Rutherford
+ * @version $Id: MessageFrame.java,v 1.1 2004-06-09 09:47:08 tjc Exp $
+ **/
+
+public class MessageFrame extends JFrame {
+ /**
+ * Create a new MessageFrame component.
+ * @param message The message to display in the JDialog and it's title.
+ **/
+ public MessageFrame (final String message) {
+ this (message, message);
+
+ this.message = new JLabel (message);
+ }
+
+ /**
+ * Create a new MessageFrame component.
+ * @param title The title of the new dialog JFrame.
+ * @param message The message to display in the JDialog.
+ **/
+ public MessageFrame (final String title,
+ final String message) {
+ super (title);
+
+ this.message = new JLabel (message);
+
+ getContentPane ().add (this.message, "North");
+
+ final JPanel panel = new JPanel ();
+
+ panel.add (ok_button);
+ ok_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ MessageFrame.this.dispose ();
+ }
+ });
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ MessageFrame.this.dispose ();
+ }
+ });
+
+ addKeyListener (new KeyAdapter () {
+ public void keyTyped(final KeyEvent e) {
+ MessageFrame.this.dispose ();
+ }
+ });
+
+ getContentPane ().add (panel, "South");
+ pack ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+
+ setVisible (true);
+ }
+
+ final private JButton ok_button = new JButton ("OK");
+
+ /**
+ * This is the message displayed above the OK button. It can be set with
+ * setMessage ().
+ **/
+ private JLabel message;
+}
+
+
diff --git a/uk/ac/sanger/artemis/components/MultiComparator.java b/uk/ac/sanger/artemis/components/MultiComparator.java
new file mode 100644
index 000000000..daeade376
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/MultiComparator.java
@@ -0,0 +1,1091 @@
+/* MultiComparator.java
+ *
+ * created: Tue Sep 11 2001
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 2001,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/MultiComparator.java,v 1.1 2004-06-09 09:47:09 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import uk.ac.sanger.artemis.util.FileDocument;
+import uk.ac.sanger.artemis.util.OutOfRangeException;
+import uk.ac.sanger.artemis.util.InputStreamProgressListener;
+import uk.ac.sanger.artemis.io.EntryInformationException;
+import uk.ac.sanger.artemis.io.DocumentEntryFactory;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.SimpleEntryInformation;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.io.IOException;
+import java.io.File;
+import java.util.Vector;
+import java.net.URL;
+import javax.swing.*;
+import java.awt.dnd.*;
+import java.awt.datatransfer.Transferable;
+import java.awt.datatransfer.UnsupportedFlavorException;
+import javax.swing.border.Border;
+import javax.swing.border.BevelBorder;
+
+/**
+ * This JFrame component contains an arbitrary number of AlignmentViewer
+ * components and FeatureDisplay components along with ComparatorGlue objects
+ * to keep them synchronized.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: MultiComparator.java,v 1.1 2004-06-09 09:47:09 tjc Exp $
+ **/
+
+public class MultiComparator extends JFrame
+ implements DropTargetListener
+{
+
+ /** The menu_bar is created in makeMenus(). */
+ private final JMenuBar menu_bar = new JMenuBar();
+
+ /**
+ * An array of EntryGroup objects to display(set by the constructor). The
+ * array will contain at least one EntryGroup and will be exactly one
+ * element longer than comparison_data_array.
+ **/
+ private EntryGroup[] entry_group_array = null;
+
+ /**
+ * An array of ComparisonData objects to display(set by the constructor).
+ * The array will be exactly one element shorter than entry_group_array.
+ **/
+ private ComparisonData[] comparison_data_array = null;
+
+ /**
+ * An array of Selection objects - one per EntryGroup. Created by
+ * makeSelectionArray()
+ **/
+ private Selection[] selection_array = null;
+
+ /**
+ * An array of GotoEventSource objects - one per EntryGroup. Created by
+ * makeGotoEventSourceArray()
+ **/
+ private GotoEventSource[] goto_event_source_array = null;
+
+ /**
+ * An array of FeatureDisplay objects - one per EntryGroup. Created in the
+ * constructor.
+ **/
+ private FeatureDisplay[] feature_display_array = null;
+
+ /**
+ * An array of AlignmentViewer objects - one per ComparisonData. Created
+ * in the constructor.
+ **/
+ private AlignmentViewer[] alignment_viewer_array = null;
+
+ /**
+ * An array of AlignmentViewer objects - one per ComparisonData. Created
+ * in the constructor.
+ **/
+ private ComparatorGlue[] comparator_glue_array = null;
+
+ /**
+ * An array of BasePlotGroup objects - one per FeatureDisplay/EntryGroup.
+ * Created in the constructor.
+ **/
+ private BasePlotGroup[] base_plot_group_array = null;
+
+ /** This menu is populated by makeFileMenu(). */
+ private final JMenu file_menu = new JMenu("File");
+
+ /**
+ * The EntrySourceVector reference that is created in the constructor.
+ **/
+ private EntrySourceVector entry_sources;
+
+ /** Used to show the progress of loading file. */
+ private InputStreamProgressListener progress_listener;
+
+ /** current group used for drag and drop */
+ private int current_group = -1;
+
+ /**
+ * Initialise entry_group_array and comparison_data_array and create all
+ * the FeatureDisplay and AlignmentViewer components.
+ * @param entry_group_array The EntryGroup components to display.
+ * @param comparison_data_array The ComparisonData to display. This array
+ * must have one element less than entry_group_array.
+ * @param progress_listener The object to which InputStreamProgressEvents
+ * will be send while reading. Currently unused.
+ **/
+ public MultiComparator(final EntryGroup[] entry_group_array,
+ final ComparisonData[] comparison_data_array,
+ final InputStreamProgressListener
+ progress_listener)
+ {
+ if(entry_group_array.length != comparison_data_array.length + 1)
+ throw new Error("internal error - " +
+ "MultiComparator got illegal arguments");
+
+ this.entry_group_array = entry_group_array;
+ this.comparison_data_array = comparison_data_array;
+ this.progress_listener = progress_listener;
+ this.entry_sources = Utilities.getEntrySources(this, null);
+
+ setDropTarget(new DropTarget(this,this));
+ final StringBuffer title_buffer = new StringBuffer();
+
+ title_buffer.append("ACT: ");
+
+ for(int i = 0; i < entry_group_array.length - 1; ++i)
+ {
+ final String sequence_name =
+ entry_group_array[i].getDefaultEntry().getName();
+ title_buffer.append(sequence_name).append(" vs ");
+ }
+
+ final EntryGroup last_entry_group =
+ entry_group_array[entry_group_array.length - 1];
+
+ title_buffer.append(last_entry_group.getDefaultEntry().getName());
+
+ setTitle(title_buffer.toString());
+
+ makeSelectionArray();
+ makeGotoEventSourceArray();
+
+ feature_display_array =
+ new FeatureDisplay[entry_group_array.length];
+ base_plot_group_array =
+ new BasePlotGroup[entry_group_array.length];
+ alignment_viewer_array =
+ new AlignmentViewer[comparison_data_array.length];
+ comparator_glue_array =
+ new ComparatorGlue[comparison_data_array.length];
+
+ for(int i = 0; i < getEntryGroupArray().length; ++i)
+ {
+ final EntryGroup this_entry_group = getEntryGroupArray()[i];
+
+ final BasePlotGroup base_plot_group =
+ new BasePlotGroup(this_entry_group, this,
+ getSelectionArray()[i],
+ getGotoEventSourceArray()[i]);
+
+ final int scroll_bar_position;
+
+ if(i == getEntryGroupArray().length - 1 &&
+ getEntryGroupArray().length == 2)
+ {
+ // put scrollbar at the top normally, but at the bottom of the lower
+ // sequence if there's two entries on display
+ scroll_bar_position = FeatureDisplay.SCROLLBAR_AT_BOTTOM;
+ }
+ else
+ scroll_bar_position = FeatureDisplay.SCROLLBAR_AT_TOP;
+
+ feature_display_array[i] =
+ new FeatureDisplay(this_entry_group,
+ getSelectionArray()[i],
+ getGotoEventSourceArray()[i],
+ base_plot_group,
+ scroll_bar_position);
+
+ feature_display_array[i].setShowLabels(false);
+ feature_display_array[i].setHardLeftEdge(false);
+
+ if(getEntryGroupArray().length > 2)
+ {
+ feature_display_array[i].setShowForwardFrameLines(false);
+ feature_display_array[i].setShowReverseFrameLines(false);
+ }
+
+ feature_display_array[i].addDisplayAdjustmentListener(base_plot_group);
+
+ base_plot_group_array[i] = base_plot_group;
+
+ this_entry_group.ref();
+ }
+
+ for(int i = 0 ; i < getComparisonDataArray().length ; ++i)
+ {
+ alignment_viewer_array[i] =
+ new AlignmentViewer(getFeatureDisplayArray()[i] ,
+ getFeatureDisplayArray()[i + 1],
+ getComparisonDataArray()[i]);
+
+ comparator_glue_array[i] =
+ new ComparatorGlue(this,
+ getFeatureDisplayArray()[i],
+ getFeatureDisplayArray()[i + 1],
+ getAlignmentViewerArray()[i]);
+ }
+
+ final Font default_font = getDefaultFont();
+
+ setFont(default_font);
+
+ makeMenus();
+
+ GridBagLayout gridbag = new GridBagLayout();
+ getContentPane().setLayout(gridbag);
+
+ GridBagConstraints c = new GridBagConstraints();
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ c.fill = GridBagConstraints.HORIZONTAL;
+ c.anchor = GridBagConstraints.NORTH;
+ c.gridheight = 1;
+ c.weightx = 1;
+ c.weighty = 0;
+
+ for(int i = 0; i < getFeatureDisplayArray().length; ++i)
+ {
+ if(!(i == getEntryGroupArray().length - 1 &&
+ getEntryGroupArray().length == 2))
+ {
+ // put graph above the sequence in this case
+ c.weighty = 0;
+ gridbag.setConstraints(base_plot_group_array[i], c);
+ getContentPane().add(base_plot_group_array[i]);
+ }
+
+ c.weighty = 0;
+ gridbag.setConstraints(feature_display_array[i], c);
+ getContentPane().add(feature_display_array[i]);
+
+ if(i == getEntryGroupArray().length - 1 &&
+ getEntryGroupArray().length == 2)
+ {
+ // put graph below the sequence in this case
+ c.weighty = 0;
+ gridbag.setConstraints(base_plot_group_array[i], c);
+ getContentPane().add(base_plot_group_array[i]);
+ }
+
+ if(i < getAlignmentViewerArray().length)
+ {
+ c.fill = GridBagConstraints.BOTH;
+ c.weighty = 1;
+ gridbag.setConstraints(getAlignmentViewerArray()[i], c);
+ getContentPane().add(getAlignmentViewerArray()[i]);
+ }
+ }
+
+ for(int i = 0 ; i < getEntryGroupArray().length ; ++i)
+ {
+ final EntryGroupChangeListener change_listener =
+ new EntryGroupChangeListener()
+ {
+ public void entryGroupChanged(final EntryGroupChangeEvent event)
+ {
+ switch(event.getType())
+ {
+ case EntryGroupChangeEvent.ENTRY_ADDED:
+ case EntryGroupChangeEvent.ENTRY_DELETED:
+ makeFileMenu();
+ break;
+ }
+ }
+ };
+
+ getEntryGroupArray()[i].addEntryGroupChangeListener(change_listener);
+
+ final EntryChangeListener entry_change_listener =
+ new EntryChangeListener()
+ {
+ public void entryChanged(final EntryChangeEvent event)
+ {
+ switch(event.getType())
+ {
+ case EntryChangeEvent.NAME_CHANGED:
+ makeFileMenu();
+ break;
+ }
+ }
+ };
+
+ getEntryGroupArray()[i].addEntryChangeListener(entry_change_listener);
+ }
+
+ addWindowListener(new WindowAdapter()
+ {
+ public void windowClosing(WindowEvent event)
+ {
+ closeComparator();
+ }
+ });
+
+ final URL icon_url = Splash.class.getResource("/icon.gif");
+
+ if(icon_url != null)
+ {
+ Toolkit toolkit = Toolkit.getDefaultToolkit();
+ final Image icon_image = toolkit.getImage(icon_url);
+ MediaTracker tracker = new MediaTracker(this);
+ tracker.addImage(icon_image, 0);
+
+ try
+ {
+ tracker.waitForAll();
+ setIconImage(icon_image);
+ }
+ catch(InterruptedException e)
+ {
+ // ignore and continue
+ }
+ }
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+
+ packme();
+
+ int screen_height = screen.height;
+ int screen_width = screen.width;
+
+ if(getAlignmentViewerArray().length > 0)
+ {
+ if(screen_width <= 900 || screen_height <= 700)
+ setSize(screen_width * 9 / 10, screen_height * 9 / 10);
+ else
+ setSize(900, 700);
+ }
+
+ setLocation(new Point((screen.width - getSize().width) / 2,
+ (screen.height - getSize().height) / 2));
+ }
+
+ /**
+ * Move all the sequences(and comparisons) up one place. The first and
+ * last EntryGroups should be the same(reference).
+ **/
+ private void rotateSequences()
+ {
+ final EntryGroup[] new_entry_groups =
+ new EntryGroup[getEntryGroupArray().length];
+
+ final ComparisonData[] new_comparison_data =
+ new ComparisonData[getComparisonDataArray().length];
+
+ for(int i = 1 ; i < new_entry_groups.length ; ++i)
+ new_entry_groups[i - 1] = getEntryGroupArray()[i];
+
+ new_entry_groups[new_entry_groups.length - 1] = new_entry_groups[0];
+
+ for(int i = 1; i < new_comparison_data.length; ++i)
+ new_comparison_data[i - 1] = getComparisonDataArray()[i];
+
+ new_comparison_data[new_comparison_data.length - 1] =
+ getComparisonDataArray()[0];
+
+ final MultiComparator new_comparator =
+ new MultiComparator(new_entry_groups, new_comparison_data,
+ progress_listener);
+
+ setVisible(false);
+ new_comparator.setVisible(true);
+ closeComparator();
+ }
+
+ /**
+ * If there are no unsaved changes, close this EntryEdit. Otherwise ask
+ * the user first.
+ **/
+ private void closeComparator()
+ {
+ for(int i = 0 ; i < getEntryGroupArray().length ; ++i)
+ {
+ final EntryGroup entry_group = getEntryGroupArray()[i];
+
+ if(entry_group.hasUnsavedChanges() &&
+ entry_group.refCount() == 1)
+ {
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog(this,
+ "there are unsaved changes - really close?");
+
+ if(!yes_no_dialog.getResult())
+ return;
+ }
+ }
+
+ for(int i = 0 ; i < getEntryGroupArray().length ; ++i)
+ {
+ final EntryGroup entry_group = getEntryGroupArray()[i];
+ entry_group.unref();
+ }
+
+ dispose();
+ }
+
+ /**
+ * This method will call pack() and then move the JFrame to the centre of
+ * the screen. (Implementation of the FeatureDisplayOwner interface).
+ **/
+ public void packme()
+ {
+ pack();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+
+ final int x_position =(screen.width - getSize().width) / 2;
+ int y_position =(screen.height - getSize().height) / 2;
+
+ if(y_position < 10)
+ y_position = 10;
+
+ setLocation(new Point(x_position, y_position));
+ }
+
+ /**
+ * Make one Selection object each EntryGroup.
+ **/
+ private void makeSelectionArray()
+ {
+ selection_array = new Selection[getEntryGroupArray().length];
+ for(int i = 0 ; i < selection_array.length ; ++i)
+ selection_array[i] = new Selection(null);
+ }
+
+ /**
+ * Make subject_goto_event_source and query_goto_event_source and wire them
+ * togeather so that goto events do the right thing.
+ **/
+ private void makeGotoEventSourceArray()
+ {
+ goto_event_source_array =
+ new GotoEventSource[getEntryGroupArray().length];
+
+ for(int i = 0 ; i < goto_event_source_array.length ; ++i)
+ {
+ goto_event_source_array[i] =
+ new SimpleGotoEventSource(getEntryGroupArray()[i])
+ {
+ /**
+ * Send the given event to all the GotoListeners.
+ **/
+ public void sendGotoEvent(final GotoEvent goto_event)
+ {
+ // temporarily disable moving so that the other FeatureDisplay
+ // doesn't start moving(because of the listeners set up in
+ // addDisplayListeners()
+ super.sendGotoEvent(goto_event);
+ }
+ };
+ }
+ }
+
+ /**
+ * Save the given entry, prompting for a file name if necessary.
+ **/
+ private void saveEntry(final Entry entry)
+ {
+ if(entry.getName() == null)
+ {
+ final EntryFileDialog file_dialog = new EntryFileDialog(this, true);
+
+ file_dialog.saveEntry(entry, true, true,
+ true, DocumentEntryFactory.ANY_FORMAT);
+
+ }
+ else
+ {
+ try
+ {
+ entry.save(DocumentEntryFactory.ANY_FORMAT);
+ }
+ catch(IOException e)
+ {
+ new MessageDialog(this, "error while saving: " + e);
+ return;
+ }
+ catch(EntryInformationException e)
+ {
+ new MessageDialog(this, "error while saving: " + e);
+ return;
+ }
+ }
+ }
+
+ /**
+ * Return the name to use for the sub JMenu for the given EntryGroup.
+ **/
+ private String makeNewSubMenuName(final EntryGroup entry_group)
+ {
+ final Entry sequence_entry = entry_group.getSequenceEntry();
+
+ if(sequence_entry == null)
+ return "(no name)";
+ else
+ {
+ final String sequence_name = sequence_entry.getName();
+ if(sequence_name == null)
+ return "(no name)";
+ else
+ return sequence_name;
+ }
+
+ }
+
+ /**
+ * Make and add the menus for this component.
+ **/
+ private void makeMenus()
+ {
+ final Font default_font = getDefaultFont();
+
+ setJMenuBar(menu_bar);
+
+ makeFileMenu();
+
+ menu_bar.add(file_menu);
+
+ final JMenu entries_menu = new JMenu("Entries");
+ menu_bar.add(entries_menu);
+ final JMenu select_menu = new JMenu("Select");
+ menu_bar.add(select_menu);
+ final JMenu view_menu = new JMenu("View");
+ menu_bar.add(view_menu);
+ final JMenu goto_menu = new JMenu("Goto");
+ menu_bar.add(goto_menu);
+ final JMenu edit_menu = new JMenu("Edit");
+ menu_bar.add(edit_menu);
+ final JMenu create_menu = new JMenu("Create");
+ menu_bar.add(create_menu);
+ final JMenu write_menu = new JMenu("Write");
+ menu_bar.add(write_menu);
+ JMenu run_menu = null;
+ if(Options.isUnixHost())
+ {
+ run_menu = new JMenu("Run");
+ menu_bar.add(run_menu);
+ }
+ final JMenu graph_menu = new JMenu("Graph");
+ menu_bar.add(graph_menu);
+
+ for(int i = 0 ; i < getEntryGroupArray().length ; ++i)
+ {
+ final EntryGroup entry_group = getEntryGroupArray()[i];
+
+ final String sub_menu_name = makeNewSubMenuName(entry_group);
+
+ final EntryGroupMenu this_entries_menu =
+ new EntryGroupMenu(this,
+ getEntryGroupArray()[i],
+ sub_menu_name);
+ entries_menu.add(this_entries_menu);
+
+ final SelectMenu this_select_menu =
+ new SelectMenu(this,
+ getSelectionArray()[i],
+ getGotoEventSourceArray()[i],
+ getEntryGroupArray()[i],
+ getBasePlotGroupArray()[i],
+ sub_menu_name);
+ select_menu.add(this_select_menu);
+
+ final ViewMenu this_view_menu =
+ new ViewMenu(this,
+ getSelectionArray()[i],
+ getGotoEventSourceArray()[i],
+ getEntryGroupArray()[i],
+ getBasePlotGroupArray()[i],
+ sub_menu_name);
+ view_menu.add(this_view_menu);
+
+ final GotoMenu this_goto_menu =
+ new GotoMenu(this,
+ getSelectionArray()[i],
+ getGotoEventSourceArray()[i],
+ getEntryGroupArray()[i],
+ sub_menu_name);
+ goto_menu.add(this_goto_menu);
+
+ AddMenu this_create_menu = null;
+
+ if(Options.readWritePossible())
+ {
+ final EditMenu this_edit_menu =
+ new EditMenu(this,
+ getSelectionArray()[i],
+ getGotoEventSourceArray()[i],
+ getEntryGroupArray()[i],
+ getBasePlotGroupArray()[i],
+ sub_menu_name);
+ edit_menu.add(this_edit_menu);
+
+ this_create_menu =
+ new AddMenu(this,
+ getSelectionArray()[i],
+ getEntryGroupArray()[i],
+ getGotoEventSourceArray()[i],
+ getBasePlotGroupArray()[i],
+ sub_menu_name);
+ create_menu.add(this_create_menu);
+
+ final WriteMenu this_write_menu =
+ new WriteMenu(this,
+ getSelectionArray()[i],
+ getEntryGroupArray()[i],
+ sub_menu_name);
+ write_menu.add(this_write_menu);
+
+ if(Options.isUnixHost())
+ {
+ final RunMenu this_run_menu =
+ new RunMenu(this,
+ getSelectionArray()[i],
+ sub_menu_name);
+ run_menu.add(this_run_menu);
+ }
+ }
+
+ final GraphMenu this_graph_menu =
+ new GraphMenu(this,
+ getEntryGroupArray()[i],
+ getBasePlotGroupArray()[i],
+ getFeatureDisplayArray()[i],
+ sub_menu_name);
+ graph_menu.add(this_graph_menu);
+ }
+
+ final JMenu display_menu = new JMenu("Display");
+
+ final JMenuItem hide_on_frame_lines_item =
+ new JMenuItem("Hide Frame Lines");
+ hide_on_frame_lines_item.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ for(int i = 0 ; i < getFeatureDisplayArray().length ; ++i)
+ {
+ getFeatureDisplayArray()[i].setShowForwardFrameLines(false);
+ getFeatureDisplayArray()[i].setShowReverseFrameLines(false);
+ }
+ }
+ });
+
+ display_menu.add(hide_on_frame_lines_item);
+
+ final JMenuItem show_on_frame_lines_item =
+ new JMenuItem("Show Frame Lines");
+ show_on_frame_lines_item.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ for(int i = 0 ; i < getFeatureDisplayArray().length ; ++i)
+ {
+ getFeatureDisplayArray()[i].setShowForwardFrameLines(true);
+ getFeatureDisplayArray()[i].setShowReverseFrameLines(true);
+ }
+ }
+ });
+
+ display_menu.add(show_on_frame_lines_item);
+
+ menu_bar.add(display_menu);
+ }
+
+ /**
+ * Make a new File menu replacing the current one(if any).
+ **/
+ private void makeFileMenu()
+ {
+ file_menu.removeAll();
+
+ final EntryGroup[] entry_group_array = getEntryGroupArray();
+
+ JMenuItem popFileManager = new JMenuItem("Show File Manager ...");
+ popFileManager.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ if(ActMain.filemanager == null)
+ ActMain.filemanager = new FileManager(MultiComparator.this,null);
+ else
+ ActMain.filemanager.setVisible(true);
+ }
+ });
+ file_menu.add(popFileManager);
+
+ if(entry_group_array[0] ==
+ entry_group_array[entry_group_array.length - 1])
+ {
+ final JMenuItem rotate_button = new JMenuItem("Rotate Sequences");
+ rotate_button.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ rotateSequences();
+ }
+ });
+
+ file_menu.add(rotate_button);
+ file_menu.addSeparator();
+ }
+
+ for(int i = 0; i < getEntryGroupArray().length; ++i)
+ {
+ final EntryGroup entry_group = getEntryGroupArray()[i];
+ final String new_menu_name = makeNewSubMenuName(entry_group);
+ final JMenu entry_group_menu = new JMenu(new_menu_name);
+ file_menu.add(entry_group_menu);
+
+ for(int source_index = 0; source_index < entry_sources.size();
+ ++source_index)
+ {
+ final EntrySource this_source =
+ entry_sources.elementAt(source_index);
+
+ if(this_source.isFullEntrySource())
+ continue;
+
+ String entry_source_name = this_source.getSourceName();
+ String menu_item_name = null;
+
+ if(entry_source_name.equals("Filesystem"))
+ menu_item_name = "Read An Entry ...";
+ else
+ menu_item_name = "Read An Entry From " + entry_source_name + " ...";
+
+ final JMenuItem read_entry = new JMenuItem(menu_item_name);
+
+ read_entry.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ readAnEntry(this_source,entry_group);
+ }
+ });
+
+ entry_group_menu.add(read_entry);
+ }
+
+ entry_group_menu.addSeparator();
+
+ if(entry_group == null || entry_group.size() == 0)
+ {
+ // don't create a menu
+ }
+ else
+ {
+ final JMenu save_entry_menu = new JMenu("Save Entry");
+
+ for(int entry_index = 0; entry_index < entry_group.size();
+ ++entry_index)
+ {
+ final Entry this_entry = entry_group.elementAt(entry_index);
+ String entry_name = this_entry.getName();
+
+ if(entry_name == null)
+ entry_name = "no name";
+
+ final ActionListener save_entry_listener =
+ new ActionListener()
+ {
+ public void actionPerformed(final ActionEvent event)
+ {
+ MultiComparator.this.saveEntry(this_entry);
+ }
+ };
+
+ final JMenuItem save_entry_item = new JMenuItem(entry_name);
+ save_entry_item.addActionListener(save_entry_listener);
+ save_entry_menu.add(save_entry_item);
+ }
+
+ entry_group_menu.add(save_entry_menu);
+
+ final JMenuItem save_all_menu = new JMenuItem("Save All");
+
+ save_all_menu.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ for(int entry_index = 0; entry_index < entry_group.size();
+ ++entry_index)
+ {
+ final Entry this_entry = entry_group.elementAt(entry_index);
+ MultiComparator.this.saveEntry(this_entry);
+ }
+ }
+ });
+
+ entry_group_menu.add(save_all_menu);
+ entry_group_menu.addSeparator();
+ }
+
+ final JMenuItem edit_subject = new JMenuItem("Edit In Artemis");
+ edit_subject.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ final EntryEdit entry_edit = new EntryEdit(entry_group);
+ entry_edit.setVisible(true);
+ }
+ });
+
+ entry_group_menu.add(edit_subject);
+ }
+
+ file_menu.addSeparator();
+
+ final JMenuItem close_button = new JMenuItem("Close");
+ close_button.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ closeComparator();
+ }
+ });
+
+ file_menu.add(close_button);
+ }
+
+
+ /**
+ * Read an entry
+ **/
+ private void readAnEntry(final EntrySource this_source,
+ final EntryGroup entry_group)
+ {
+ final ProgressThread progress_thread = new ProgressThread(null,
+ "Loading Entry...");
+
+ SwingWorker entryWorker = new SwingWorker()
+ {
+ public Object construct()
+ {
+ try
+ {
+ final Entry new_entry = this_source.getEntry(entry_group.getBases(),
+ progress_thread, true);
+ if(new_entry != null)
+ entry_group.add(new_entry);
+ }
+ catch(final OutOfRangeException e)
+ {
+ new MessageDialog(MultiComparator.this,
+ "read failed: one of the features " +
+ "in the entry has an out of " +
+ "range location: " +
+ e.getMessage());
+ }
+ catch(final IOException e)
+ {
+ new MessageDialog(MultiComparator.this,
+ "read failed due to an IO error: " +
+ e.getMessage());
+ }
+ return null;
+ }
+
+ public void finished()
+ {
+ if(progress_thread !=null)
+ progress_thread.finished();
+ }
+ };
+ entryWorker.start();
+ }
+
+ /**
+ * Read an entry
+ **/
+ private void readAnEntryFromFile(final File file,
+ final EntryGroup entry_group)
+ {
+ final ProgressThread progress_thread = new ProgressThread(null,
+ "Loading Entry...");
+ progress_thread.start();
+
+ SwingWorker entryWorker = new SwingWorker()
+ {
+ public Object construct()
+ {
+ try
+ {
+ EntryInformation new_entry_information =
+ new SimpleEntryInformation(Options.getArtemisEntryInformation());
+
+ final Entry new_entry = new Entry(entry_group.getBases(),
+ EntryFileDialog.getEntryFromFile(null,
+ new FileDocument(file),
+ new_entry_information, false));
+
+ if(new_entry != null)
+ entry_group.add(new_entry);
+ }
+ catch(final OutOfRangeException e)
+ {
+ new MessageDialog(MultiComparator.this,
+ "read failed: one of the features " +
+ "in the entry has an out of " +
+ "range location: " +
+ e.getMessage());
+ }
+ return null;
+ }
+
+ public void finished()
+ {
+ if(progress_thread !=null)
+ progress_thread.finished();
+ }
+ };
+ entryWorker.start();
+ }
+
+
+ /**
+ * Return the current default font(from Diana.options).
+ **/
+ private Font getDefaultFont()
+ {
+ return Options.getOptions().getFont();
+ }
+
+ /**
+ * Return the EntryGroup objects that were passed to the constructor.
+ **/
+ private EntryGroup[] getEntryGroupArray()
+ {
+ return entry_group_array;
+ }
+
+ /**
+ * Return the ComparisonData objects that were passed to the constructor.
+ **/
+ private ComparisonData[] getComparisonDataArray()
+ {
+ return comparison_data_array;
+ }
+
+ /**
+ * Return the AlignmentViewer objects that were created in the constructor.
+ **/
+ private AlignmentViewer[] getAlignmentViewerArray()
+ {
+ return alignment_viewer_array;
+ }
+
+ /**
+ * Return the FeatureDisplay objects that were created in the constructor.
+ **/
+ private FeatureDisplay[] getFeatureDisplayArray()
+ {
+ return feature_display_array;
+ }
+
+ /**
+ * Return the Selection objects that were created in the constructor.
+ **/
+ private Selection[] getSelectionArray()
+ {
+ return selection_array;
+ }
+
+ /**
+ * Return the GotoEventSource objects that were created in the constructor.
+ **/
+ private GotoEventSource[] getGotoEventSourceArray()
+ {
+ return goto_event_source_array;
+ }
+
+ /**
+ * Return the BasePlotGroup objects that were created in the constructor.
+ **/
+ private BasePlotGroup[] getBasePlotGroupArray()
+ {
+ return base_plot_group_array;
+ }
+
+ // DropTargetListener methods
+
+ protected static Border dropBorder = new BevelBorder(BevelBorder.LOWERED);
+ public void drop(DropTargetDropEvent e)
+ {
+ Transferable t = e.getTransferable();
+ try
+ {
+ if(t.isDataFlavorSupported(FileNode.FILENODE))
+ {
+ FileNode fn = (FileNode)t.getTransferData(FileNode.FILENODE);
+ readAnEntryFromFile(fn.getFile(),
+ entry_group_array[current_group]);
+ }
+ else
+ e.rejectDrop();
+ }
+ catch(UnsupportedFlavorException ufe)
+ {
+ ufe.printStackTrace();
+ }
+ catch(IOException ioe)
+ {
+ ioe.printStackTrace();
+ }
+ finally
+ {
+ feature_display_array[current_group].setBorder(null);
+ }
+ }
+
+ public void dragExit(DropTargetEvent e)
+ {
+ for(int i=0;i<feature_display_array.length;i++)
+ feature_display_array[i].setBorder(null);
+ }
+ public void dropActionChanged(DropTargetDragEvent e) {}
+
+ public void dragOver(DropTargetDragEvent e)
+ {
+ if(e.isDataFlavorSupported(FileNode.FILENODE))
+ {
+ Point ploc = e.getLocation();
+ boolean over_feature_display = false;
+
+ for(int i=0;i<feature_display_array.length;i++)
+ {
+ int top = feature_display_array[i].getY();
+ int btm = top + feature_display_array[i].getHeight();
+
+ if(ploc.y > top && ploc.y < btm)
+ {
+ feature_display_array[i].setBorder(dropBorder);
+ e.acceptDrag(DnDConstants.ACTION_COPY_OR_MOVE);
+ current_group = i;
+ return;
+ }
+ }
+
+ e.rejectDrag();
+ }
+ }
+
+ public void dragEnter(DropTargetDragEvent e)
+ {
+ if(e.isDataFlavorSupported(FileNode.FILENODE))
+ e.acceptDrag(DnDConstants.ACTION_COPY_OR_MOVE);
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/Navigator.java b/uk/ac/sanger/artemis/components/Navigator.java
new file mode 100644
index 000000000..199dd60e7
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/Navigator.java
@@ -0,0 +1,933 @@
+/* Navigator.java
+ *
+ * created: Sun Jan 10 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/Navigator.java,v 1.1 2004-06-09 09:47:10 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.sequence.*;
+import uk.ac.sanger.artemis.*;
+
+import uk.ac.sanger.artemis.util.StringVector;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * This component allows the user to navigate around the Entry.
+ *
+ * @author Kim Rutherford
+ * @version $Id: Navigator.java,v 1.1 2004-06-09 09:47:10 tjc Exp $
+ **/
+
+public class Navigator extends JFrame
+ implements EntryGroupChangeListener {
+ /**
+ * Create a new Navigator component.
+ * @param selection The Selection that the commands will operate on.
+ * @param goto_event_source The object the we will call gotoBase () on.
+ * @param entry_group The EntryGroup object used when searching for
+ * qualifier text in features.
+ **/
+ public Navigator (final Selection selection,
+ final GotoEventSource goto_event_source,
+ final EntryGroup entry_group) {
+ super ("Artemis Navigator");
+
+ this.selection = selection;
+ this.entry_group = entry_group;
+ this.goto_event_source = goto_event_source;
+
+ final Font default_font = Options.getOptions ().getFont ();
+
+ GridBagLayout gridbag = new GridBagLayout();
+ getContentPane ().setLayout (gridbag);
+
+ setFont (default_font);
+
+ GridBagConstraints c = new GridBagConstraints();
+
+ c.fill = GridBagConstraints.HORIZONTAL;
+ c.anchor = GridBagConstraints.NORTH;
+ c.weighty = 0;
+
+ final int TEXT_FIELD_WIDTH = 25;
+
+ final ButtonGroup button_group = new ButtonGroup ();
+
+ goto_base_button = new JRadioButton ("Goto Base:", true);
+
+ button_group.add (goto_base_button);
+
+ final JPanel goto_base_panel = new JPanel ();
+ goto_base_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ goto_base_panel.add (goto_base_button);
+ c.gridwidth = 2;
+ gridbag.setConstraints (goto_base_panel, c);
+ getContentPane ().add (goto_base_panel);
+
+ goto_base_text = new JTextField ("", TEXT_FIELD_WIDTH);
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (goto_base_text, c);
+ getContentPane ().add (goto_base_text);
+
+ goto_base_text.addKeyListener (new KeyAdapter () {
+ public void keyTyped(final KeyEvent e) {
+ goto_base_button.setSelected (true);
+ if (e.getKeyChar () == '\n') {
+ doGoto ();
+ }
+ }
+ });
+
+
+ goto_gene_name_button =
+ new JRadioButton ("Goto Feature With Gene Name:", true);
+
+ button_group.add (goto_gene_name_button);
+
+ final JPanel goto_gene_name_panel = new JPanel ();
+ goto_gene_name_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ goto_gene_name_panel.add (goto_gene_name_button);
+ c.gridwidth = 2;
+ gridbag.setConstraints (goto_gene_name_panel, c);
+ getContentPane ().add (goto_gene_name_panel);
+
+ goto_gene_name_textfield = new JTextField ("", TEXT_FIELD_WIDTH);
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (goto_gene_name_textfield, c);
+ getContentPane ().add (goto_gene_name_textfield);
+
+ goto_gene_name_textfield.addKeyListener (new KeyAdapter () {
+ public void keyTyped(final KeyEvent e) {
+ goto_gene_name_button.setSelected (true);
+ if (e.getKeyChar () == '\n') {
+ doGoto ();
+ }
+ }
+ });
+
+
+ goto_qualifier_button =
+ new JRadioButton ("Goto Feature With This Qualifier Value:", true);
+ button_group.add (goto_qualifier_button);
+
+ final JPanel goto_qualifier_panel = new JPanel ();
+ goto_qualifier_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ goto_qualifier_panel.add (goto_qualifier_button);
+ c.gridwidth = 2;
+ gridbag.setConstraints (goto_qualifier_panel, c);
+ getContentPane ().add (goto_qualifier_panel);
+
+ goto_qualifier_textfield = new JTextField ("", TEXT_FIELD_WIDTH);
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (goto_qualifier_textfield, c);
+ getContentPane ().add (goto_qualifier_textfield);
+
+ goto_qualifier_textfield.addKeyListener (new KeyAdapter () {
+ public void keyTyped(final KeyEvent e) {
+ goto_qualifier_button.setSelected (true);
+ if (e.getKeyChar () == '\n') {
+ doGoto ();
+ }
+ }
+ });
+
+
+ goto_key_button =
+ new JRadioButton ("Goto Feature With This Key:", true);
+ button_group.add (goto_key_button);
+
+ final JPanel goto_key_panel = new JPanel ();
+ goto_key_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ goto_key_panel.add (goto_key_button);
+ c.gridwidth = 2;
+ gridbag.setConstraints (goto_key_panel, c);
+ getContentPane ().add (goto_key_panel);
+
+ goto_feature_key_textfield = new JTextField ("", TEXT_FIELD_WIDTH);
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (goto_feature_key_textfield, c);
+ getContentPane ().add (goto_feature_key_textfield);
+
+ goto_feature_key_textfield.addKeyListener (new KeyAdapter () {
+ public void keyTyped(final KeyEvent e) {
+ goto_key_button.setSelected (true);
+ if (e.getKeyChar () == '\n') {
+ doGoto ();
+ }
+ }
+ });
+
+
+ goto_base_pattern_button =
+ new JRadioButton ("Find Base Pattern:", true);
+ button_group.add (goto_base_pattern_button);
+
+ final JPanel goto_base_pattern_panel = new JPanel ();
+ goto_base_pattern_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ goto_base_pattern_panel.add (goto_base_pattern_button);
+ c.gridwidth = 2;
+ gridbag.setConstraints (goto_base_pattern_panel, c);
+ getContentPane ().add (goto_base_pattern_panel);
+
+ goto_base_pattern_text = new JTextField ("", TEXT_FIELD_WIDTH);
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (goto_base_pattern_text, c);
+ getContentPane ().add (goto_base_pattern_text);
+
+ goto_base_pattern_text.addKeyListener (new KeyAdapter () {
+ public void keyTyped(final KeyEvent e) {
+ goto_base_pattern_button.setSelected (true);
+ if (e.getKeyChar () == '\n') {
+ doGoto ();
+ }
+ }
+ });
+
+ goto_aa_pattern_button =
+ new JRadioButton ("Find Amino Acid String:", true);
+ button_group.add (goto_aa_pattern_button);
+
+ final JPanel goto_aa_pattern_panel = new JPanel ();
+ goto_aa_pattern_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ goto_aa_pattern_panel.add (goto_aa_pattern_button);
+ c.gridwidth = 2;
+ gridbag.setConstraints (goto_aa_pattern_panel, c);
+ getContentPane ().add (goto_aa_pattern_panel);
+
+ goto_aa_pattern_text = new JTextField ("", TEXT_FIELD_WIDTH);
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (goto_aa_pattern_text, c);
+ getContentPane ().add (goto_aa_pattern_text);
+
+ goto_aa_pattern_text.addKeyListener (new KeyAdapter () {
+ public void keyTyped(final KeyEvent e) {
+ goto_aa_pattern_button.setSelected (true);
+ if (e.getKeyChar () == '\n') {
+ doGoto ();
+ }
+ }
+ });
+
+
+ goto_base_button.setSelected (true);
+
+ final ButtonGroup start_position_button_group =
+ new ButtonGroup ();
+
+ final JPanel start_at_an_end_panel = new JPanel ();
+
+ start_at_an_end_button =
+ new JRadioButton ("Start search at beginning (or end)", true);
+
+ start_position_button_group.add (start_at_an_end_button);
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+
+ start_at_an_end_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ start_at_an_end_panel.add (start_at_an_end_button);
+
+ gridbag.setConstraints (start_at_an_end_panel, c);
+ getContentPane ().add (start_at_an_end_panel);
+
+
+ final JPanel start_at_selection_panel = new JPanel ();
+
+ start_at_selection_button =
+ new JRadioButton ("Start search at selection", false);
+ start_position_button_group.add (start_at_selection_button);
+
+ start_at_selection_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ start_at_selection_panel.add (start_at_selection_button);
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+
+ gridbag.setConstraints (start_at_selection_panel, c);
+ getContentPane ().add (start_at_selection_panel);
+
+
+ final JPanel option_button_panel = new JPanel ();
+
+ option_button_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+
+ search_backward_button = new JRadioButton ("Search Backward", false);
+ ignore_case_button = new JRadioButton ("Ignore Case", true);
+ partial_match_button = new JRadioButton ("Allow Substring Matches", true);
+
+ option_button_panel.add (search_backward_button);
+ option_button_panel.add (ignore_case_button);
+ option_button_panel.add (partial_match_button);
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+
+ gridbag.setConstraints (option_button_panel, c);
+ getContentPane ().add (option_button_panel);
+
+
+ final JButton goto_button = new JButton ("Goto");
+
+ goto_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ doGoto ();
+ }
+ });
+
+
+ final JButton clear_button = new JButton ("Clear");
+
+ clear_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ clear ();
+ }
+ });
+
+
+ final JButton close_button = new JButton ("Close");
+
+ close_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ Navigator.this.dispose ();
+ }
+ });
+
+
+ final FlowLayout flow_layout =
+ new FlowLayout (FlowLayout.CENTER, 15, 5);
+
+ final JPanel close_and_goto_panel = new JPanel (flow_layout);
+
+ close_and_goto_panel.add (goto_button);
+ close_and_goto_panel.add (clear_button);
+ close_and_goto_panel.add (close_button);
+
+ gridbag.setConstraints (close_and_goto_panel, c);
+ getContentPane ().add (close_and_goto_panel);
+
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ getEntryGroup ().removeEntryGroupChangeListener (Navigator.this);
+ Navigator.this.dispose ();
+ }
+ });
+
+ getEntryGroup ().addEntryGroupChangeListener (this);
+
+ pack ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+
+ setVisible (true);
+ }
+
+ /**
+ * Implementation of the EntryGroupChangeListener interface. We listen to
+ * EntryGroupChange events so that we can get rid of the Navigator when the
+ * EntryGroup is no longer in use (for example when the EntryEdit is
+ * closed).
+ **/
+ public void entryGroupChanged (final EntryGroupChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryGroupChangeEvent.DONE_GONE:
+ getEntryGroup ().removeEntryGroupChangeListener (this);
+ dispose ();
+ break;
+ }
+ }
+
+ /**
+ * This method finds the given pattern in the Bases of the given EntryGroup
+ * and returns a MarkerRange for it.
+ * @param pattern This is the pattern to search for.
+ * @param entry_group The EntryGroup to search.
+ * @param selection The current selection.
+ * @param start_at_end If true or if there is nothing in the Selection then
+ * the search will start at the first or last base (depending on value of
+ * the next parameter), otherwise the search will start at the Selection.
+ * @param search_backwards If true the search will move from last base to
+ * first base, otherwise first to last.
+ * @return The range that matches the pattern or null if there is no match.
+ **/
+ public static MarkerRange findBasePattern (final BasePattern pattern,
+ final EntryGroup entry_group,
+ final Selection selection,
+ final boolean start_at_end,
+ final boolean search_backwards) {
+ // if start_at_end is false we want to start the search at the selection
+ final Marker selection_base = selection.getLowestBaseOfSelection ();
+
+ final Marker start_position;
+
+ if (start_at_end || selection_base == null) {
+ // null means start the search from the beginning
+ start_position = null;
+ } else {
+ start_position = selection_base;
+ }
+
+ final MarkerRange match_range =
+ pattern.findMatch (entry_group.getBases (),
+ start_position,
+ entry_group.getSequenceLength (),
+ search_backwards);
+
+ if (match_range == null) {
+ return null;
+ } else {
+ return match_range;
+ }
+ }
+
+ /**
+ * This method finds the given amino acid seqeunce, sets the selection to
+ * the matching bases and then sends a GotoEvent to all the GotoEvent
+ * listeners that will make the first base of the match visible.
+ * @param sequence This is the pattern to search for.
+ * @param entry_group The EntryGroup to search.
+ * @param selection The current selection.
+ * @param start_at_end If true or if there is nothing in the Selection then
+ * the search will start at first or last base (depending on value of the
+ * next parameter), otherwise the search will start at the Selection.
+ * @param search_backwards If true the search will move from last base to
+ * first base, otherwise first to last.
+ * @return The range that matches the pattern or null if there is no match.
+ **/
+ public static MarkerRange findAminoAcidSequence (final AminoAcidSequence
+ sequence,
+ final EntryGroup
+ entry_group,
+ final Selection selection,
+ final boolean start_at_end,
+ final boolean
+ search_backwards) {
+ // if start_at_end is false we want to start the search at the selection
+ final Marker selection_base = selection.getLowestBaseOfSelection ();
+
+ final Marker start_position;
+
+ if (start_at_end || selection_base == null) {
+ // null means start the search from the beginning
+ start_position = null;
+ } else {
+ start_position = selection_base;
+ }
+
+ final MarkerRange match_range;
+
+ if (search_backwards) {
+ match_range = sequence.findMatch (entry_group.getBases (),
+ start_position,
+ true);
+ } else {
+ match_range = sequence.findMatch (entry_group.getBases (),
+ start_position,
+ false);
+ }
+
+ if (match_range == null) {
+ return null;
+ } else {
+ return match_range;
+ }
+ }
+
+ /**
+ * This method will perform the selected goto function.
+ **/
+ private void doGoto () {
+ if (goto_base_button.isSelected ()) {
+ doGotoBase ();
+ return;
+ }
+
+ if (goto_base_pattern_button.isSelected ()) {
+ doGotoBasePattern ();
+ return;
+ }
+
+ if (goto_aa_pattern_button.isSelected ()) {
+ doGotoAAPattern ();
+ return;
+ }
+
+ if (goto_gene_name_button.isSelected ()) {
+ final StringVector qualifiers_to_search = new StringVector ();
+ qualifiers_to_search.add (Options.getOptions ().getAllGeneNames ());
+
+ doGotoQualifierValue (qualifiers_to_search,
+ goto_gene_name_textfield.getText ().trim ());
+ return;
+ }
+
+ if (goto_qualifier_button.isSelected ()) {
+ doGotoQualifierValue (null, goto_qualifier_textfield.getText ().trim ());
+ return;
+ }
+
+ if (goto_key_button.isSelected ()) {
+ doGotoKey ();
+ return;
+ }
+ }
+
+ /**
+ * Clear all the JTextField components.
+ **/
+ private void clear () {
+ goto_base_text.setText ("");
+ goto_base_pattern_text.setText ("");
+ goto_aa_pattern_text.setText ("");
+ goto_qualifier_textfield.setText ("");
+ goto_gene_name_textfield.setText ("");
+ goto_feature_key_textfield.setText ("");
+ }
+
+ /**
+ * Show a message dialog saying that the search text field is empty.
+ **/
+ private void searchTextEmptyError () {
+ new MessageDialog (this, "You have not entered a value to search for");
+ }
+
+ /**
+ * Go to the base that the user typed in to the goto_base_text TextArea.
+ **/
+ private void doGotoBase () {
+ final String number_string = goto_base_text.getText ().trim ();
+
+ if (number_string.length () == 0) {
+ new MessageDialog (this, "you have not entered a number to go to");
+ return;
+ }
+
+ try {
+ final int destination_base =
+ Integer.valueOf (number_string).intValue ();
+
+ final MarkerRange destination_range =
+ goto_event_source.gotoBase (destination_base);
+
+ if (destination_range == null) {
+ new MessageDialog (this,
+ "the base is out of range for this sequence");
+ } else {
+ // success select that base
+ getSelection ().setMarkerRange (destination_range);
+ }
+ } catch (NumberFormatException e) {
+ new MessageDialog (this, "Cannot understand this number: " +
+ goto_base_text.getText ());
+ }
+ }
+
+ /**
+ * Go to the base pattern that the user typed in to the
+ * goto_base_pattern_text TextArea.
+ **/
+ private void doGotoBasePattern () {
+ try {
+ final String pattern_string =
+ goto_base_pattern_text.getText ().trim ();
+
+ if (pattern_string.length () == 0) {
+ new MessageDialog (this, "you have not entered a pattern to go to");
+ return;
+ }
+
+ final BasePattern pattern = new BasePattern (pattern_string);
+
+ final boolean start_at_an_end = start_at_an_end_button.isSelected ();
+
+ start_at_selection_button.setSelected (true);
+
+ final MarkerRange match_range =
+ findBasePattern (pattern,
+ getEntryGroup (),
+ getSelection (),
+ start_at_an_end,
+ search_backward_button.isSelected ());
+
+ if (match_range == null) {
+ new MessageDialog (this, "reached the end of sequence");
+ } else {
+ getSelection ().setMarkerRange (match_range);
+
+ final Marker first_selected_base =
+ getSelection ().getLowestBaseOfSelection ();
+
+ goto_event_source.gotoBase (first_selected_base);
+ }
+ } catch (BasePatternFormatException e) {
+ new MessageDialog (this,
+ "Illegal base pattern: " +
+ goto_base_pattern_text.getText ());
+ }
+ }
+
+ /**
+ * Find the amino acid pattern that the user typed in to the
+ * goto_aa_pattern_text TextArea.
+ **/
+ private void doGotoAAPattern () {
+ final String pattern_string =
+ goto_aa_pattern_text.getText ().trim ();
+
+ if (pattern_string.length () == 0) {
+ new MessageDialog (this, "you have not entered a pattern to go to");
+ return;
+ }
+
+ final AminoAcidSequence pattern = new AminoAcidSequence (pattern_string);
+
+ final boolean start_at_an_end = start_at_an_end_button.isSelected ();
+
+ start_at_selection_button.setSelected (true);
+
+ final boolean search_backwards = search_backward_button.isSelected ();
+
+ final MarkerRange match_range =
+ findAminoAcidSequence (pattern,
+ getEntryGroup (),
+ getSelection (),
+ start_at_an_end,
+ search_backwards);
+
+ if (match_range == null) {
+ new MessageDialog (this, "reached the end of sequence");
+ } else {
+ getSelection ().setMarkerRange (match_range);
+
+ goto_event_source.gotoBase (getSelection ().getLowestBaseOfSelection ());
+ }
+ }
+
+ /**
+ * Select the next feature that contains the text given by the user in the
+ * goto_qualifier_textfield TextArea.
+ **/
+ private void doGotoQualifierValue (final StringVector qualifiers_to_search,
+ final String search_text) {
+ if (search_text.equals ("")) {
+ searchTextEmptyError ();
+ return;
+ }
+
+ final FeatureVector selected_features =
+ getSelection ().getAllFeatures ();
+
+ final int index;
+
+ if (selected_features.size () == 0 ||
+ start_at_an_end_button.isSelected ()) {
+ index = -1;
+ } else {
+ index = getEntryGroup ().indexOf (selected_features.elementAt (0));
+ }
+
+ final int first_search_feature_index;
+
+ Feature found_feature = null;
+
+ if (search_backward_button.isSelected ()) {
+ if (index == -1) {
+ // nothing was selected so start the search at the first feature
+ first_search_feature_index =
+ getEntryGroup ().getAllFeaturesCount () - 1;
+ } else {
+ first_search_feature_index = index - 1;
+ }
+
+ for (int i = first_search_feature_index ; i >= 0 ; --i) {
+ final Feature this_feature = getEntryGroup ().featureAt (i);
+
+ if (this_feature.containsText (search_text,
+ ignore_case_button.isSelected (),
+ partial_match_button.isSelected (),
+ qualifiers_to_search)) {
+ found_feature = this_feature;
+ break;
+ }
+ }
+ } else {
+ if (index == -1) {
+ // nothing was selected so start the search at the first feature
+ first_search_feature_index = 0;
+ } else {
+ first_search_feature_index = index + 1;
+ }
+
+ for (int i = first_search_feature_index ;
+ i < getEntryGroup ().getAllFeaturesCount () ;
+ ++i) {
+ final Feature this_feature = getEntryGroup ().featureAt (i);
+
+ if (this_feature.containsText (search_text,
+ ignore_case_button.isSelected (),
+ partial_match_button.isSelected (),
+ qualifiers_to_search)) {
+
+ found_feature = this_feature;
+ break;
+ }
+ }
+ }
+
+ if (found_feature == null) {
+ getSelection ().clear ();
+ start_at_an_end_button.setSelected (true);
+
+ new MessageDialog (this, "text not found");
+ } else {
+ getSelection ().set (found_feature);
+ goto_event_source.gotoBase (getSelection ().getLowestBaseOfSelection ());
+ start_at_selection_button.setSelected (true);
+ }
+ }
+
+ /**
+ * Select the next feature that has the key given by the user in the
+ * goto_feature_key_textfield TextArea.
+ **/
+ private void doGotoKey () {
+ final FeatureVector selected_features =
+ getSelection ().getAllFeatures ();
+
+ final int index;
+
+ if (selected_features.size () == 0 ||
+ start_at_an_end_button.isSelected ()) {
+ index = -1;
+ } else {
+ index = getEntryGroup ().indexOf (selected_features.elementAt (0));
+ }
+
+ final int first_search_feature_index;
+
+ final String search_key_string =
+ goto_feature_key_textfield.getText ().trim ();
+
+ if (search_key_string.equals ("")) {
+ searchTextEmptyError ();
+ return;
+ }
+
+ Feature found_feature = null;
+
+ if (search_backward_button.isSelected ()) {
+ if (index == -1) {
+ // nothing was selected so start the search at the first feature
+ first_search_feature_index =
+ getEntryGroup ().getAllFeaturesCount () - 1;
+ } else {
+ first_search_feature_index = index - 1;
+ }
+
+ for (int i = first_search_feature_index ; i >= 0 ; --i) {
+ final Feature this_feature = getEntryGroup ().featureAt (i);
+
+ if (keyMatches (this_feature, search_key_string)) {
+ found_feature = this_feature;
+ break;
+ }
+ }
+ } else {
+ if (index == -1) {
+ // nothing was selected so start the search at the first feature
+ first_search_feature_index = 0;
+ } else {
+ first_search_feature_index = index + 1;
+ }
+
+ for (int i = first_search_feature_index ;
+ i < getEntryGroup ().getAllFeaturesCount () ;
+ ++i) {
+ final Feature this_feature = getEntryGroup ().featureAt (i);
+
+ if (keyMatches (this_feature, search_key_string)) {
+ found_feature = this_feature;
+ break;
+ }
+ }
+ }
+
+ if (found_feature == null) {
+ getSelection ().clear ();
+ start_at_an_end_button.setSelected (true);
+
+ new MessageDialog (this, "key not found");
+ } else {
+ getSelection ().set (found_feature);
+ goto_event_source.gotoBase (getSelection ().getLowestBaseOfSelection ());
+ start_at_selection_button.setSelected (true);
+ }
+ }
+
+ /**
+ * Returns true if and only if the given feature has search_key_string as
+ * it's Key.
+ **/
+ public boolean keyMatches (final Feature test_feature,
+ final String search_key_string) {
+ final String feature_key_string;
+
+ if (ignore_case_button.isSelected ()) {
+ feature_key_string = test_feature.getKey ().toString ().toLowerCase ();
+ } else {
+ feature_key_string = test_feature.getKey ().toString ();
+ }
+
+ if (feature_key_string.equals (search_key_string.toLowerCase ())) {
+ return true;
+ } else {
+ return false;
+ }
+ }
+
+ /**
+ * Return the Selection object that was passed to the constructor.
+ **/
+ private Selection getSelection () {
+ return selection;
+ }
+
+ /**
+ * Return the EntryGroup object that was passed to the constructor.
+ **/
+ private EntryGroup getEntryGroup () {
+ return entry_group;
+ }
+
+ /**
+ * The JRadioButton that selects the goto base function.
+ **/
+ final JRadioButton goto_base_button;
+
+ /**
+ * The JRadioButton that selects the goto base pattern function.
+ **/
+ final JRadioButton goto_base_pattern_button;
+
+ /**
+ * The JRadioButton that selects the find amino acid sequence function.
+ **/
+ final JRadioButton goto_aa_pattern_button;
+
+ /**
+ * The JRadioButton that selects the goto feature qualifier value function.
+ **/
+ final JRadioButton goto_qualifier_button;
+
+ /**
+ * The JRadioButton that selects the goto gene name function.
+ **/
+ final JRadioButton goto_gene_name_button;
+
+ /**
+ * The JRadioButton that selects the goto feature key function.
+ **/
+ final JRadioButton goto_key_button;
+
+ /**
+ * This contains the pattern to search for if the user has selected the
+ * goto base function.
+ **/
+ final JTextField goto_base_text;
+
+ /**
+ * This contains the pattern to search for if the user has selected the
+ * goto base pattern function.
+ **/
+ final JTextField goto_base_pattern_text;
+
+ /**
+ * This contains the pattern to search for if the user has selected the
+ * goto amino acid function.
+ **/
+ final JTextField goto_aa_pattern_text;
+
+ /**
+ * This contains the pattern to search for if the user has selected the
+ * goto qualifier value function.
+ **/
+ final JTextField goto_qualifier_textfield;
+
+ /**
+ * This contains the pattern to search for if the user has selected the
+ * goto gene name function.
+ **/
+ final JTextField goto_gene_name_textfield;
+
+ /**
+ * This contains the key to search for if the user has selected the
+ * goto key function.
+ **/
+ final JTextField goto_feature_key_textfield;
+
+ /**
+ * The user selects this JRadioButton if the search should start at first/last
+ * base or first/last feature (depending on the search type).
+ **/
+ JRadioButton start_at_an_end_button;
+
+ /**
+ * The user selects this JRadioButton if the search should start at the
+ * position of the current selection.
+ **/
+ final JRadioButton start_at_selection_button;
+
+ /**
+ * If checked the search will go backwards.
+ **/
+ final JRadioButton search_backward_button;
+
+ /**
+ * If checked the search will ignore the case of the query and subject.
+ **/
+ final JRadioButton ignore_case_button;
+
+ /**
+ * If checked the search text is allowed to match a substring of a
+ * qualifier value.
+ **/
+ final JRadioButton partial_match_button;
+
+ /**
+ * The GotoEventSource object that was passed to the constructor.
+ **/
+ final GotoEventSource goto_event_source;
+
+ /**
+ * The EntryGroup object that was passed to the constructor.
+ **/
+ final EntryGroup entry_group;
+
+ /**
+ * This is the Selection that was passed to the constructor.
+ **/
+ final private Selection selection;
+}
diff --git a/uk/ac/sanger/artemis/components/Plot.java b/uk/ac/sanger/artemis/components/Plot.java
new file mode 100644
index 000000000..8ee213ebe
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/Plot.java
@@ -0,0 +1,723 @@
+/* Plot.java
+ *
+ * created: Thu Dec 17 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/Plot.java,v 1.1 2004-06-09 09:47:11 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.plot.*;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * This class implements a simple plot component.
+ *
+ * @author Kim Rutherford
+ * @version $Id: Plot.java,v 1.1 2004-06-09 09:47:11 tjc Exp $
+ **/
+
+public abstract class Plot extends JPanel {
+ /**
+ * Create a new plot component.
+ * @param algorithm The object that will generate the values we plot in
+ * this component.
+ * @param draw_scale If true then a scale line will be drawn at the bottom
+ * of the graph.
+ **/
+ public Plot (Algorithm algorithm, boolean draw_scale) {
+ this.algorithm = algorithm;
+ this.draw_scale = draw_scale;
+
+ final Font font = Options.getOptions ().getFont ();
+
+ setFont (font);
+ FontMetrics fm = getFontMetrics (font);
+ font_height = fm.getHeight ();
+
+ setLayout(new BorderLayout ());
+
+ final int MAX_WINDOW;
+
+ if (getAlgorithm ().getDefaultMaxWindowSize () != null) {
+ MAX_WINDOW = getAlgorithm ().getDefaultMaxWindowSize ().intValue ();
+ } else {
+ MAX_WINDOW = 500;
+ }
+
+ final int MIN_WINDOW;
+
+ if (getAlgorithm ().getDefaultMinWindowSize () != null) {
+ MIN_WINDOW = getAlgorithm ().getDefaultMinWindowSize ().intValue ();
+ } else {
+ MIN_WINDOW = 5;
+ }
+
+ final int START_WINDOW;
+
+ if (getAlgorithm ().getDefaultWindowSize () == null) {
+ START_WINDOW = 10;
+ } else {
+ START_WINDOW = getAlgorithm ().getDefaultWindowSize ().intValue ();
+ }
+
+ window_changer = new JScrollBar (Scrollbar.VERTICAL);
+ window_changer.setValues (START_WINDOW, SCROLL_NOB_SIZE,
+ MIN_WINDOW, MAX_WINDOW + SCROLL_NOB_SIZE);
+ if (MAX_WINDOW >= 50) {
+ window_changer.setBlockIncrement (MAX_WINDOW/50);
+ } else {
+ window_changer.setBlockIncrement (1);
+ }
+
+ window_changer.addAdjustmentListener (new AdjustmentListener () {
+ public void adjustmentValueChanged(AdjustmentEvent e) {
+ recalculate_flag = true;
+ repaintCanvas ();
+ }
+ });
+
+ addComponentListener (new ComponentAdapter () {
+ public void componentShown(ComponentEvent e) {
+ recalculate_flag = true;
+ repaintCanvas ();
+ }
+ });
+
+ add (window_changer, "East");
+
+ createCanvas ();
+
+ getCanvas ().setBackground (Color.white);
+ }
+
+ final int SCROLL_NOB_SIZE = 10;
+
+ /**
+ * Return the algorithm that was passed to the constructor.
+ **/
+ public Algorithm getAlgorithm () {
+ return algorithm;
+ }
+
+ /**
+ * Return the current value of the window size, as set by the
+ * window_changer scrollbar.
+ **/
+ public int getWindowSize () {
+ return window_changer.getValue ();
+ }
+
+ /**
+ * Create the canvas object for this BasePlot and add it to the component.
+ **/
+ private void createCanvas () {
+ canvas = new JComponent () {
+ /**
+ * Set the offscreen buffer to null as part of invalidation.
+ **/
+ public void invalidate() {
+ super.invalidate();
+ offscreen = null;
+ }
+
+ /**
+ * Override update to *not* erase the background before painting
+ */
+ public void update(Graphics g) {
+ paint(g);
+ }
+
+ /**
+ * Paint the canvas.
+ */
+ public void paint(Graphics g) {
+ paintCanvas (g);
+ }
+ };
+
+ final MouseListener mouse_listener =
+ new MouseAdapter () {
+ /**
+ * Listen for mouse press events so that we can do a popup menu and a
+ * crosshair.
+ **/
+ public void mousePressed (MouseEvent event) {
+ if (event.isPopupTrigger () || event.isMetaDown ()) {
+ final JComponent parent = (JComponent) event.getSource ();
+
+ final JPopupMenu popup = new JPopupMenu ("Plot Options");
+
+ final JCheckBoxMenuItem scaling_toggle =
+ new JCheckBoxMenuItem ("Scaling");
+
+ scaling_toggle.setState (getAlgorithm ().scalingFlag ());
+ scaling_toggle.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent _) {
+ getAlgorithm ().setScalingFlag (scaling_toggle.getState ());
+ recalculate_flag = true;
+ repaintCanvas ();
+ }
+ });
+
+ popup.add (scaling_toggle);
+
+ popup.addSeparator ();
+
+ final JMenuItem max_window_size =
+ new JMenuItem ("Maximum Window Size:");
+
+ popup.add (max_window_size);
+
+ final int [] window_sizes = {
+ 100, 200, 500, 1000, 2000, 5000, 10000, 20000, 50000, 100000,
+ 200000, 500000, 1000000
+ };
+
+ for (int i = 0 ; i < window_sizes.length ; ++i) {
+ final int size = i;
+
+ JMenuItem window_size_item = new JMenuItem (" " + window_sizes[i]);
+
+ window_size_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent _) {
+ final int new_maximum = window_sizes[size];
+ if (new_maximum > window_changer.getMinimum ()) {
+ window_changer.setMaximum (new_maximum + SCROLL_NOB_SIZE);
+ recalculate_flag = true;
+ repaintCanvas ();
+ }
+ }
+ });
+
+ popup.add (window_size_item);
+ }
+
+ parent.add (popup);
+
+ popup.show (parent, event.getX (), event.getY ());
+ } else {
+ final int point_x = event.getPoint ().x;
+ final int point_y = event.getPoint ().y;
+
+ if (point_y > getLabelHeight ()) {
+ cross_hair_position = point_x;
+ drag_start_position = point_x;
+ } else {
+ cancelCrossHairs ();
+ }
+
+ if (event.getClickCount () == 2) {
+ fireDoubleClickEvent ();
+ } else {
+ fireClickEvent ();
+ }
+
+ repaintCanvas ();
+ }
+ }
+ };
+
+ canvas.addMouseListener (mouse_listener);
+
+ final MouseMotionListener mouse_motion_listener =
+ new MouseMotionAdapter () {
+
+ public void mouseDragged (MouseEvent event) {
+ final int point_x = event.getPoint ().x;
+ final int point_y = event.getPoint ().y;
+
+ if (point_y > getLabelHeight ()) {
+ cross_hair_position = point_x;
+ } else {
+ cancelCrossHairs ();
+ }
+
+ fireDragEvent ();
+
+ repaintCanvas ();
+ }
+ };
+
+ canvas.addMouseMotionListener (mouse_motion_listener);
+
+ add (canvas, "Center");
+ }
+
+ /**
+ * Call mouseClick () on each of the PlotMouseListener objects in the
+ * listener list.
+ **/
+ private void fireClickEvent () {
+ for (int i = 0 ; i < listener_list.size () ; ++i) {
+ final PlotMouseListener listener =
+ (PlotMouseListener) listener_list.elementAt (i);
+ listener.mouseClick (getPointPosition (cross_hair_position));
+ }
+ }
+
+ /**
+ * Call mouseDragged () on each of the PlotMouseListener objects in the
+ * listener list.
+ **/
+ private void fireDragEvent () {
+ for (int i = 0 ; i < listener_list.size () ; ++i) {
+ final PlotMouseListener listener =
+ (PlotMouseListener) listener_list.elementAt (i);
+ listener.mouseDrag (getPointPosition (drag_start_position),
+ getPointPosition (cross_hair_position));
+ }
+ }
+
+ /**
+ * Call mouseDoubleClick () on each of the PlotMouseListener objects in the
+ * listener list.
+ **/
+ private void fireDoubleClickEvent () {
+ for (int i = 0 ; i < listener_list.size () ; ++i) {
+ final PlotMouseListener listener =
+ (PlotMouseListener) listener_list.elementAt (i);
+ listener.mouseDoubleClick (getPointPosition (cross_hair_position));
+ }
+ }
+
+ /**
+ * Adds the given listener to receive mouse events from this object.
+ * @param l the listener.
+ **/
+ public void addPlotMouseListener (final PlotMouseListener listener) {
+ listener_list.addElement (listener);
+ }
+
+ /**
+ * Removes the given listener from the list of those objects that receive
+ * mouse events from this object.
+ * @param l the listener.
+ **/
+ public void removePlotMouseListener (final PlotMouseListener listener) {
+ listener_list.removeElement (listener);
+ }
+
+ /**
+ * The main paint function for the canvas. An off screen image used for
+ * double buffering when drawing the canvas.
+ * @param g The Graphics object of the canvas.
+ **/
+ private void paintCanvas (final Graphics g) {
+ if (!isVisible ()) {
+ return;
+ }
+
+ final int canvas_width = canvas.getSize ().width;
+ final int canvas_height = canvas.getSize ().height;
+
+ if (canvas_height <= 0 || canvas_width <= 0) {
+ // there is no point painting a zero width canvas
+ return;
+ }
+
+ if (offscreen == null) {
+ offscreen = createImage (canvas_width,
+ canvas_height);
+ }
+
+ Graphics og = offscreen.getGraphics ();
+ og.setClip (0, 0, canvas_width, canvas_height);
+
+ og.setColor (new Color (240, 240, 240));
+
+ og.fillRect (0, 0, canvas.getSize ().width, canvas.getSize ().height);
+
+ // Redraw the graph on the canvas using the algorithm from the
+ // constructor.
+ drawMultiValueGraph (og);
+
+ drawLabels (og);
+
+ g.drawImage (offscreen, 0, 0, null);
+ og.dispose ();
+ }
+
+ /**
+ * Return the canvas x position of the last click or -1 if the user hasn't
+ * clicked anywhere yet.
+ **/
+ protected int getCrossHairPosition () {
+ if (cross_hair_position >= getCanvas ().getSize ().width) {
+ return -1;
+ } else {
+ return cross_hair_position;
+ }
+ }
+
+ /**
+ * Force this component to stop drawing crosshairs.
+ **/
+ protected void cancelCrossHairs () {
+ cross_hair_position = -1;
+ drag_start_position = -1;
+ }
+
+ // the minimum distance in pixels between the labels
+ private final static int MINIMUM_LABEL_SPACING = 50;
+
+ /**
+ * Draw the scale line at the bottom of the graph.
+ * @param start The base on the left
+ * @param end The base on the right
+ **/
+ protected void drawScaleLine (final Graphics g,
+ final int start, final int end) {
+
+ final int canvas_width = canvas.getSize ().width;
+ final int canvas_height = canvas.getSize ().height;
+
+ final int scale_number_y_pos = canvas_height - 1;
+
+ final float bases_per_pixel = 1.0F;
+
+ // set the spacing so that the labels are at multiples of 10
+ final int base_label_spacing = MINIMUM_LABEL_SPACING;
+
+ final int label_spacing = (int)(base_label_spacing / bases_per_pixel);
+
+ final int possible_index_of_first_label = start / base_label_spacing;
+
+ final int index_of_first_label;
+
+ if (possible_index_of_first_label == 0) {
+ index_of_first_label = 1;
+ } else {
+ index_of_first_label = possible_index_of_first_label;
+ }
+
+ final int index_of_last_label = end / base_label_spacing;
+
+ for (int i = index_of_first_label ;
+ i <= index_of_last_label ;
+ ++i) {
+ final String label_string =
+ String.valueOf ((int)(i * base_label_spacing));
+
+ final int scale_number_x_pos =
+ (int) ((i * base_label_spacing - start) / bases_per_pixel);
+
+ g.drawString (label_string,
+ scale_number_x_pos + 2,
+ scale_number_y_pos);
+
+ g.drawLine (scale_number_x_pos, canvas_height - getScaleHeight () / 2,
+ scale_number_x_pos, canvas_height - getScaleHeight ());
+ }
+ }
+
+ /**
+ * Plot the given points onto a Graphics object.
+ * @param min_value The minimum of the plot_values.
+ * @param max_value The maximum of the plot_values.
+ * @param step_size The current step size for this algorithm. This is
+ * never greater than window_size.
+ * @param window_size The window size used in calculating plot_values.
+ * @param total_unit_count The maximum number of residues/bases we can
+ * show. This is used to draw the scale line and to calculate the
+ * distance (in pixels) between plot points.
+ * @param start_position The distance from the edge of the canvas (measured
+ * in residues/bases) to start drawing the plot.
+ * @param plot_values The values to plot.
+ **/
+ protected void drawPoints (final Graphics g,
+ final float min_value, final float max_value,
+ final int step_size, final int window_size,
+ final int total_unit_count,
+ final int start_position,
+ final float [] plot_values) {
+ final float residues_per_pixel =
+ (float) total_unit_count / canvas.getSize ().width;
+
+ // this is the height of the graph (slightly smaller than the canvas for
+ // ease of viewing).
+ final int graph_height = canvas.getSize ().height -
+ getLabelHeight () - // leave room for the algorithm name
+ getScaleHeight () - // leave room for the scale
+ 2;
+
+ if (graph_height < 5) {
+ // too small to draw
+ return;
+ }
+
+ final int number_of_values = plot_values.length;
+
+ for (int i = 0 ; i < number_of_values - 1 ; ++i) {
+ final int start_residue =
+ window_size / 2 + i * step_size + start_position;
+ final int end_residue =
+ start_residue + step_size;
+
+ final int start_x = (int) (start_residue / residues_per_pixel);
+ final int end_x = (int) (end_residue / residues_per_pixel);
+
+ // this is a number between 0.0 and 1.0
+ final float scaled_start_value =
+ (plot_values[i] - min_value) / (max_value - min_value);
+ final int start_y =
+ graph_height - (int) (scaled_start_value * graph_height) +
+ getLabelHeight () + 1;
+
+ final float scaled_end_value =
+ (plot_values[i+1] - min_value) / (max_value - min_value);
+ final int end_y =
+ graph_height - (int) (scaled_end_value * graph_height) +
+ getLabelHeight () + 1;
+
+ g.drawLine (start_x, start_y, end_x, end_y);
+ }
+ }
+
+ /**
+ * Redraw the graph on the canvas using the algorithm.
+ * @param g The object to draw into.
+ **/
+ protected abstract void drawMultiValueGraph (final Graphics g);
+
+ /**
+ * Draw a line representing the average of the algorithm over the feature.
+ * @param g The object to draw into.
+ * @param min_value The minimum value of the function for the range we are
+ * viewing
+ * @param max_value The maximum value of the function for the range we are
+ * viewing
+ **/
+ protected void drawGlobalAverage (final Graphics g,
+ final float min_value,
+ final float max_value) {
+ final Float average = getAlgorithm ().getAverage ();
+
+ if (average != null) {
+ g.setColor (Color.gray);
+
+ // this is the height of the graph (slightly smaller than the canvas for
+ // ease of viewing).
+ final int graph_height =
+ canvas.getSize ().height - getFontHeight ();
+
+ // this is a number between 0.0 and 1.0
+ final float scaled_average =
+ (average.floatValue () - min_value) / (max_value - min_value);
+
+ final int position =
+ graph_height -
+ (int) (scaled_average * graph_height) +
+ getFontHeight () + 1;
+
+ g.drawLine (0, position,
+ canvas.getSize ().width, position);
+
+ final FontMetrics fm = g.getFontMetrics ();
+
+ final int canvas_width = canvas.getSize ().width;
+
+ final String average_string =
+ String.valueOf (Math.round (average.floatValue () * 100.0) / 100.0);
+
+ g.drawString (average_string,
+ canvas_width - fm.stringWidth (average_string) - 1,
+ position);
+ }
+ }
+
+ /**
+ * Put the algorithm name in the top left corner of the canvas and the
+ * window size in the bottom left.
+ * @param g The object to draw into.
+ **/
+ private void drawLabels (final Graphics g) {
+ g.setColor (Color.black);
+ g.drawString (getAlgorithm ().getAlgorithmName () +
+ " Window size: " +
+ String.valueOf (window_changer.getValue ()),
+ 2,
+ font_height);
+ }
+
+ /**
+ * The method converts the min_value and max_value to String objects and
+ * then draws them onto the canvas. The min_value is drawn at the bottom
+ * right, max_value at the top right.
+ **/
+ protected void drawMinMax (final Graphics g,
+ final float min_value, final float max_value) {
+ g.setColor (Color.black);
+
+ final int canvas_width = canvas.getSize ().width;
+ final int canvas_height = canvas.getSize ().height;
+
+ g.drawLine (0, canvas_height - getScaleHeight (),
+ canvas_width, canvas_height - getScaleHeight ());
+
+ g.drawLine (0, getLabelHeight (),
+ canvas_width, getLabelHeight ());
+
+ final FontMetrics fm = g.getFontMetrics ();
+
+ final String min_string =
+ String.valueOf (((int) (min_value * 100)) / 100.0);
+
+ g.drawString (min_string,
+ canvas_width - fm.stringWidth (min_string) - 1,
+ canvas_height - 1 - getScaleHeight ());
+
+ final String max_string =
+ String.valueOf (((int) (max_value * 100)) / 100.0);
+
+ g.drawString (max_string,
+ canvas_width - fm.stringWidth (max_string) - 1,
+ 1 + getFontHeight () * 2);
+ }
+
+ /**
+ * Draw a vertical line at the given position.
+ * @param label The label to use on the crosshair
+ * @param label_pos The position on the line at which the label should be
+ * drawn (0 is nearest the top).
+ **/
+ protected void drawCrossHair (final Graphics g, final int x_position,
+ final String label, final int label_pos) {
+ if (x_position >= 0) {
+ g.drawLine (x_position, getLabelHeight (),
+ x_position, canvas.getSize ().height);
+
+ g.drawString (label, x_position + 2,
+ getFontHeight () * (2 + label_pos) + 2);
+ }
+ }
+
+ /**
+ * Return the JComponent of this Plot.
+ **/
+ protected JComponent getCanvas () {
+ return canvas;
+ }
+
+ /**
+ * Call repaint () on the canvas object.
+ **/
+ protected void repaintCanvas () {
+ canvas.repaint ();
+ }
+
+ /**
+ * Recalculate the values all the state that is used for drawing the plot
+ **/
+ protected abstract void recalculateValues ();
+
+ /**
+ * Get the position in the Feature or Sequence of the given x canvas
+ * position. This is the label used when the user clicks the mouse in on
+ * the canvas (see drawCrossHair ()).
+ **/
+ protected abstract int getPointPosition (final int canvas_x_position);
+
+ /**
+ * Return the amount of vertical space (in pixels) to use for the scale.
+ **/
+ private int getScaleHeight () {
+ if (draw_scale) {
+ return getFontHeight () + 2;
+ } else {
+ return 0;
+ }
+ }
+
+ /**
+ * Return the height in algorithm name and label line (returns the font
+ * height plus a small amount).
+ **/
+ private int getLabelHeight () {
+ return getFontHeight () + 2;
+ }
+
+ /**
+ * Return the height in pixels of the current font.
+ **/
+ private int getFontHeight () {
+ return font_height;
+ }
+
+ /**
+ * The drawing area for this component.
+ **/
+ private JComponent canvas = null;
+
+ /**
+ * A scroll bar for changing the window size.
+ **/
+ private JScrollBar window_changer = null;
+
+ /**
+ * The height of the font used in this component.
+ **/
+ private int font_height;
+
+ /**
+ * Off screen image used for double buffering when drawing the canvas.
+ **/
+ private Image offscreen;
+
+ /**
+ * The object that will generate the value we plot in this component.
+ **/
+ private Algorithm algorithm;
+
+ /**
+ * If true then a scale line will be drawn at the bottom of the graph when
+ * drawScaleLine () is called.
+ **/
+ private boolean draw_scale;
+
+ /**
+ * Set to true if drawMultiValueGraph () should call recalculateValues ().
+ * It is reset to false by recalculateValues ().
+ **/
+ protected boolean recalculate_flag = true;
+
+ /**
+ * The x position of the last click or -1 if the user hasn't clicked
+ * anywhere yet or the user clicked outside the graph.
+ **/
+ private int cross_hair_position = -1;
+
+ /**
+ * The x position of the start of the last mouse drag or -1 if the user
+ * hasn't clicked anywhere yet or the user clicked outside the graph.
+ **/
+ private int drag_start_position = -1;
+
+ /**
+ * A vector of those objects listening for PlotMouse events.
+ **/
+ final private java.util.Vector listener_list = new java.util.Vector ();
+}
diff --git a/uk/ac/sanger/artemis/components/PlotMouseListener.java b/uk/ac/sanger/artemis/components/PlotMouseListener.java
new file mode 100644
index 000000000..50abff74b
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/PlotMouseListener.java
@@ -0,0 +1,64 @@
+/* PlotMouseListener.java
+ *
+ * created: Wed Sep 13 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/PlotMouseListener.java,v 1.1 2004-06-09 09:47:12 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+/**
+ * Implemented by those objects that need to mouse events from a Plot object.
+ * The coordinates of the mouse click are translated to base/aa positions for
+ * ease of use.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: PlotMouseListener.java,v 1.1 2004-06-09 09:47:12 tjc Exp $
+ **/
+
+public interface PlotMouseListener {
+ /**
+ * Called when the user clicks somewhere on the plot canvas.
+ * @param position the base/amino acid position of the click. This is
+ * -1 if and only if the click was outside the graph (eg. in the label at
+ * the top)
+ **/
+ void mouseClick (final int position);
+
+ /**
+ * Called when the user drags the mouse over the plot.
+ * @param drag_start_position The base/amnino acid position where the drag
+ * started or -1 if the drag was started outside the graph.
+ * @param current_position the base/amino acid position of the click.
+ * This is -1 if and only if the user has dragged the mouse out of
+ * the graph (eg. in the label at the top)
+ **/
+ void mouseDrag (final int drag_start_position,
+ final int current_position);
+
+ /**
+ * Called when the user double-clicks somewhere on the plot.
+ * @param position the base/amino acid position of the click. This is
+ * -1 if and only if the click was outside the graph (eg. in the label at
+ * the top)
+ **/
+ void mouseDoubleClick (final int position);
+}
diff --git a/uk/ac/sanger/artemis/components/ProcessWatcher.java b/uk/ac/sanger/artemis/components/ProcessWatcher.java
new file mode 100644
index 000000000..be0136492
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ProcessWatcher.java
@@ -0,0 +1,194 @@
+/* ProcessWatcher.java
+ *
+ * created: Mon Oct 4 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ProcessWatcher.java,v 1.1 2004-06-09 09:47:13 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.Logger;
+
+import java.io.*;
+
+/**
+ * Objects of this class watch a Process object and then display a
+ * MessageFrame window when the process finishes.
+ *
+ * @author Kim Rutherford
+ * @version $Id: ProcessWatcher.java,v 1.1 2004-06-09 09:47:13 tjc Exp $
+ **/
+
+public class ProcessWatcher
+ implements Runnable {
+ /**
+ * Create a new ProcessWatcher object for the given Process. When the
+ * process finishes a MessageFrame will alert the user and all
+ * ProcessWatcherListeners will be informed.
+ * @param process The Process to watch.
+ * @param name The name of the process to watch.
+ **/
+ public ProcessWatcher (final Process process, final String name) {
+ this (process, name, true);
+ }
+
+ /**
+ * Create a new ProcessWatcher object for the given Process. When the
+ * process finishes a MessageFrame will alert the user if and only if the
+ * alert_user argument is true and all ProcessWatcherListeners will be
+ * informed.
+ * @param process The Process to watch.
+ * @param name The name of the process to watch.
+ * @param alert_user The user will be informed when a process ends if and
+ * only if this is true.
+ **/
+ public ProcessWatcher (final Process process, final String name,
+ final boolean alert_user) {
+ this.process = process;
+ this.name = name;
+ this.alert_user = alert_user;
+ }
+
+ /**
+ * This code will wait for the Process to finish then display the return
+ * value in a MessageFrame.
+ **/
+ public void run () {
+ try {
+ final Reader reader = new InputStreamReader (process.getErrorStream ());
+ getLogger ().log (reader);
+ } catch (IOException e) {
+ final MessageFrame message_frame =
+ new MessageFrame ("error while reading output of: " + name);
+
+ message_frame.setVisible (true);
+ }
+
+ try {
+ final Reader reader = new InputStreamReader (process.getInputStream ());
+ getLogger ().log (reader);
+ } catch (IOException e) {
+ final MessageFrame message_frame =
+ new MessageFrame ("error while reading output of: " + name);
+
+ message_frame.setVisible (true);
+ }
+
+ while (true) {
+ try {
+ final int return_value = process.waitFor ();
+
+ for (int i = 0 ; i < listeners.size () ; ++i) {
+ final ProcessWatcherEvent event =
+ new ProcessWatcherEvent (process, return_value);
+ final ProcessWatcherListener listener =
+ (ProcessWatcherListener) listeners.elementAt (i);
+ listener.processFinished (event);
+ }
+
+ final boolean core_dumped = (return_value & 0x80) != 0;
+
+ getLogger ().log ("\n--------------------------------------" +
+ "---------------------\n\n");
+
+ final String log_message;
+
+ if (core_dumped) {
+ log_message = name + " process dumped core";
+ new MessageFrame (log_message +
+ " - check the log window").setVisible (true);
+ } else {
+ final int sig_number = return_value & 0x7f;
+
+ if (sig_number > 0) {
+ log_message = name + " process received signal: " + sig_number;
+ new MessageFrame (log_message +
+ " - check the log window").setVisible (true);
+ } else {
+ final int exit_code = return_value >> 8;
+
+ if (exit_code == 0) {
+ log_message = name + " process completed";
+ if (alert_user) {
+ final MessageFrame message_frame =
+ new MessageFrame (log_message);
+ message_frame.setVisible (true);
+ }
+ } else {
+ log_message =
+ name + " process finished with exit code: " + exit_code;
+ new MessageFrame (log_message +
+ " - check the log window").setVisible (true);
+ }
+ }
+ }
+
+ getLogger ().log (log_message + "\n");
+
+ return;
+ } catch (InterruptedException e) {
+ // go around the loop again
+ }
+ }
+ }
+
+ /**
+ * Return the global Logger object.
+ **/
+ private static Logger getLogger () {
+ return Splash.getLogger ();
+ }
+
+ /**
+ * Add the given object as a ProcessWatcherListener for this ProcessWatcher.
+ **/
+ public void addProcessWatcherListener (final ProcessWatcherListener l) {
+ listeners.addElement (l);
+ }
+
+ /**
+ * Remove the given object as a ProcessWatcherListener for this
+ * ProcessWatcher.
+ **/
+ public void removeProcessWatcherListener (final ProcessWatcherListener l) {
+ listeners.removeElement (l);
+ }
+
+ /**
+ * The Process reference that was passed to the constructor.
+ **/
+ private Process process;
+
+ /**
+ * The program name that was passed to the constructor.
+ **/
+ private String name;
+
+ /**
+ * The alert_user argument that was passed to the constructor.
+ **/
+ private boolean alert_user;
+
+ /**
+ * The list of objects that are listening for ProcessWatcher events.
+ **/
+ private final java.util.Vector listeners = new java.util.Vector ();
+}
diff --git a/uk/ac/sanger/artemis/components/ProcessWatcherEvent.java b/uk/ac/sanger/artemis/components/ProcessWatcherEvent.java
new file mode 100644
index 000000000..61576c0f3
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ProcessWatcherEvent.java
@@ -0,0 +1,70 @@
+/* ProcessWatcherEvent.java
+ *
+ * created: Tue Feb 29 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ProcessWatcherEvent.java,v 1.1 2004-06-09 09:47:14 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+/**
+ * This event is sent when the process that is watched by ProcessWatcher
+ * finishes.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: ProcessWatcherEvent.java,v 1.1 2004-06-09 09:47:14 tjc Exp $
+ **/
+
+public class ProcessWatcherEvent {
+ /**
+ * Create a new ProcessWatcherEvent object.
+ * @param process The Process that has finished.
+ * @param exit_code The exit code of the process that has finished.
+ **/
+ public ProcessWatcherEvent (final Process process, final int exit_code) {
+ this.process = process;
+ this.exit_code = exit_code;
+ }
+
+ /**
+ * Return the process that was passed to the constructor.
+ **/
+ public Process getProcess () {
+ return process;
+ }
+
+ /**
+ * Return the exit_code that was passed to the constructor.
+ **/
+ public int getExitCode () {
+ return exit_code;
+ }
+
+ /**
+ * The process that was passed to the constructor.
+ **/
+ final Process process;
+
+ /**
+ * The exit_code that was passed to the constructor.
+ **/
+ final int exit_code;
+}
diff --git a/uk/ac/sanger/artemis/components/ProcessWatcherListener.java b/uk/ac/sanger/artemis/components/ProcessWatcherListener.java
new file mode 100644
index 000000000..723155a4c
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ProcessWatcherListener.java
@@ -0,0 +1,42 @@
+/* ProcessWatcherListener.java
+ *
+ * created: Tue Feb 29 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ProcessWatcherListener.java,v 1.1 2004-06-09 09:47:15 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+/**
+ * This interface is implemented by those classes that need to be notified
+ * when a Process finishes. The Process must be watched with a
+ * ProcessWatcher object.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: ProcessWatcherListener.java,v 1.1 2004-06-09 09:47:15 tjc Exp $
+ **/
+
+public interface ProcessWatcherListener {
+ /**
+ * Invoked by a ProcessWatcher object when a Process finishes.
+ **/
+ void processFinished (final ProcessWatcherEvent event);
+}
diff --git a/uk/ac/sanger/artemis/components/ProgressThread.java b/uk/ac/sanger/artemis/components/ProgressThread.java
new file mode 100644
index 000000000..5a83b08f5
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ProgressThread.java
@@ -0,0 +1,64 @@
+/* ArtemisMain.java
+ *
+ * created: Tue May 11 2004
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2004 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import javax.swing.*;
+import java.awt.Dimension;
+import java.awt.Color;
+
+public class ProgressThread extends Thread
+{
+ private JFrame frame;
+ private JFrame progress_frame;
+ private String msg;
+ private JProgressBar progressBar = new JProgressBar();
+
+ public ProgressThread(JFrame frame, String msg)
+ {
+ this.frame = frame;
+ this.msg = msg;
+ }
+
+ public void run()
+ {
+ progress_frame = new JFrame("Loading...");
+ Dimension d = progress_frame.getToolkit().getScreenSize();
+ progressBar.setIndeterminate(true);
+ progressBar.setBackground(Color.white);
+ progress_frame.getContentPane().add(progressBar);
+ progress_frame.pack();
+ progress_frame.setLocation(
+ ((int)d.getWidth()-progress_frame.getWidth())/2,
+ ((int)d.getHeight()-progress_frame.getHeight())/2);
+ progress_frame.setVisible(true);
+ }
+
+ public void finished()
+ {
+ if(progress_frame != null)
+ progress_frame.setVisible(false);
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/QualifierChoice.java b/uk/ac/sanger/artemis/components/QualifierChoice.java
new file mode 100644
index 000000000..4cb6c0aa0
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/QualifierChoice.java
@@ -0,0 +1,181 @@
+/* QualifierChoice.java
+ *
+ * created: Tue Sep 7 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/QualifierChoice.java,v 1.1 2004-06-09 09:47:17 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import uk.ac.sanger.artemis.util.StringVector;
+import uk.ac.sanger.artemis.io.Key;
+import uk.ac.sanger.artemis.io.InvalidKeyException;
+import uk.ac.sanger.artemis.io.EntryInformation;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+import javax.swing.event.*;
+
+/**
+ * This is a Choice component that shows only the qualifier names for a given
+ * key.
+ *
+ * @author Kim Rutherford
+ * @version $Id: QualifierChoice.java,v 1.1 2004-06-09 09:47:17 tjc Exp $
+ **/
+
+public class QualifierChoice extends JComboBox {
+ /**
+ * Create a new QualifierChoice component for the given Key with the given
+ * qualifier as the default.
+ * @param entry_information The object to get the list of possible
+ * qualifiers from.
+ * @param default_qualifier The name of the Qualifier that should be shown
+ * initially. If null the first (alphabetically) is selected.
+ **/
+ public QualifierChoice (final EntryInformation entry_information,
+ final Key key, final String default_qualifier) {
+ this.entry_information = entry_information;
+ this.key = key;
+
+ if (default_qualifier != null &&
+ entry_information.isValidQualifier (key, default_qualifier)) {
+ this.default_qualifier = default_qualifier;
+ } else {
+ this.default_qualifier = null;
+ }
+
+ final int MAX_VISIBLE_ROWS = 30;
+
+ setMaximumRowCount (MAX_VISIBLE_ROWS);
+
+ setEditable(true);
+
+ update ();
+ }
+
+ /**
+ * Change the qualifiers shown in this component to be those of the given
+ * Key.
+ **/
+ public void setKey (final Key key) {
+ if (this.key != key) {
+ this.key = key;
+
+ update ();
+ }
+ }
+
+ /**
+ * Select the given qualifier_name.
+ **/
+ private void setSelectedQualifierByName (final String qualifier_name) {
+ final int index = indexOf (qualifier_name);
+
+ if (index == -1) {
+ // add the key
+ addItem (qualifier_name);
+ setSelectedItem (qualifier_name);
+ } else {
+ setSelectedIndex (index);
+ }
+ }
+
+ /**
+ * Return the index in the Choice component of the given qualifier_name.
+ **/
+ private int indexOf (final String qualifier_name) {
+ for (int i = 0 ; i < getItemCount () ; ++i) {
+ if (getItemAt (i).equals (qualifier_name)) {
+ return i;
+ }
+ }
+ return -1;
+ }
+
+ /**
+ * Update the Choice to refect the current Key.
+ **/
+ private void update () {
+ removeAllItems ();
+
+// final StringVector common_qualifiers = new StringVector ();
+// final StringVector uncommon_qualifiers = new StringVector ();
+
+ StringVector qualifier_names =
+ entry_information.getValidQualifierNames (key);
+
+ if (qualifier_names == null) {
+ qualifier_names = new StringVector ("note");
+ }
+
+ if (default_qualifier != null &&
+ !qualifier_names.contains (default_qualifier)) {
+ qualifier_names.add (default_qualifier);
+ }
+
+ qualifier_names.sort ();
+
+// final StringVector invisible_qualifiers =
+// Options.getOptions ().getInvisibleQualifiers ();
+
+ for (int i = 0 ; i < qualifier_names.size () ; ++i) {
+ final String qualifier_name = qualifier_names.elementAt (i);
+// if (!invisible_qualifiers.contains (qualifier_name)) {
+ addItem (qualifier_name);
+// }
+ }
+
+ if (default_qualifier == null) {
+ if (indexOf ("note") != -1) {
+ setSelectedQualifierByName ("note");
+ } else {
+ if (indexOf ("locus_tag") != -1) {
+ setSelectedQualifierByName ("locus_tag");
+ } else {
+ setSelectedIndex (0);
+ }
+ }
+ } else {
+ setSelectedQualifierByName (default_qualifier);
+ }
+ }
+
+ /**
+ * The Key that was passed to the constructor.
+ **/
+ private Key key = null;
+
+ /**
+ * The qualifier name that was passed to the constructor.
+ **/
+ private String default_qualifier = null;
+
+ /**
+ * The EntryInformation object that was passed to the constructor.
+ **/
+ private EntryInformation entry_information;
+}
+
diff --git a/uk/ac/sanger/artemis/components/QualifierEditor.java b/uk/ac/sanger/artemis/components/QualifierEditor.java
new file mode 100644
index 000000000..2e87f0953
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/QualifierEditor.java
@@ -0,0 +1,332 @@
+/* QualifierEditor.java
+ *
+ * created: Tue Oct 23 2001
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000,2001,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/QualifierEditor.java,v 1.1 2004-06-09 09:47:18 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import uk.ac.sanger.artemis.util.ReadOnlyException;
+import uk.ac.sanger.artemis.io.Qualifier;
+import uk.ac.sanger.artemis.io.QualifierInfo;
+import uk.ac.sanger.artemis.io.QualifierVector;
+import uk.ac.sanger.artemis.io.QualifierParseException;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.EntryInformationException;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.util.Vector;
+
+import javax.swing.*;
+
+/**
+ * This component allows qualifiers to be added to or replaced in several
+ * features at once.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: QualifierEditor.java,v 1.1 2004-06-09 09:47:18 tjc Exp $
+ **/
+
+public class QualifierEditor extends JFrame {
+ /**
+ * Create a new QualifierEditor for the given features.
+ **/
+ public QualifierEditor (final FeatureVector features,
+ final EntryGroup entry_group) {
+ super (getFrameTitle (features));
+
+ this.features = features;
+ this.entry_group = entry_group;
+
+ final Font font = Options.getOptions ().getFont ();
+
+ final Feature first_feature = features.elementAt (0);
+
+ final EntryInformation entry_information =
+ first_feature.getEntry ().getEntryInformation ();
+
+ setFont (font);
+
+ final QualifierChoice qualifier_choice =
+ new QualifierChoice (entry_information, first_feature.getKey (), null);
+
+ final JPanel outer_qualifier_choice_panel = new JPanel ();
+ final JPanel qualifier_choice_panel = new JPanel ();
+ outer_qualifier_choice_panel.setLayout (new BorderLayout ());
+
+ outer_qualifier_choice_panel.add (qualifier_choice_panel, "West");
+
+ final JButton qualifier_button = new JButton ("Insert qualifier:");
+
+ qualifier_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ final String qualifier_name =
+ (String) qualifier_choice.getSelectedItem ();
+ final QualifierInfo qualifier_info =
+ entry_information.getQualifierInfo (qualifier_name);
+
+ if (qualifier_info == null) {
+ new MessageDialog (QualifierEditor.this, "internal error: no " +
+ "qualifier info for " + qualifier_name);
+ } else {
+ qualifier_text_area.append ("/" + qualifier_name);
+
+ switch (qualifier_info.getType ()) {
+ case QualifierInfo.QUOTED_TEXT:
+ qualifier_text_area.append ("=\"\"");
+ break;
+
+ case QualifierInfo.NO_VALUE:
+ case QualifierInfo.OPTIONAL_QUOTED_TEXT:
+ break;
+
+ default:
+ qualifier_text_area.append ("=");
+ }
+
+ qualifier_text_area.append ("\n");
+ }
+ }
+
+ });
+
+ qualifier_choice_panel.add (qualifier_button);
+
+ qualifier_choice_panel.add (qualifier_choice);
+
+ getContentPane ().add (outer_qualifier_choice_panel, "North");
+
+ qualifier_text_area = new QualifierTextArea ();
+
+ add_button.setFont (getFont ());
+ replace_button.setFont (getFont ());
+ close_button.setFont (getFont ());
+
+ add_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ addOrReplace (false);
+ }
+ });
+
+ replace_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ addOrReplace (true);
+ }
+ });
+
+ close_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ dispose ();
+ }
+ });
+
+ button_panel.setFont (getFont ());
+
+ button_panel.add (replace_button);
+ button_panel.add (add_button);
+ button_panel.add (close_button);
+
+ getContentPane ().add (qualifier_text_area, "Center");
+ getContentPane ().add (button_panel, "South");
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ dispose ();
+ }
+ });
+
+ pack ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+ }
+
+ /**
+ * Add to or replace the qualifiers in all the features that were passed to
+ * the constructor with the qualifiers from qualifier_text_area.
+ * @param replace If false any existing qualifiers of the same name in the
+ * features are left unchanged. If true existing qualifiers of the same
+ * name in the features will be deleted.
+ **/
+ private void addOrReplace (final boolean replace) {
+ try {
+ entry_group.getActionController ().startAction ();
+
+ // this will contain one QualifierVector object for each Feature in the
+ // features vector (in the same order)
+ final Vector qualifier_vector_vector = new Vector ();
+
+ for (int i = 0 ; i < features.size () ; ++i) {
+ final Feature this_feature = features.elementAt (i);
+
+ final Entry this_feature_entry = this_feature.getEntry ();
+
+ if (this_feature_entry == null) {
+ // feature has already been deleted
+ qualifier_vector_vector.addElement (null);
+ } else {
+ final EntryInformation entry_information =
+ this_feature_entry.getEntryInformation ();
+
+ try {
+ final QualifierVector qualifiers =
+ qualifier_text_area.getParsedQualifiers (entry_information);
+
+ qualifier_vector_vector.addElement (qualifiers);
+
+ } catch (QualifierParseException e) {
+ new MessageDialog (this,
+ "error while parsing: " + e.getMessage ());
+ return;
+ }
+ }
+ }
+
+ if (qualifier_vector_vector.size () != features.size ()) {
+ throw new Error ("Internal error in QualifierEditor.add() - " +
+ "mismatched array sizes");
+ }
+
+ for (int feature_index = 0 ;
+ feature_index < features.size () ;
+ ++feature_index) {
+ final Feature this_feature = features.elementAt (feature_index);
+
+ if (qualifier_vector_vector.elementAt (feature_index) == null) {
+ continue;
+ }
+
+ final QualifierVector qualifier_vector =
+ (QualifierVector) qualifier_vector_vector.elementAt (feature_index);
+
+ for (int qualifier_index = 0 ;
+ qualifier_index < qualifier_vector.size () ;
+ ++qualifier_index) {
+ final Qualifier this_qualifier =
+ qualifier_vector.elementAt (qualifier_index);
+
+ if (replace) {
+ try {
+ this_feature.setQualifier (this_qualifier);
+ } catch (EntryInformationException e) {
+ new MessageDialog (this,
+ "failed to add qualifiers to: " +
+ this_feature.getIDString () + ": " +
+ e.getMessage ());
+ } catch (ReadOnlyException e) {
+ new MessageDialog (this,
+ "failed to add qualifiers to read-only " +
+ "feature: " + this_feature.getIDString () +
+ ": " + e.getMessage ());
+ }
+ } else {
+ try {
+ this_feature.addQualifierValues (this_qualifier);
+ } catch (EntryInformationException e) {
+ new MessageDialog (this,
+ "failed to add qualifiers to: " +
+ this_feature.getIDString () + ": " +
+ e.getMessage ());
+ } catch (ReadOnlyException e) {
+ new MessageDialog (this,
+ "failed to add qualifiers to read-only " +
+ "feature: " + this_feature.getIDString () +
+ ": " + e.getMessage ());
+ }
+
+ }
+ }
+ }
+ } finally {
+ entry_group.getActionController ().endAction ();
+ }
+ }
+
+ /**
+ * Return an appropriate String to use for the title of this JFrame.
+ **/
+ static private String getFrameTitle (final FeatureVector features) {
+ boolean etc_flag = false;
+
+ final StringBuffer buffer = new StringBuffer ();
+
+ final int MAX_LENGTH = 80;
+
+ for (int i = 0 ; i < features.size () ; ++i) {
+ final Feature this_feature = features.elementAt (i);
+
+ final String feature_name = this_feature.getIDString ();
+
+ if (feature_name == null) {
+ etc_flag = true;
+ continue;
+ }
+
+ if (buffer.length () + feature_name.length () < MAX_LENGTH) {
+ if (buffer.length () == 0) {
+ buffer.append ("Add or replace qualifiers of: ");
+ buffer.append (feature_name);
+ } else {
+ buffer.append (", ").append (feature_name);
+ }
+ } else {
+ etc_flag = true;
+ break;
+ }
+ }
+
+ if (buffer.length () == 0) {
+ buffer.append ("Add or replace qualifiers");
+ } else {
+ if (etc_flag) {
+ buffer.append (", ...");
+ }
+ }
+
+ return buffer.toString ();
+ }
+
+ private QualifierTextArea qualifier_text_area;
+
+ private JButton add_button = new JButton ("Add");
+ private JButton replace_button = new JButton ("Replace");
+ private JButton close_button = new JButton ("Close");
+
+ private FlowLayout flow_layout =
+ new FlowLayout (FlowLayout.CENTER, 25, 5);
+
+ private JPanel button_panel = new JPanel (flow_layout);
+
+ /**
+ * The Feature objects that were passed to the constructor.
+ **/
+ private FeatureVector features = new FeatureVector ();
+
+ /**
+ * The EntryGroup that contains the Features (passed to the constructor).
+ **/
+ private EntryGroup entry_group;
+}
diff --git a/uk/ac/sanger/artemis/components/QualifierTextArea.java b/uk/ac/sanger/artemis/components/QualifierTextArea.java
new file mode 100644
index 000000000..cb9bf1849
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/QualifierTextArea.java
@@ -0,0 +1,96 @@
+/* QualifierTextArea.java
+ *
+ * created: Tue Oct 23 2001
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/QualifierTextArea.java,v 1.1 2004-06-09 09:47:19 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.Options;
+
+import uk.ac.sanger.artemis.io.QualifierParseException;
+import uk.ac.sanger.artemis.io.QualifierVector;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.EmblStreamFeature;
+
+import java.awt.*;
+import java.io.*;
+import javax.swing.*;
+
+/**
+ * This component is a TextArea that understands qualifiers.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: QualifierTextArea.java,v 1.1 2004-06-09 09:47:19 tjc Exp $
+ **/
+
+public class QualifierTextArea extends JTextArea {
+ /**
+ * Create a new QualifierTextArea containing no text.
+ **/
+ public QualifierTextArea () {
+ super ((Options.getOptions ().getPropertyTruthValue ("alicat_mode") ||
+ Options.getOptions ().getPropertyTruthValue ("val_mode") ?
+ 40 :
+ 18),
+ 81);
+ setLineWrap (true);
+ setBackground (Color.white);
+
+ setDragEnabled(true);
+ }
+
+ /**
+ * Parse and return the qualifiers in this TextArea in a QualifierVector.
+ **/
+ public QualifierVector
+ getParsedQualifiers (final EntryInformation entry_information)
+ throws QualifierParseException {
+ final String qualifier_string = getText ();
+ return getQualifiersFromString (qualifier_string,
+ entry_information);
+ }
+
+ /**
+ * Return a QualifierVector containing the qualifiers from a String.
+ * @param qual_string contains the qualifiers to parse
+ */
+ private static QualifierVector
+ getQualifiersFromString (final String qual_string,
+ final EntryInformation entry_information)
+ throws QualifierParseException {
+
+ try {
+ final StringReader string_reader = new StringReader (qual_string);
+
+ final QualifierVector embl_qualifiers =
+ EmblStreamFeature.readQualifiers (string_reader,
+ entry_information);
+
+ string_reader.close ();
+
+ return embl_qualifiers;
+ } catch (IOException exception) {
+ throw (new QualifierParseException (exception.getMessage ()));
+ }
+ }
+}
diff --git a/uk/ac/sanger/artemis/components/RunMenu.java b/uk/ac/sanger/artemis/components/RunMenu.java
new file mode 100644
index 000000000..8be27bef1
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/RunMenu.java
@@ -0,0 +1,278 @@
+/* RunMenu.java
+ *
+ * created: Fri Jan 22 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/RunMenu.java,v 1.1 2004-06-09 09:47:20 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.util.ReadOnlyException;
+import uk.ac.sanger.artemis.util.StringVector;
+import uk.ac.sanger.artemis.io.EntryInformationException;
+import uk.ac.sanger.artemis.io.Qualifier;
+import uk.ac.sanger.artemis.io.InvalidKeyException;
+import uk.ac.sanger.artemis.io.InvalidRelationException;
+
+import java.io.IOException;
+import java.awt.event.*;
+import java.util.Vector;
+
+import javax.swing.*;
+
+/**
+ * A JMenu of external commands/functions.
+ *
+ * @author Kim Rutherford
+ * @version $Id: RunMenu.java,v 1.1 2004-06-09 09:47:20 tjc Exp $
+ **/
+
+public class RunMenu extends SelectionMenu
+{
+ /**
+ * Create a new RunMenu object.
+ * @param frame The JFrame that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param menu_name The name of the new menu.
+ **/
+ public RunMenu(final JFrame frame, final Selection selection,
+ final String menu_name)
+ {
+ super(frame, menu_name, selection);
+
+ final ExternalProgramVector external_programs =
+ Options.getOptions().getExternalPrograms();
+
+ for(int i = 0 ; i < external_programs.size() ; ++i)
+ makeMenuItem(external_programs.elementAt(i));
+
+ addSeparator();
+
+ for(int i = 0 ; i < external_programs.size() ; ++i)
+ makeOptionsMenuItem(external_programs.elementAt(i));
+
+ if(Options.getOptions().getProperty("jcon_min_jobs") != null)
+ {
+ addSeparator();
+ final JMenuItem jcon_status = new JMenuItem("Show Job Status ...");
+
+ jcon_status.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ try
+ {
+ final int ids[] = getIds();
+ TaskViewerFrame tvf = new TaskViewerFrame(ids);
+
+ tvf.setSize(400, 600);
+ tvf.setVisible(true);
+ }
+ catch(Exception e)
+ {
+ e.printStackTrace();
+ new MessageDialog(frame, "unable to view job status: " + e);
+ }
+ }
+ });
+
+ add(jcon_status);
+ }
+ }
+
+ /**
+ * Create a new RunMenu object.
+ * @param frame The JFrame that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ **/
+ public RunMenu(final JFrame frame,
+ final Selection selection)
+ {
+ this(frame, selection, "Run");
+ }
+
+ /**
+ * Make a new menu item for running the given ExternalProgram object.
+ * @param program Create two menu items for this program.
+ **/
+ private void makeMenuItem(final ExternalProgram program)
+ {
+ final JMenuItem new_menu;
+
+ if(program.getType() == ExternalProgram.AA_PROGRAM ||
+ program.getType() == ExternalProgram.DNA_PROGRAM &&
+ Options.getOptions().getPropertyTruthValue("sanger_options"))
+ {
+ final String options_string = program.getProgramOptions();
+
+ if(options_string.length() > 0)
+ new_menu = new JMenuItem("Run " + program.getName() + " (" +
+ options_string + ") on selected features");
+ else
+ new_menu =
+ new JMenuItem("Run " + program.getName() + " on selected features");
+ }
+ else
+ new_menu =
+ new JMenuItem("Run " + program.getName() + " on selected features");
+
+ new_menu.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ if(!checkForSelectionFeatures())
+ return;
+
+ final FeatureVector selection_features =
+ getSelection().getAllFeatures();
+
+ try
+ {
+ final ExternalProgramMonitor monitor =
+ program.run(selection_features, Splash.getLogger());
+
+ monitor.addExternalProgramListener(new ExternalProgramListener()
+ {
+ public void statusChanged(final ExternalProgramEvent e)
+ {
+ if(e.getType() == ExternalProgramEvent.FINISHED)
+ new MessageFrame(e.getMessage()).setVisible(true);
+ }
+ });
+ new Thread(monitor).start();
+ }
+ catch(InvalidKeyException e)
+ {
+ new MessageDialog(getParentFrame(),
+ "execution failed: " + e.getMessage());
+ }
+ catch(EntryInformationException e)
+ {
+ new MessageDialog(getParentFrame(),
+ "execution of " + program.getName() +
+ " failed because: " + e.getMessage());
+ }
+ catch(ReadOnlyException e)
+ {
+ new MessageDialog(getParentFrame(),
+ "execution of " + program.getName() +
+ " failed because one of the features is " +
+ "read only");
+ }
+ catch(IOException e)
+ {
+ new MessageDialog(getParentFrame(),
+ "execution of " + program.getName() +
+ " failed because of an I/O error: " +
+ e);
+ }
+ catch(ExternalProgramException e)
+ {
+ new MessageDialog(getParentFrame(),
+ "execution of " + program.getName() +
+ " failed: " + e.getMessage());
+ }
+ }
+ });
+
+ add(new_menu);
+ }
+
+ /**
+ * Make a new options menu item for the given ExternalProgram object.
+ * @param program Create two menu items for this program.
+ **/
+ private void makeOptionsMenuItem(final ExternalProgram program)
+ {
+ if(!(program.getType() == ExternalProgram.AA_PROGRAM ||
+ program.getType() == ExternalProgram.DNA_PROGRAM))
+ return;
+
+ final JMenuItem new_options_menu =
+ new JMenuItem("Set " + program.getName() + " options");
+
+ new_options_menu.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ new ExternalProgramOptions(program);
+ }
+ });
+
+ add(new_options_menu);
+ }
+
+ /**
+ *
+ **/
+ private int[] getIds()
+ {
+ final FeatureVector selected_features = getSelection().getAllFeatures();
+ final Vector ids_vector = new Vector();
+
+ for(int feature_index = 0; feature_index < selected_features.size();
+ ++feature_index)
+ {
+ final Feature this_feature = selected_features.elementAt(feature_index);
+
+ try
+ {
+ final Qualifier job_qualifier =
+ this_feature.getQualifierByName("job");
+
+ final StringVector values = job_qualifier.getValues();
+
+ if(values != null && values.size() > 0)
+ {
+ for(int value_index=0; value_index<values.size();
+ ++value_index)
+ {
+ final String job_value = values.elementAt(value_index);
+ final StringVector bits = StringVector.getStrings(job_value);
+
+ if(bits.size() > 4 && bits.elementAt(2).equals("task:"))
+ {
+ try
+ {
+ final Integer task_id = Integer.valueOf(bits.elementAt(3));
+
+ if(!ids_vector.contains(task_id))
+ ids_vector.add(task_id);
+ }
+ catch(NumberFormatException e) {}
+ }
+ }
+ }
+ }
+ catch(InvalidRelationException e) {}
+ }
+
+ final int[] ids = new int[ids_vector.size()];
+
+ for(int i=0 ; i<ids.length ; ++i)
+ ids[i] =((Integer)ids_vector.elementAt(i)).intValue();
+
+ return ids;
+ }
+}
diff --git a/uk/ac/sanger/artemis/components/ScoreChangeEvent.java b/uk/ac/sanger/artemis/components/ScoreChangeEvent.java
new file mode 100644
index 000000000..0d567b905
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ScoreChangeEvent.java
@@ -0,0 +1,58 @@
+/* ScoreChangeEvent.java
+ *
+ * created: Thu Oct 21 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ScoreChangeEvent.java,v 1.1 2004-06-09 09:47:22 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+/**
+ * The adjustment event emitted when a score changes.
+ *
+ * @author Kim Rutherford
+ * @version $Id: ScoreChangeEvent.java,v 1.1 2004-06-09 09:47:22 tjc Exp $
+ **/
+
+public class ScoreChangeEvent extends java.util.EventObject {
+ /**
+ * Create new ScoreChangeEvent.
+ **/
+ public ScoreChangeEvent (final Object source, final int value) {
+ super (source);
+ this.value = value;
+ }
+
+ /**
+ * Return the new score value that caused this event (as passed to the
+ * constructor).
+ **/
+ public int getValue () {
+ return value;
+ }
+
+
+ /**
+ * The new score value that caused this event (as passed to the
+ * constructor).
+ **/
+ final int value;
+}
diff --git a/uk/ac/sanger/artemis/components/ScoreChangeListener.java b/uk/ac/sanger/artemis/components/ScoreChangeListener.java
new file mode 100644
index 000000000..0cde0f0da
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ScoreChangeListener.java
@@ -0,0 +1,40 @@
+/* ScoreAdjustmentListener.java
+ *
+ * created: Thu Oct 21 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ScoreChangeListener.java,v 1.1 2004-06-09 09:47:28 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+/**
+ * The listener interface for receiving score change events.
+ *
+ * @author Kim Rutherford
+ * @version $Id: ScoreChangeListener.java,v 1.1 2004-06-09 09:47:28 tjc Exp $
+ **/
+
+public interface ScoreChangeListener {
+ /**
+ * Invoked when the value of the score has changed.
+ **/
+ void scoreChanged (final ScoreChangeEvent event);
+}
diff --git a/uk/ac/sanger/artemis/components/ScoreChanger.java b/uk/ac/sanger/artemis/components/ScoreChanger.java
new file mode 100644
index 000000000..1375dd314
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ScoreChanger.java
@@ -0,0 +1,222 @@
+/* ScoreChanger.java
+ *
+ * created: Thu Oct 21 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ScoreChanger.java,v 1.1 2004-06-09 09:47:29 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * This is a JFrame component that contains ScoreScrollbar components.
+ *
+ * @author Kim Rutherford
+ * @version $Id: ScoreChanger.java,v 1.1 2004-06-09 09:47:29 tjc Exp $
+ **/
+
+public class ScoreChanger extends JFrame {
+ /**
+ * Create a new ScoreChanger.
+ * @param minimum_value The minimum allowable value for the scroll bars.
+ * @param maximum_value The maximum allowable value for the scroll bars.
+ **/
+ public ScoreChanger (final String name,
+ final ScoreChangeListener minimum_listener,
+ final ScoreChangeListener maximum_listener,
+ final int minimum_value, final int maximum_value)
+ throws IllegalArgumentException {
+
+ super (name);
+
+ this.minimum_listener = minimum_listener;
+ this.maximum_listener = maximum_listener;
+ this.minimum_value = minimum_value;
+ this.maximum_value = maximum_value;
+
+ getContentPane ().setLayout (new GridLayout (5, 1));
+
+ minimum_label = new JLabel ();
+
+ getContentPane ().add (minimum_label);
+
+ minimum_score_scrollbar =
+ new ScoreScrollbar (minimum_value, maximum_value);
+
+ final ScoreChangeListener this_minimum_listener =
+ new ScoreChangeListener () {
+ public void scoreChanged (ScoreChangeEvent event) {
+ minimum_label.setText ("Minimum Cutoff: " + event.getValue ());
+ }
+ };
+
+ minimum_score_scrollbar.addScoreChangeListener (this_minimum_listener);
+
+ getContentPane ().add (minimum_score_scrollbar);
+
+ maximum_label = new JLabel ();
+
+ getContentPane ().add (maximum_label);
+
+ maximum_score_scrollbar =
+ new ScoreScrollbar (minimum_value, maximum_value);
+
+ final ScoreChangeListener this_maximum_listener =
+ new ScoreChangeListener () {
+ public void scoreChanged (ScoreChangeEvent event) {
+ maximum_label.setText ("Maximum Cutoff: " + event.getValue ());
+ }
+ };
+
+ maximum_score_scrollbar.addScoreChangeListener (this_maximum_listener);
+
+ getContentPane ().add (maximum_score_scrollbar);
+
+ final FlowLayout flow_layout =
+ new FlowLayout (FlowLayout.CENTER, 18, 0);
+
+ final JPanel button_panel = new JPanel (flow_layout);
+
+ final JButton reset_button = new JButton ("Reset");
+
+ reset_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ reset ();
+ }
+ });
+
+ button_panel.add (reset_button);
+
+
+ final JButton close_button = new JButton ("Close");
+
+ close_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ dispose ();
+ }
+ });
+
+
+ button_panel.add (close_button);
+
+ getContentPane ().add (button_panel);
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ dispose ();
+ }
+ });
+
+ pack ();
+
+ setSize (270, getSize ().height);
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+
+ reset ();
+
+ minimum_score_scrollbar.addScoreChangeListener (minimum_listener);
+ maximum_score_scrollbar.addScoreChangeListener (maximum_listener);
+ }
+
+ /**
+ * Call reset (), clean up the listeners then call super.dispose ().
+ **/
+ public void dispose () {
+ reset ();
+
+ minimum_score_scrollbar.removeScoreChangeListener (minimum_listener);
+ maximum_score_scrollbar.removeScoreChangeListener (maximum_listener);
+
+ super.dispose ();
+ }
+
+ /**
+ * Reset the minimum_score_scrollbar to 0 and the maximum_score_scrollbar
+ * to 100.
+ **/
+ private void reset () {
+ minimum_score_scrollbar.setValue (minimum_value);
+ maximum_score_scrollbar.setValue (maximum_value);
+
+ minimum_label.setText ("Minimum Cutoff: " + minimum_value);
+ maximum_label.setText ("Maximum Cutoff: " + maximum_value);
+
+ final ScoreChangeEvent minimum_event =
+ new ScoreChangeEvent (this, minimum_value);
+
+ minimum_listener.scoreChanged (minimum_event);
+
+ final ScoreChangeEvent maximum_event =
+ new ScoreChangeEvent (this, maximum_value);
+
+ maximum_listener.scoreChanged (maximum_event);
+ }
+
+ /**
+ * The ScoreChangeListener for the minimum score that was passed to the
+ * constructor.
+ **/
+ final ScoreChangeListener minimum_listener;
+
+ /**
+ * The minimum score scrollbar the created by the constructor.
+ **/
+ final ScoreScrollbar minimum_score_scrollbar;
+
+ /**
+ * The ScoreChangeListener for the maximum score that was passed to the
+ * constructor.
+ **/
+ final ScoreChangeListener maximum_listener;
+
+ /**
+ * The maximum score scrollbar the created by the constructor.
+ **/
+ final ScoreScrollbar maximum_score_scrollbar;
+
+ /**
+ * The minimum allowable value for the scroll bars.
+ **/
+ final int minimum_value;
+
+ /**
+ * The maximum allowable value for the scroll bars.
+ **/
+ final int maximum_value;
+
+ /**
+ * A Label that shows something like this: "Minimum Cutoff: 0"
+ **/
+ final JLabel minimum_label;
+
+ /**
+ * A Label that shows something like this: "Maximum Cutoff: 100"
+ **/
+ final JLabel maximum_label;
+}
+
diff --git a/uk/ac/sanger/artemis/components/ScoreScrollbar.java b/uk/ac/sanger/artemis/components/ScoreScrollbar.java
new file mode 100644
index 000000000..d234bb8cb
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ScoreScrollbar.java
@@ -0,0 +1,120 @@
+/* ScoreScrollbar.java
+ *
+ * created: Thu Oct 21 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1999 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ScoreScrollbar.java,v 1.1 2004-06-09 09:47:31 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * This component is a Scrollbar that generates ScoreChange events when the
+ * value changes.
+ *
+ * @author Kim Rutherford
+ * @version $Id: ScoreScrollbar.java,v 1.1 2004-06-09 09:47:31 tjc Exp $
+ **/
+
+public class ScoreScrollbar extends JScrollBar
+ implements AdjustmentListener {
+ /**
+ * Constructs a new horizontal score scroll bar with an initial value of 0.
+ * @param minimum_value The minimum allowable value for the scroll bar.
+ * @param maximum_value The maximum allowable value for the scroll bar.
+ **/
+ public ScoreScrollbar (final int minimum_value, final int maximum_value) {
+ this (Scrollbar.HORIZONTAL, minimum_value, minimum_value, maximum_value);
+ }
+
+ /**
+ * Constructs a new score scroll bar with the specified orientation.
+ *
+ * The orientation argument must take one of the two values
+ * java.awt.Scrollbar.HORIZONTAL, or java.awt.Scrollbar.VERTICAL,
+ * indicating a horizontal or vertical scroll bar, respectively.
+ * @param orientation indicates the orientation of the scroll bar.
+ * @param value The initial value of the scrollbar.
+ * @param minimum_value The minimum allowable value for the scroll bar.
+ * @param maximum_value The maximum allowable value for the scroll bar.
+ * @exception IllegalArgumentException when an illegal value for the
+ * orientation argument is supplied or if the value parameter is less
+ * than minimum_value or greater than maximum_value.
+ **/
+ public ScoreScrollbar (final int orientation, final int value,
+ final int minimum_value, final int maximum_value)
+ throws IllegalArgumentException {
+ super (orientation,
+ (value < minimum_value || value > maximum_value ?
+ minimum_value :
+ value),
+ 1, minimum_value, maximum_value + 1);
+ }
+
+ /**
+ * Add the given ScoreChangeListener as a listener for ScoreChange events
+ * from this components.
+ **/
+ public void addScoreChangeListener (final ScoreChangeListener l) {
+ score_change_listeners.addElement (l);
+
+ if (score_change_listeners.size () == 1) {
+ addAdjustmentListener (this);
+ }
+ }
+
+ /**
+ * Remove the given ScoreChangeListener as a listener for ScoreChange
+ * events from this components.
+ **/
+ public void removeScoreChangeListener (final ScoreChangeListener l) {
+ score_change_listeners.addElement (l);
+
+ if (score_change_listeners.size () == 0) {
+ removeAdjustmentListener (this);
+ }
+ }
+
+ /**
+ * Implementation of the AdjustmentListener interface.
+ **/
+ public void adjustmentValueChanged (AdjustmentEvent e) {
+ for (int i = 0 ; i < score_change_listeners.size () ; ++i) {
+ final ScoreChangeEvent event =
+ new ScoreChangeEvent (this, getValue ());
+ final ScoreChangeListener this_listener =
+ (ScoreChangeListener)(score_change_listeners.elementAt (i));
+ this_listener.scoreChanged (event);
+ }
+ }
+
+ /**
+ * The ScoreChangeListener objects that have been added with
+ * addScoreChangeListener ().
+ **/
+ private final java.util.Vector score_change_listeners =
+ new java.util.Vector ();
+}
+
diff --git a/uk/ac/sanger/artemis/components/SearchResultViewer.java b/uk/ac/sanger/artemis/components/SearchResultViewer.java
new file mode 100644
index 000000000..17228e217
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/SearchResultViewer.java
@@ -0,0 +1,108 @@
+/* SearchResultViewer.java
+ *
+ * created: Thu Feb 24 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/SearchResultViewer.java,v 1.1 2004-06-09 09:47:34 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+
+import uk.ac.sanger.artemis.util.*;
+
+import java.io.*;
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * A component that displays the results of external searches, with the
+ * ability to send the results to a netscape process.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: SearchResultViewer.java,v 1.1 2004-06-09 09:47:34 tjc Exp $
+ **/
+
+public class SearchResultViewer extends FileViewer {
+ /**
+ * Create a new SearchResultViewer component.
+ * @param title The name to attach to the new JFrame.
+ * @param file_name The file to read into the new viewer.
+ **/
+ public SearchResultViewer (final String label,
+ final Document document)
+ throws IOException {
+
+ super (label);
+
+ try {
+ readFile (document.getReader ());
+ } catch (IOException e) {
+ System.out.println ("error while reading results: " + e);
+ dispose ();
+ throw e;
+ }
+
+ if (!Options.getOptions ().getPropertyTruthValue ("sanger_options")) {
+ return;
+ }
+
+ final JButton to_browser = new JButton ("Send to browser");
+
+ getButtonPanel ().add (to_browser);
+
+ to_browser.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ try {
+ sendToBrowser (document.toString ());
+ } catch (IOException e) {
+ System.out.println ("error while reading results: " + e);
+ new MessageDialog (SearchResultViewer.this,
+ "Message",
+ "Send to browser failed: " + e);
+ } catch (ExternalProgramException e) {
+ System.out.println ("error while reading results: " + e);
+ new MessageDialog (SearchResultViewer.this,
+ "Message",
+ "Send to browser failed: " + e);
+ }
+ }
+ });
+ }
+
+ /**
+ * Mark up the contents of the given file (which should contain blast or
+ * fasta output) and send it to a web browser (with netscape -remote).
+ **/
+ public static void sendToBrowser (final String file_name)
+ throws IOException, ExternalProgramException {
+ final String [] arguments = {
+ file_name
+ };
+
+ final Process process =
+ ExternalProgram.startProgram ("../etc/results_to_netscape", arguments);
+
+ new ProcessWatcher (process, "results_to_netscape", false);
+ }
+}
diff --git a/uk/ac/sanger/artemis/components/SelectMenu.java b/uk/ac/sanger/artemis/components/SelectMenu.java
new file mode 100644
index 000000000..371c54185
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/SelectMenu.java
@@ -0,0 +1,827 @@
+/* SelectMenu.java
+ *
+ * created: Thu Jan 14 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/SelectMenu.java,v 1.1 2004-06-09 09:47:37 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import uk.ac.sanger.artemis.util.OutOfRangeException;
+import uk.ac.sanger.artemis.util.StringVector;
+import uk.ac.sanger.artemis.io.Range;
+import uk.ac.sanger.artemis.io.Key;
+import uk.ac.sanger.artemis.io.KeyVector;
+import uk.ac.sanger.artemis.io.Qualifier;
+import uk.ac.sanger.artemis.io.InvalidKeyException;
+import uk.ac.sanger.artemis.io.InvalidRelationException;
+import uk.ac.sanger.artemis.io.EntryInformation;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * This menu has contains items such a "Select all", "Select none" and
+ * "Select by key".
+ *
+ * @author Kim Rutherford
+ * @version $Id: SelectMenu.java,v 1.1 2004-06-09 09:47:37 tjc Exp $
+ **/
+
+public class SelectMenu extends SelectionMenu {
+ /**
+ * Create a new SelectMenu object and all it's menu items.
+ * @param frame The JFrame that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param goto_event_source The object the we will call makeBaseVisible ()
+ * on.
+ * @param entry_group The EntryGroup object where features and exons are
+ * selected from.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ * @param menu_name The name of the new menu.
+ **/
+ public SelectMenu (final JFrame frame,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final EntryGroup entry_group,
+ final BasePlotGroup base_plot_group,
+ final String menu_name) {
+ super (frame, menu_name, selection);
+
+ this.entry_group = entry_group;
+ this.goto_event_source = goto_event_source;
+
+ selector_item = new JMenuItem ("Feature Selector ...");
+ selector_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ new Selector (selection, goto_event_source, getEntryGroup (),
+ base_plot_group);
+ }
+ });
+
+ add (selector_item);
+
+ addSeparator ();
+
+ all_item = new JMenuItem ("All");
+ all_item.setAccelerator (SELECT_ALL_KEY);
+ all_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ selectAll ();
+ }
+ });
+
+ add (all_item);
+
+ all_bases_item = new JMenuItem ("All Bases");
+ all_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ selectAllBases ();
+ }
+ });
+
+ add (all_bases_item);
+
+ none_item = new JMenuItem ("None");
+ none_item.setAccelerator (SELECT_NONE_KEY);
+ none_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ clearSelection ();
+ }
+ });
+
+ add (none_item);
+
+ select_by_key_item = new JMenuItem ("By Key");
+ select_by_key_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ selectByKeyPopup ();
+ }
+ });
+
+ add (select_by_key_item);
+
+ select_non_pseudo_cds_item =
+ new JMenuItem ("CDS Features without /pseudo");
+ select_non_pseudo_cds_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ // select all CDS features that do not have the /pseudo qualifier
+ final FeatureKeyQualifierPredicate predicate =
+ new FeatureKeyQualifierPredicate (Key.CDS, "pseudo", false);
+
+ clearSelection ();
+
+ selectFeaturesByPredicate (predicate);
+ }
+ });
+
+ add (select_non_pseudo_cds_item);
+
+ select_all_cds_item = new JMenuItem ("All CDS Features");
+ select_all_cds_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ final FeatureKeyPredicate predicate =
+ new FeatureKeyPredicate (Key.CDS);
+
+ clearSelection ();
+
+ selectFeaturesByPredicate (predicate);
+ }
+ });
+
+ add (select_all_cds_item);
+
+ select_same_type_item = new JMenuItem ("Same Key");
+ select_same_type_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ selectSameKey ();
+ }
+ });
+
+ add (select_same_type_item);
+
+ select_matching_qualifiers_item =
+ new JMenuItem ("Features Matching Qualifier");
+ select_matching_qualifiers_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ selectMatchingQualifiers ();
+ }
+ });
+
+ add (select_matching_qualifiers_item);
+
+ select_orf_item = new JMenuItem ("Open Reading Frame");
+ select_orf_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ selectOrf ();
+ }
+ });
+
+ add (select_orf_item);
+
+ select_features_in_range_item =
+ new JMenuItem ("Features Overlapping Selection");
+ select_features_in_range_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ selectOverlappingFeatures ();
+ }
+ });
+
+ add (select_features_in_range_item);
+
+ select_base_range_item = new JMenuItem ("Base Range ...");
+ select_base_range_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ selectBaseRange ();
+ }
+ });
+
+ add (select_base_range_item);
+
+ select_aa_range_in_feature_item = new JMenuItem ("Feature AA Range ...");
+ select_aa_range_in_feature_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ selectFeatureAARange ();
+ }
+ });
+
+ add (select_aa_range_in_feature_item);
+
+ addSeparator ();
+
+ selection_toggle_item = new JMenuItem ("Toggle Selection");
+ selection_toggle_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ toggleSelection ();
+ }
+ });
+
+ add (selection_toggle_item);
+ }
+
+ /**
+ * The shortcut for Select All
+ **/
+ final static KeyStroke SELECT_ALL_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_A, InputEvent.CTRL_MASK);
+
+ /**
+ * The shortcut for Select None
+ **/
+ final static KeyStroke SELECT_NONE_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_N, InputEvent.CTRL_MASK);
+
+ /**
+ * Create a new SelectMenu object and all it's menu items.
+ * @param frame The JFrame that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param goto_event_source The object the we will call makeBaseVisible ()
+ * on.
+ * @param entry_group The EntryGroup object where features and exons are
+ * selected from.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public SelectMenu (final JFrame frame,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final EntryGroup entry_group,
+ final BasePlotGroup base_plot_group) {
+ this (frame, selection, goto_event_source, entry_group,
+ base_plot_group, "Select");
+ }
+
+ /**
+ * Warn if the user tries to select more than this number of features.
+ **/
+ final private int MAX_FEATURE_TO_SELECT_COUNT = 10000;
+
+ /**
+ * Select all the features in the active entries. If there are more than
+ * 1000 features the user is asked for confirmation.
+ **/
+ private void selectAll () {
+ if (getEntryGroup ().getAllFeaturesCount () >
+ MAX_FEATURE_TO_SELECT_COUNT) {
+ final YesNoDialog dialog =
+ new YesNoDialog (getParentFrame (),
+ "Are you sure you want to select " +
+ getEntryGroup ().getAllFeaturesCount () +
+ " features?");
+
+ if (!dialog.getResult ()) {
+ return;
+ }
+ }
+
+ final FeatureVector all_features = getEntryGroup ().getAllFeatures ();
+
+ if (getEntryGroup () instanceof SimpleEntryGroup) {
+ // special case for speed
+ getSelection ().set (all_features);
+ } else {
+ clearSelection ();
+
+ getSelection ().add (all_features);
+ }
+ }
+
+ /**
+ * Select all the bases.
+ **/
+ private void selectAllBases () {
+ try {
+ final Strand strand = getEntryGroup ().getBases ().getForwardStrand ();
+
+ final MarkerRange new_range =
+ strand.makeMarkerRangeFromPositions (1, strand.getSequenceLength ());
+
+ getSelection ().setMarkerRange (new_range);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+
+ /**
+ * Remove the all Features and FeatureSegments in the EntryGroup from the
+ * Selection. If the current EntryGroup is a SimpleEntryGroup then this
+ * method just calls getSelection ().clear ();
+ **/
+ private void clearSelection () {
+ if (getEntryGroup () instanceof SimpleEntryGroup) {
+ // special case for speed
+ getSelection ().clear ();
+ } else {
+ getSelection ().setMarkerRange (null);
+
+ final FeatureEnumeration test_enumerator = getEntryGroup ().features ();
+
+ while (test_enumerator.hasMoreFeatures ()) {
+ final Feature this_feature = test_enumerator.nextFeature ();
+
+ getSelection ().remove (this_feature);
+ getSelection ().removeSegmentsOf (this_feature);
+ }
+ }
+ }
+
+ /**
+ * Invert the selection - after calling this method the selection will
+ * contain only those features that were not in the selection before the
+ * call.
+ **/
+ private void toggleSelection () {
+ final FeatureVector selected_features = getSelection ().getAllFeatures ();
+
+ final FeatureVector all_features = getEntryGroup ().getAllFeatures ();
+
+ final FeatureVector new_selection = new FeatureVector ();
+
+ for (int i = 0 ; i < all_features.size () ; ++i) {
+ final Feature this_feature = all_features.elementAt (i);
+
+ if (!selected_features.contains (this_feature)) {
+ new_selection.add (this_feature);
+ }
+ }
+
+ clearSelection ();
+
+ getSelection ().add (new_selection);
+ }
+
+
+ /**
+ * Popup a TextRequester component and then select all the features that
+ * have the same key as the user types.
+ **/
+ private void selectByKeyPopup () {
+ final KeyChooser key_chooser;
+
+ final EntryInformation default_entry_information =
+ Options.getArtemisEntryInformation ();
+
+ key_chooser = new KeyChooser (default_entry_information,
+ new Key ("misc_feature"));
+
+ key_chooser.getKeyChoice ().addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent _) {
+ selectByKey (key_chooser.getKeyChoice ().getSelectedItem ());
+ key_chooser.setVisible (false);
+ key_chooser.dispose ();
+ }
+ });
+
+ key_chooser.getOKButton ().addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent _) {
+ selectByKey (key_chooser.getKeyChoice ().getSelectedItem ());
+ key_chooser.setVisible (false);
+ key_chooser.dispose ();
+ }
+ });
+
+ key_chooser.setVisible (true);
+ }
+
+ /**
+ * Select all the features that have the given key.
+ **/
+ private void selectByKey (final Key key) {
+ final FeaturePredicate predicate = new FeatureKeyPredicate (key);
+
+ selectFeaturesByPredicate (predicate);
+ }
+
+ /**
+ * Select all the features that have the given key and contains a qualifier
+ * with the given name and value.
+ * If key is null select any feature with the contains a qualifier with the
+ * given name and value.
+ **/
+ private void selectByQualifier (final Key key,
+ final String name, final String value) {
+ final FeaturePredicate predicate =
+ new FeatureKeyQualifierPredicate (key, name, value);
+
+ selectFeaturesByPredicate (predicate);
+ }
+
+ /**
+ * Select all the features that have the same key as the currently selected
+ * features.
+ **/
+ private void selectSameKey () {
+ if (! checkForSelectionFeatures ()) {
+ return;
+ }
+
+ final KeyVector seen_keys = new KeyVector ();
+
+ final FeatureVector selected_features = getSelection ().getAllFeatures ();
+
+ for (int i = 0 ; i < selected_features.size () ; ++i) {
+ final Feature current_feature = selected_features.elementAt (i);
+
+ if (!seen_keys.contains (current_feature.getKey ())) {
+ seen_keys.add (current_feature.getKey ());
+ }
+ }
+
+ clearSelection ();
+
+ for (int i = 0 ; i < seen_keys.size () ; ++i) {
+ selectByKey (seen_keys.elementAt (i));
+ }
+ }
+
+ /**
+ * Ask the user for a qualifier name, list all of the qualifier with that
+ * name in the currently selected feature then select all features that
+ * have that name and qualifier.
+ **/
+ private void selectMatchingQualifiers () {
+ if (!checkForSelectionFeatures (getParentFrame (), getSelection ())) {
+ return;
+ }
+
+ final FeatureVector selected_features = getSelection ().getAllFeatures ();
+
+ if (selected_features.size () > 1) {
+ new MessageDialog (getParentFrame (), "select only one feature");
+ return;
+ }
+
+ final Feature selected_feature = selected_features.elementAt (0);
+
+ final StringVector qualifier_names =
+ Feature.getAllQualifierNames (selected_features);
+
+ if (qualifier_names.size () == 0) {
+ new MessageDialog (getParentFrame (), "feature has no qualifiers");
+ return;
+ }
+
+ final ChoiceFrame name_choice_frame =
+ new ChoiceFrame ("Select a qualifier name ...", qualifier_names);
+
+ final JComboBox name_choice = name_choice_frame.getChoice ();
+
+ class SelectListener implements ActionListener, ItemListener {
+ public void doStuff () {
+ selectMatchingQualifiersHelper (selected_feature,
+ (String) name_choice.getSelectedItem ());
+ name_choice_frame.setVisible (false);
+ name_choice_frame.dispose ();
+ }
+
+ public void itemStateChanged (ItemEvent _) {
+ doStuff ();
+ // need to remove() because itemStateChanged() is called twice on the
+ // Tru64 1.4.1 JVM
+ name_choice.removeItemListener (this);
+ }
+
+ public void actionPerformed (ActionEvent _) {
+ doStuff ();
+ name_choice_frame.getOKButton ().removeActionListener (this);
+ }
+ };
+
+ final SelectListener listener = new SelectListener ();
+
+ name_choice.addItemListener (listener);
+ name_choice_frame.getOKButton ().addActionListener (listener);
+
+ name_choice_frame.setVisible (true);
+ }
+
+ /**
+ * Pop up a list of the values of the qualifiers with the given name in the
+ * given feature then select all features that have a qualifier with the
+ * same and value.
+ **/
+ private void selectMatchingQualifiersHelper (final Feature feature,
+ final String name) {
+ final Qualifier qualifier;
+
+ try {
+ qualifier = feature.getQualifierByName (name);
+ } catch (InvalidRelationException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+
+ if (qualifier == null) {
+ throw new Error ("internal error - unexpected null reference");
+ }
+
+ final StringVector qualifier_values = qualifier.getValues ();
+
+ if (qualifier_values.size () == 0) {
+ new MessageDialog (getParentFrame (),
+ "qualifier " + name + " has no values in ");
+ return;
+ }
+
+ if (qualifier_values.size () == 1) {
+ selectByQualifier (null, name, qualifier_values.elementAt (0));
+ } else {
+ final ChoiceFrame value_choice_frame =
+ new ChoiceFrame ("Select a qualifier value", qualifier_values);
+
+ final JComboBox value_choice = value_choice_frame.getChoice ();
+
+ value_choice.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent _) {
+ selectByQualifier (null, name,
+ (String) value_choice.getSelectedItem ());
+ value_choice_frame.setVisible (false);
+ value_choice_frame.dispose ();
+ }
+ });
+
+ value_choice_frame.getOKButton ().addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent _) {
+ selectByQualifier (null, name,
+ (String) value_choice.getSelectedItem ());
+ value_choice_frame.setVisible (false);
+ value_choice_frame.dispose ();
+ }
+ });
+
+ value_choice_frame.setVisible (true);
+ }
+ }
+
+ /**
+ * Select all the features that match the given predicate.
+ **/
+ private void selectFeaturesByPredicate (final FeaturePredicate predicate) {
+ final FeatureVector new_selection_features = new FeatureVector ();
+
+ final FeatureEnumeration feature_enum = getEntryGroup ().features ();
+
+ while (feature_enum.hasMoreFeatures ()) {
+ final Feature current_feature = feature_enum.nextFeature ();
+
+ if (predicate.testPredicate (current_feature)) {
+ new_selection_features.add (current_feature);
+ }
+ }
+
+ clearSelection ();
+
+ getSelection ().add (new_selection_features);
+ }
+
+ /**
+ * If a range of bases is selected, then select the ORF around those
+ * bases.
+ **/
+ private void selectOrf () {
+ if (!checkForSelectionRange ()) {
+ return;
+ }
+
+ final MarkerRange range = getSelection ().getMarkerRange ();
+
+ final Strand strand = getEntryGroup ().getBases ().getForwardStrand ();
+
+ final MarkerRange start_orf_range =
+ strand.getORFAroundMarker (range.getStart (), true);
+
+ /*final*/ Marker end_marker;
+
+ // get the marker of the first base of the last codon in the range (we
+ // want to keep in the same frame)
+ try {
+ final int start_end_diff = range.getCount () - 1;
+
+ final int mod_length = start_end_diff - start_end_diff % 3;
+
+ end_marker = range.getStart ().moveBy (mod_length);
+ } catch (OutOfRangeException e) {
+ end_marker = range.getStart ();
+ }
+
+ final MarkerRange end_orf_range =
+ strand.getORFAroundMarker (end_marker, true);
+
+ MarkerRange new_range = range;
+
+ if (start_orf_range != null) {
+ new_range = new_range.extendRange (start_orf_range);
+ }
+
+ if (end_orf_range != null) {
+ new_range = new_range.extendRange (end_orf_range);
+ }
+
+ if (start_orf_range == null && end_orf_range == null &&
+ range.getCount () <= 6) { // 6 == two codons
+ new MessageDialog (getParentFrame (),
+ "there is no open reading frame at the selected " +
+ "bases");
+ return;
+ }
+
+ getSelection ().setMarkerRange (new_range);
+ }
+
+ /**
+ * This method will ask the user for a range of bases (such as 100..200),
+ * using a MarkerRangeRequester component, then selects that range.
+ **/
+ private void selectBaseRange () {
+ final MarkerRangeRequester range_requester =
+ new MarkerRangeRequester ("enter a range of bases (eg. 100..200):",
+ 18, "");
+
+ final MarkerRangeRequesterListener listener =
+ new MarkerRangeRequesterListener () {
+ public void actionPerformed (final MarkerRangeRequesterEvent event) {
+ final MarkerRange marker_range =
+ event.getMarkerRange (getEntryGroup ().getBases ());
+
+ getSelection ().setMarkerRange (marker_range);
+
+ makeBaseVisible (getSelection ().getStartBaseOfSelection ());
+ }
+ };
+
+ range_requester.addMarkerRangeRequesterListener (listener);
+
+ range_requester.setVisible (true);
+ }
+
+ /**
+ * This method will ask the user for a range of amino acids in a feature
+ * (such as 100..200), using a Requester component, then selects that
+ * range on the sequence.
+ **/
+ private void selectFeatureAARange () {
+ if (!checkForSelectionFeatures (getParentFrame (), getSelection ())) {
+ return;
+ }
+
+ final FeatureVector selected_features = getSelection ().getAllFeatures ();
+
+ if (selected_features.size () > 1) {
+ new MessageDialog (getParentFrame (), "select only one feature");
+ return;
+ }
+
+ final Feature selected_feature = selected_features.elementAt (0);
+
+ final MarkerRangeRequester range_requester =
+ new MarkerRangeRequester ("enter a range of amino acids (eg. 100..200):",
+ 18, "");
+
+ final MarkerRangeRequesterListener listener =
+ new MarkerRangeRequesterListener () {
+ public void actionPerformed (final MarkerRangeRequesterEvent event) {
+ final Range range = event.getRawRange ();
+
+ if (range == null) {
+ return;
+ }
+
+ final int start_position = range.getStart ();
+ final int end_position = range.getEnd ();
+
+ final int start_pos_in_feature = (start_position - 1) * 3 + 1;
+ final int end_pos_in_feature = (end_position - 1) * 3 + 3;
+
+ try {
+ final Marker start_marker =
+ selected_feature.getPositionInSequence (start_pos_in_feature);
+
+ final Marker end_marker =
+ selected_feature.getPositionInSequence (end_pos_in_feature);
+
+ final MarkerRange marker_range =
+ new MarkerRange (start_marker.getStrand (),
+ start_marker.getPosition (),
+ end_marker.getPosition ());
+
+ getSelection ().setMarkerRange (marker_range);
+
+ makeBaseVisible (getSelection ().getStartBaseOfSelection ());
+ } catch (OutOfRangeException e) {
+ new MessageDialog (getParentFrame (),
+ "amino acid range is out of range " +
+ "for this feature");
+ }
+ }
+ };
+
+ range_requester.addMarkerRangeRequesterListener (listener);
+
+ range_requester.setVisible (true);
+ }
+
+ /**
+ * If there are some selected bases, select the feature in that range
+ * (replacing the orginal selection). If some features are selected,
+ * select those features that overlap the selected features (and unselect
+ * the original features).
+ **/
+ private void selectOverlappingFeatures () {
+ final MarkerRange selected_marker_range =
+ getSelection ().getMarkerRange ();
+
+ if (selected_marker_range == null) {
+ final FeatureVector selected_features =
+ getSelection ().getAllFeatures ();
+
+ if (selected_features.size () == 0) {
+ new MessageDialog (getParentFrame (), "nothing selected");
+ return;
+ } else {
+ final FeatureVector new_selection = new FeatureVector ();
+
+ for (int i = 0 ; i < selected_features.size () ; ++i) {
+ final Feature this_feature = selected_features.elementAt (i);
+
+ final Range this_feature_raw_range = this_feature.getMaxRawRange ();
+
+ try {
+ final FeatureVector overlapping_features =
+ getEntryGroup ().getFeaturesInRange (this_feature_raw_range);
+
+ for (int overlapping_feature_index = 0 ;
+ overlapping_feature_index < overlapping_features.size () ;
+ ++overlapping_feature_index) {
+ final Feature overlapping_feature =
+ overlapping_features.elementAt (overlapping_feature_index);
+
+ if (!new_selection.contains (overlapping_feature)) {
+ new_selection.add (overlapping_feature);
+ }
+ }
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+
+ for (int i = 0 ; i < selected_features.size () ; ++i) {
+ new_selection.remove (selected_features.elementAt (i));
+ }
+
+ getSelection ().set (new_selection);
+ }
+ } else {
+ try {
+ final Range raw_range = selected_marker_range.getRawRange ();
+ getSelection ().set (getEntryGroup ().getFeaturesInRange (raw_range));
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+ }
+ }
+
+ /**
+ * This method sends an GotoEvent to all the GotoEvent listeners that will
+ * make the given base visible.
+ **/
+ private void makeBaseVisible (final Marker base_marker) {
+ goto_event_source.gotoBase (base_marker);
+ }
+
+ /**
+ * Return the EntryGroup that was passed to the constructor.
+ **/
+ private EntryGroup getEntryGroup () {
+ return entry_group;
+ }
+
+ /**
+ * The EntryGroup object that was passed to the constructor.
+ **/
+ private EntryGroup entry_group;
+
+ /**
+ * The GotoEventSource object that was passed to the constructor.
+ **/
+ private GotoEventSource goto_event_source;
+
+ private JMenuItem selector_item = null;
+ private JMenuItem all_item = null;
+ private JMenuItem all_bases_item = null;
+ private JMenuItem none_item = null;
+ private JMenuItem selection_toggle_item = null;
+ private JMenuItem select_same_type_item = null;
+ private JMenuItem select_matching_qualifiers_item = null;
+ private JMenuItem select_features_in_range_item = null;
+ private JMenuItem select_base_range_item = null;
+ private JMenuItem select_aa_range_in_feature_item = null;
+ private JMenuItem select_orf_item = null;
+ private JMenuItem select_by_key_item = null;
+ private JMenuItem select_non_pseudo_cds_item = null;
+ private JMenuItem select_all_cds_item = null;
+}
diff --git a/uk/ac/sanger/artemis/components/SelectionInfoDisplay.java b/uk/ac/sanger/artemis/components/SelectionInfoDisplay.java
new file mode 100644
index 000000000..d21cde661
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/SelectionInfoDisplay.java
@@ -0,0 +1,435 @@
+/* SelectionInfoDisplay.java
+ *
+ * created: Tue Dec 15 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/SelectionInfoDisplay.java,v 1.1 2004-06-09 09:47:40 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import uk.ac.sanger.artemis.io.StreamQualifier;
+import uk.ac.sanger.artemis.io.QualifierInfo;
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.io.Qualifier;
+import uk.ac.sanger.artemis.io.QualifierVector;
+import uk.ac.sanger.artemis.io.Range;
+import uk.ac.sanger.artemis.util.OutOfRangeException;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.util.Vector;
+
+import javax.swing.*;
+
+/**
+ * This class displays information about the selection in a Label.
+ *
+ * @author Kim Rutherford
+ * @version $Id: SelectionInfoDisplay.java,v 1.1 2004-06-09 09:47:40 tjc Exp $
+ **/
+public class SelectionInfoDisplay extends CanvasPanel
+ implements SelectionChangeListener {
+ /**
+ * Create a new SelectionInfoDisplay component.
+ * @param entry_group The EntryGroup that this component will display.
+ * @param selection The Selection that this component will display.
+ **/
+ public SelectionInfoDisplay (final EntryGroup entry_group,
+ final Selection selection) {
+ this.entry_group = entry_group;
+ this.selection = selection;
+
+ getSelection ().addSelectionChangeListener (this);
+
+ getCanvas ().addComponentListener (new ComponentAdapter () {
+ public void componentResized(ComponentEvent e) {
+ getCanvas ().setSize (getCanvas ().getSize ().width,
+ getFontHeight () + 1);
+ getCanvas ().repaint ();
+ }
+ public void componentShown (ComponentEvent e) {
+ getCanvas ().setSize (getCanvas ().getSize ().width,
+ getFontHeight () + 1);
+ getCanvas ().repaint ();
+ }
+ });
+
+ int canvas_width = getCanvas ().getSize ().width;
+
+ setBackground (Color.white);
+
+ setSize (100, getFontHeight ());
+ }
+
+ /**
+ *
+ **/
+ public Dimension getPreferredSize () {
+ return new Dimension (10, getFontHeight ());
+ }
+
+ /**
+ *
+ **/
+ public Dimension getMinimumSize () {
+ return new Dimension (10, getFontHeight ());
+ }
+
+ /**
+ * Implementation of the SelectionChangeListener interface. We listen to
+ * SelectionChange events so that we can update the list to reflect the
+ * current selection.
+ **/
+ public void selectionChanged (SelectionChangeEvent event) {
+ repaintCanvas ();
+ }
+
+ /**
+ * Draw the label.
+ **/
+ public void paintCanvas (final Graphics g) {
+ if (!isVisible ()) {
+ return;
+ }
+
+ final FeatureVector features = getSelection ().getAllFeatures ();
+
+ final StringBuffer new_text = new StringBuffer ();
+
+ new_text.append (markerRangeText (getSelection (), entry_group));
+
+ int base_total = 0;
+ int aa_total = 0;
+ boolean saw_a_non_cds = false;
+
+ if (features.size () > 0) {
+ final StringBuffer feature_names = new StringBuffer ();
+
+ if (features.size () < 100) {
+ if (features.size () > 1) {
+ feature_names.append (" (");
+ }
+
+ // show up to 10 features
+ for (int i = 0 ; i < features.size () ; ++i) {
+ final Feature current_feature = features.elementAt (i);
+
+ base_total += current_feature.getBaseCount ();
+
+ aa_total += current_feature.getAACount ();
+
+ if (!current_feature.getKey ().equals ("CDS")) {
+ saw_a_non_cds = true;
+ }
+
+ if (i < 10) {
+ if (i != 0) {
+ feature_names.append (' ');
+ }
+ feature_names.append (current_feature.getIDString ());
+ }
+ }
+
+ if (features.size () > 10) {
+ feature_names.append ("...");
+ }
+
+ if (features.size () == 1) {
+ // only one feature so append some qualifiers
+ feature_names.append (" (");
+ feature_names.append (getQualifierString (features.elementAt (0)));
+ }
+ feature_names.append (")");
+
+ }
+
+ if (features.size () == 1) {
+ new_text.append ("Selected feature: ");
+ } else {
+ new_text.append (features.size () + " selected features ");
+ }
+
+ if (features.size () < 100) {
+ // show a count of the number of bases and amino acids in the selected
+ // feature
+ if (features.size () > 1) {
+ new_text.append ("total bases " + base_total);
+
+ if (!saw_a_non_cds) {
+ new_text.append (" total amino acids " + aa_total);
+ }
+ } else {
+ if (features.size () == 1) {
+ new_text.append ("bases " + base_total);
+
+ if (!saw_a_non_cds) {
+ new_text.append (" amino acids " + aa_total);
+ }
+ }
+ }
+ }
+
+ new_text.append (" ");
+
+ new_text.append (feature_names);
+ }
+
+
+ String text = new_text.toString ();
+
+ if (text.length () > 0) {
+ if (text.length () > 150) {
+ // call substring () just to keep the String a sensible length
+ text = text.substring (0, 150);
+ }
+ } else {
+ text = "Nothing selected";
+ }
+
+ g.setColor (new Color (230, 230, 230));
+
+ g.fillRect (0, 0, getCanvasWidth (), getCanvasHeight ());
+
+ g.setColor (Color.black);
+
+ g.drawString (text, 2, getFontMaxAscent () + 1);
+ }
+
+ /**
+ * Return a String containing the qualifiers (except the /note) of given
+ * feature.
+ **/
+ private String getQualifierString (final Feature feature) {
+ final QualifierVector qualifiers = feature.getQualifiers ();
+
+ // if we see a /note or /fasta_file it gets saved for later
+ final Vector saved_qualifiers = new Vector ();
+
+ final StringBuffer string_buffer = new StringBuffer ();
+
+ final EntryInformation entry_information =
+ feature.getEntry ().getEntryInformation ();
+
+ for (int i = 0 ; i < qualifiers.size () ; ++i) {
+ final Qualifier this_qualifier = qualifiers.elementAt (i);
+
+ if (this_qualifier.getName ().equals ("note") ||
+ this_qualifier.getName ().endsWith ("_file")) {
+ // save the qualifier and put it last
+ saved_qualifiers.addElement (this_qualifier);
+ continue;
+ }
+
+ if (string_buffer.length () > 0) {
+ // put spaces between the qualifiers
+ string_buffer.append (' ');
+ }
+
+ final QualifierInfo qualifier_info =
+ entry_information.getQualifierInfo (this_qualifier.getName ());
+
+ string_buffer.append (StreamQualifier.toString (qualifier_info,
+ this_qualifier));
+ }
+
+ for (int i = 0 ; i < saved_qualifiers.size () ; ++i) {
+ if (string_buffer.length () > 0) {
+ // put spaces between the qualifiers
+ string_buffer.append (' ');
+ }
+
+ final Qualifier this_qualifier =
+ (Qualifier) saved_qualifiers.elementAt (i);
+
+ final QualifierInfo qualifier_info =
+ entry_information.getQualifierInfo (this_qualifier.getName ());
+
+ string_buffer.append (StreamQualifier.toString (qualifier_info,
+ this_qualifier));
+ }
+
+ return string_buffer.toString ();
+ }
+
+ /**
+ * If the selection contains a MarkerRange (a range of bases) then return a
+ * String in this form: "Selected Bases on forward strand: <start>..<end> ",
+ * otherwise return "". This method is also used by the SelectionViewer
+ * class.
+ * @param current_selection The selection to summarize.
+ * @param entry_group The EntryGroup that the selection refers to.
+ **/
+ static String markerRangeText (final Selection current_selection,
+ final EntryGroup entry_group) {
+ final MarkerRange marker_range = current_selection.getMarkerRange ();
+
+ if (marker_range == null) {
+ return "";
+ } else {
+ final StringBuffer buffer = new StringBuffer ();
+
+ final int start_pos = marker_range.getStart ().getPosition ();
+ final int end_pos = marker_range.getEnd ().getPosition ();
+
+ if (marker_range.getStrand ().isForwardStrand ()) {
+ if (start_pos == end_pos) {
+ buffer.append ("One selected base on forward strand: " +
+ start_pos + " ");
+ } else {
+ buffer.append ((end_pos - start_pos + 1) +
+ " selected bases on forward strand: " +
+ start_pos + ".." + end_pos + " ");
+ }
+ } else {
+ if (start_pos == end_pos) {
+ buffer.append ("One selected base on reverse strand: " +
+ marker_range.getStart ().getPosition () +
+ " = complement (" +
+ marker_range.getEnd ().getRawPosition () + ") ");
+ } else {
+ buffer.append ((end_pos - start_pos + 1) +
+ " selected bases on reverse strand: " +
+ marker_range.getStart ().getPosition () + ".." +
+ marker_range.getEnd ().getPosition () +
+ " = complement (" +
+ marker_range.getEnd ().getRawPosition () + ".." +
+ marker_range.getStart ().getRawPosition () + ") ");
+ }
+ }
+
+ if (marker_range.getCount () >= 3) {
+ // check if this codon is in a feature
+
+ final Range raw_range = marker_range.getRawRange ();
+
+ final FeatureVector features;
+
+ try {
+ features = entry_group.getFeaturesInRange (raw_range);
+ } catch (OutOfRangeException e) {
+ return "illegal marker range";
+ }
+
+ for (int i = 0 ; i < features.size () ; ++i) {
+ final Feature this_feature = features.elementAt (i);
+
+ if (!this_feature.isProteinFeature ()) {
+ // only display protein features
+ continue;
+ }
+
+ if (marker_range.isForwardMarker () !=
+ this_feature.isForwardFeature ()) {
+ // only display feature positions in features on the same strand
+ // as the selected bases
+ continue;
+ }
+
+ final String this_feature_id = this_feature.getIDString ();
+
+ final Marker start_marker = marker_range.getStart ();
+
+ final Marker end_marker = marker_range.getEnd ();
+
+ final int start_position_in_feature =
+ this_feature.getFeaturePositionFromMarker (start_marker);
+
+ final int start_codon_position =
+ start_position_in_feature - this_feature.getCodonStart () + 1;
+
+ String start_string = null;
+
+ if (start_position_in_feature != -1) {
+ if (start_codon_position % 3 == 0) {
+ start_string = "codon " + (start_codon_position / 3 + 1);
+ }
+ }
+
+ String end_string = null;
+
+ final int end_position_in_feature =
+ this_feature.getFeaturePositionFromMarker (end_marker);
+
+ final int end_codon_position =
+ end_position_in_feature - this_feature.getCodonStart () - 1;
+
+ if (end_position_in_feature != -1) {
+ if (start_codon_position != end_codon_position &&
+ end_codon_position % 3 == 0) {
+ end_string = "codon " + (end_codon_position / 3 + 1);
+ }
+ }
+
+ if (!(start_string == null && end_string == null)) {
+ buffer.append (" (");
+
+ if (start_string != null) {
+ buffer.append (start_string);
+ }
+
+ if (start_string != null && end_string != null) {
+ buffer.append (" to ");
+ }
+
+ if (end_string != null) {
+ buffer.append (end_string);
+ }
+
+ buffer.append (" in feature " + this_feature.getIDString () +
+ ") ");
+ }
+ }
+ }
+
+ return buffer.append (" ").toString ();
+ }
+ }
+
+ /**
+ * Return the Selection reference that was passed to the constructor.
+ **/
+ private Selection getSelection () {
+ return selection;
+ }
+
+ /**
+ * Return the Selection object that was passed to the constructor.
+ **/
+ private EntryGroup getEntryGroup () {
+ return entry_group;
+ }
+
+ /**
+ * The reference of the EntryGroup object that was passed to the
+ * constructor.
+ **/
+ private EntryGroup entry_group;
+
+ /**
+ * This is a reference to the Selection object that created this
+ * component.
+ **/
+ private final Selection selection;
+}
+
diff --git a/uk/ac/sanger/artemis/components/SelectionMenu.java b/uk/ac/sanger/artemis/components/SelectionMenu.java
new file mode 100644
index 000000000..252bd30e3
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/SelectionMenu.java
@@ -0,0 +1,294 @@
+/* SelectionMenu.java
+ *
+ * created: Sun Jan 10 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 1998,1999,2000,2001,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/SelectionMenu.java,v 1.1 2004-06-09 09:47:44 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.sequence.MarkerRange;
+import uk.ac.sanger.artemis.*;
+
+import java.awt.event.*;
+import javax.swing.*;
+
+/**
+ * This a super class for EditMenu, ViewMenu and GotoMenu. It is a JMenu that
+ * knows how to get hold of the Selection. It also has the method
+ * getParentFrame() to find the owning JFrame of the menu.
+ *
+ * @author Kim Rutherford
+ * @version $Id: SelectionMenu.java,v 1.1 2004-06-09 09:47:44 tjc Exp $
+ **/
+
+public class SelectionMenu extends JMenu
+{
+
+ /** The Selection that was passed to the constructor. */
+ /* final */ private Selection selection;
+
+ /** The JFrame reference that was passed to the constructor. */
+ private JFrame frame = null;
+
+ /**
+ * Create a new SelectionMenu object.
+ * @param frame The JFrame that owns this JMenu.
+ * @param name The string to use as the menu title.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ **/
+ public SelectionMenu(final JFrame frame,
+ final String menu_name,
+ final Selection selection)
+ {
+ super(menu_name);
+ this.frame = frame;
+ this.selection = selection;
+ }
+
+ /**
+ * Return the JFrame that was passed to the constructor.
+ **/
+ public JFrame getParentFrame()
+ {
+ return frame;
+ }
+
+ /**
+ * Check that the are some Features in the current selection. If there are
+ * some features then return true. If there are no features selected then
+ * popup a message saying so and return false.
+ **/
+ protected boolean checkForSelectionFeatures()
+ {
+ return checkForSelectionFeatures(getParentFrame(), getSelection());
+ }
+
+ /**
+ * Check that the are some Features in the given selection. If there are
+ * some features then return true. If there are no features selected then
+ * popup a message saying so and return false.
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The selected features to check.
+ **/
+ static boolean checkForSelectionFeatures(final JFrame frame,
+ final Selection selection)
+ {
+ final FeatureVector features_to_check = selection.getAllFeatures();
+
+ if(features_to_check.size() == 0)
+ {
+ new MessageDialog(frame, "No features selected");
+ return false;
+ }
+ else
+ return true;
+ }
+
+ /**
+ * Check that the are some Features in the current selection and that the
+ * selection isn't too big. If there is more than one feature in the
+ * selection and less than the given maximum then return true. If there
+ * are no features selected then popup a message saying so and return
+ * false. If there are more selected features than the given maximum
+ * than display the message in a YesNoDialog component and return the
+ * result of the dialog.
+ **/
+ protected boolean checkForSelectionFeatures(final int maximum_size,
+ final String message)
+ {
+ return checkForSelectionFeatures(getParentFrame(), getSelection(),
+ maximum_size, message);
+ }
+
+ /**
+ * Check that the are some Features in the given selection and that the
+ * selection isn't too big. If there is more than one feature in the
+ * selection and less than the given maximum then return true. If there
+ * are no features selected then popup a message saying so and return
+ * false. If there are more selected features than the given maximum
+ * than display the message in a YesNoDialog component and return the
+ * result of the dialog.
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The selected features to check.
+ **/
+ static boolean checkForSelectionFeatures(final JFrame frame,
+ final Selection selection,
+ final int maximum_size,
+ final String message)
+ {
+ final FeatureVector features_to_check = selection.getAllFeatures();
+
+ if(features_to_check.size() == 0)
+ {
+ new MessageDialog(frame, "No features selected");
+ return false;
+ }
+ else
+ {
+ if(features_to_check.size() > maximum_size)
+ {
+ final YesNoDialog dialog =
+ new YesNoDialog(frame, message);
+
+ return dialog.getResult();
+ }
+ else
+ return true;
+ }
+ }
+
+ /**
+
+ * Check that there are only CDS features in the given selection, that there
+ * are some features selected and that the selection isn't too big. If
+ * there is more than one feature in the selection and less than the given
+ * maximum then return true. If there are no features selected then popup
+ * a message saying so and return false. If there are more selected
+ * features than the given maximum than display the message in a
+ * YesNoDialog component and return the result of the dialog.
+ * @param frame The Frame to use for MessageDialog components.
+ * @param selection The selected features to check.
+ **/
+ static boolean checkForSelectionCDSFeatures(final JFrame frame,
+ final Selection selection,
+ final int maximum_size,
+ final String max_message)
+ {
+ final FeatureVector features_to_check = selection.getAllFeatures();
+
+ if(features_to_check.size() == 0)
+ {
+ new MessageDialog(frame, "No CDS features selected");
+ return false;
+ }
+ else
+ {
+ for(int i = 0 ; i < features_to_check.size() ; ++i)
+ {
+ final Feature this_feature = features_to_check.elementAt(i);
+ if(!this_feature.isCDS())
+ {
+ final String message =
+ "a non-CDS feature(" + this_feature.getIDString() +
+ ") is selected - can't continue";
+ final MessageDialog dialog =
+ new MessageDialog(frame, message);
+ return false;
+ }
+ }
+
+ if(features_to_check.size() > maximum_size)
+ {
+ final YesNoDialog dialog =
+ new YesNoDialog(frame, max_message);
+
+ return dialog.getResult();
+ }
+ else
+ return true;
+ }
+ }
+
+ /**
+ * Check that the are some FeatureSegments in the current selection and
+ * that the selection isn't too big. If there is more than one
+ * FeatureSegments in the selection and less than the given maximum then
+ * return true. If there are no FeatureSegments selected then popup a
+ * message saying so and return false. If there are more selected
+ * FeatureSegments than the given maximum than display the message in a
+ * YesNoDialog component and return the result of the dialog.
+ **/
+ protected boolean checkForSelectionFeatureSegments(final int maximum_size,
+ final String message)
+ {
+ final FeatureSegmentVector segments_to_check =
+ getSelection().getSelectedSegments();
+
+ if(segments_to_check.size() == 0)
+ {
+ new MessageDialog(getParentFrame(), "No exons selected");
+ return false;
+ }
+ else
+ {
+ if(segments_to_check.size() > maximum_size)
+ {
+ final YesNoDialog dialog =
+ new YesNoDialog(getParentFrame(), message);
+
+ return dialog.getResult();
+ }
+ else
+ return true;
+ }
+ }
+
+ /**
+ * Check that the current selection contains a MarkerRange. If it does
+ * then return true. If not then popup a message saying so and return
+ * false.
+ **/
+ protected boolean checkForSelectionRange()
+ {
+ return checkForSelectionRange(getParentFrame(), getSelection());
+ }
+
+ /**
+ * Check that the current selection contains a MarkerRange. If it does
+ * then return true. If not then popup a message saying so and return
+ * false.
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The selected features to check.
+ **/
+ static boolean checkForSelectionRange(final JFrame frame,
+ final Selection selection)
+ {
+ final MarkerRange marker_range = selection.getMarkerRange();
+
+ if(marker_range == null)
+ {
+ new MessageDialog(frame, "No bases selected");
+ return false;
+ }
+ else
+ return true;
+ }
+
+ /**
+ * Return the Selection object that was passed to the constructor.
+ **/
+ protected Selection getSelection()
+ {
+ return selection;
+ }
+
+ /**
+ *
+ **/
+ protected static KeyStroke makeMenuKeyStroke(final int key_code)
+ {
+ return KeyStroke.getKeyStroke(key_code, InputEvent.CTRL_MASK);
+ }
+
+}
+
diff --git a/uk/ac/sanger/artemis/components/SelectionViewer.java b/uk/ac/sanger/artemis/components/SelectionViewer.java
new file mode 100644
index 000000000..4db4a3ca0
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/SelectionViewer.java
@@ -0,0 +1,352 @@
+/* SelectionViewer.java
+ *
+ * created: Thu Mar 4 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/SelectionViewer.java,v 1.1 2004-06-09 09:47:45 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.util.StringVector;
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.io.*;
+
+/**
+ * This component displays the current selection in a FileViewer component.
+ *
+ * @author Kim Rutherford
+ * @version $Id: SelectionViewer.java,v 1.1 2004-06-09 09:47:45 tjc Exp $
+ **/
+
+public class SelectionViewer
+ implements SelectionChangeListener, EntryGroupChangeListener {
+ /**
+ * Create a new SelectionViewer object from the given Selection.
+ **/
+ public SelectionViewer (final Selection selection,
+ final EntryGroup entry_group) {
+ file_viewer = new FileViewer ("Artemis Selection View");
+
+ this.selection = selection;
+ this.entry_group = entry_group;
+
+ readSelection ();
+
+ selection.addSelectionChangeListener (this);
+
+ file_viewer.addWindowListener (new WindowAdapter () {
+ public void windowClosed (WindowEvent event) {
+ stopListening ();
+ }
+ });
+
+ entry_group.addEntryGroupChangeListener (this);
+ }
+
+ /**
+ * Remove this object as a selection change listener.
+ **/
+ public void stopListening () {
+ selection.removeSelectionChangeListener (this);
+ entry_group.removeEntryGroupChangeListener (this);
+ }
+
+ /**
+ * Implementation of the SelectionChangeListener interface. We listen to
+ * SelectionChange events so that we can update the view to reflect the
+ * current selection.
+ **/
+ public void selectionChanged (SelectionChangeEvent event) {
+ readSelection ();
+ }
+
+ /**
+ * Implementation of the EntryGroupChangeListener interface. We listen to
+ * EntryGroupChange events so that we can get rid of the JFrame when the
+ * EntryGroup is no longer in use (for example when the EntryEdit is
+ * closed).
+ **/
+ public void entryGroupChanged (final EntryGroupChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryGroupChangeEvent.DONE_GONE:
+ entry_group.removeEntryGroupChangeListener (this);
+ file_viewer.dispose ();
+ break;
+ }
+ }
+
+ /**
+ * Read the selection into this SelectionViewer object.
+ **/
+ public void readSelection () {
+ final String base_selection_text =
+ SelectionInfoDisplay.markerRangeText (selection, entry_group);
+
+ final FeatureVector selection_features = selection.getAllFeatures ();
+
+ final StringBuffer buffer = new StringBuffer ();
+
+ final int MAX_FEATURES = 50;
+
+ if (selection_features.size () > MAX_FEATURES) {
+ buffer.append ("first " + MAX_FEATURES + " features:\n\n");
+ }
+
+ for (int i = 0 ; i < selection_features.size () && i < 50 ; ++i) {
+ buffer.append (selection_features.elementAt (i).toString ());
+ }
+
+ if (selection_features.size () > 0) {
+ buffer.append ("\n");
+ }
+
+ if (base_selection_text != null && base_selection_text.length () > 0) {
+ buffer.append (base_selection_text).append ("\n\n");
+ }
+
+
+ // this is the maximum number of bases to show
+ final int display_base_count;
+
+ // this is the maximum number of residues to show
+ final int display_residues_count;
+
+ if (selection_features.size () == 0) {
+ display_base_count = 2000;
+ display_residues_count = 1000;
+ } else {
+ display_base_count = 600;
+ display_residues_count = 300;
+ }
+
+
+ final String selection_bases = selection.getSelectedBases ();
+
+ if (selection_bases != null && selection_bases.length () > 0) {
+ final StringVector base_summary = getBaseSummary (selection_bases);
+
+ for (int i = 0 ; i < base_summary.size () ; ++i) {
+ buffer.append (base_summary.elementAt (i)).append ("\n");
+ }
+ }
+
+ if (selection_features.size () == 1) {
+ double score =
+ selection_features.elementAt (0).get12CorrelationScore ();
+
+ score = Math.round (score * 100) / 100.0;
+
+ buffer.append ("\nCorrelation score of the selected feature: " +
+ score + "\n");
+ }
+
+ buffer.append ("\n");
+
+ if (selection_features.size () > 1) {
+ double correlation_score_total = 0;
+
+ double max_gc_content = -999;
+ double min_gc_content = 999;
+
+ double max_correlation_score = -999999;
+ double min_correlation_score = 999999;
+
+ for (int i = 0; i < selection_features.size () ; ++i) {
+ final Feature this_feature = selection_features.elementAt (i);
+
+ final double correlation_score = this_feature.get12CorrelationScore ();
+ final double gc_content = this_feature.getPercentGC ();
+
+ correlation_score_total += correlation_score;
+
+ if (min_correlation_score > correlation_score) {
+ min_correlation_score = correlation_score;
+ }
+
+ if (max_correlation_score < correlation_score) {
+ max_correlation_score = correlation_score;
+ }
+
+ if (min_gc_content > gc_content) {
+ min_gc_content = gc_content;
+ }
+
+ if (max_gc_content < gc_content) {
+ max_gc_content = gc_content;
+ }
+ }
+
+ min_gc_content = Math.round (min_gc_content * 100) / 100.0;
+ max_gc_content = Math.round (max_gc_content * 100) / 100.0;
+ min_correlation_score = Math.round (min_correlation_score * 100) / 100.0;
+ max_correlation_score = Math.round (max_correlation_score * 100) / 100.0;
+
+ final double correlation_score_average =
+ Math.round (correlation_score_total / selection_features.size () *
+ 100) / 100.0;
+
+ buffer.append ("Average correlation score of the selected features: " +
+ correlation_score_average + "\n\n");
+
+ buffer.append ("Min GC percentage of the selected features: " +
+ min_gc_content + "\n");
+ buffer.append ("Max GC percentage of the selected features: " +
+ max_gc_content + "\n");
+ buffer.append ("\n");
+ buffer.append ("Min correlation score of the selected features: " +
+ min_correlation_score + "\n");
+ buffer.append ("Max correlation score of the selected features: " +
+ max_correlation_score + "\n");
+ buffer.append ("\n");
+ }
+
+
+ if (selection_bases.length () > 0 && selection_features.size () <= 1) {
+ if (selection_bases.length () > display_base_count) {
+ // display the first display_base_count/2 bases and the last
+ // display_base_count/2 bases
+ buffer.append ("first " + display_base_count / 2 +
+ " bases of selection:\n");
+ final String start_sub_string =
+ selection_bases.substring (0, display_base_count / 2);
+ buffer.append (start_sub_string).append ("\n\n");
+ buffer.append ("last " + display_base_count / 2 +
+ " bases of selection:\n");
+ final String sub_string =
+ selection_bases.substring (selection_bases.length () -
+ display_base_count / 2);
+ buffer.append (sub_string).append ("\n\n");
+ } else {
+ buffer.append ("bases of selection:\n");
+ buffer.append (selection_bases).append ("\n\n");
+ }
+
+ if (selection_bases.length () >= 3) {
+ final int residues_to_display;
+
+ if (selection_bases.length () / 3 < display_residues_count) {
+ residues_to_display = selection_bases.length () / 3;
+
+ buffer.append ("translation of the selected bases:\n");
+ } else {
+ residues_to_display = display_residues_count;
+
+ buffer.append ("translation of the first " +
+ display_residues_count * 3 +
+ " selected bases:\n");
+ }
+
+ final String residue_bases =
+ selection_bases.substring (0, residues_to_display * 3);
+
+ final String residues =
+ AminoAcidSequence.getTranslation (residue_bases, true).toString ();
+
+ buffer.append (residues.toUpperCase ()).append ("\n\n");
+ }
+ }
+
+ file_viewer.setText (buffer.toString ());
+ }
+
+ /**
+ * Return a summary of the base content of the given String. The return
+ * value is a StringVector containing each line to be output. We return a
+ * vector so that the caller can do things like indenting the lines.
+ * @return null if the bases String is empty or null
+ **/
+ public static StringVector getBaseSummary (final String bases) {
+ if (bases == null || bases.length () == 0) {
+ return null;
+ }
+
+ final StringVector return_vector = new StringVector ();
+
+ long counts [] = new long [257];
+
+ for (int i = 0 ; i < bases.length () ; ++i) {
+ final char this_char = bases.charAt (i);
+
+ if (this_char > 255) {
+ // don't know what this is, but it isn't a base
+ ++counts[256];
+ } else {
+ ++counts[this_char];
+ }
+ }
+
+ for (int i = 0 ; i < 256 ; ++i) {
+ if (counts[i] > 0) {
+ return_vector.add (new String (Character.toUpperCase ((char)i) +
+ " content: " + counts[i] +
+ " (" + 10000 * counts[i] /
+ bases.length () / 100.0 + "%)"));
+ }
+ }
+
+ final long non_ambiguous_base_count =
+ counts['g'] + counts['c'] + counts['a'] + counts['t'];
+
+ if (non_ambiguous_base_count == bases.length ()) {
+ return_vector.add ("(no ambiguous bases)");
+ }
+
+ return_vector.add ("");
+
+ return_vector.add (new String ("GC percentage: " +
+ (Math.round (100.0 *
+ (counts['g'] + counts['c']) /
+ bases.length () * 100) /
+ 100.0)));
+
+ if (non_ambiguous_base_count > 0 &&
+ non_ambiguous_base_count < bases.length ()) {
+ return_vector.add (new String ("GC percentage of non-ambiguous bases: " +
+ (Math.round (100.0 * (counts['g'] +
+ counts['c']) /
+ non_ambiguous_base_count *
+ 100) / 100.0)));
+ }
+
+ return return_vector;
+ }
+
+ /**
+ * This is the selection object that we are viewing.
+ **/
+ final private Selection selection;
+
+ /**
+ * The FileViewer object that is displaying the selection.
+ **/
+ final private FileViewer file_viewer;
+
+ /**
+ * The EntryGroup that was passed to the constructor.
+ **/
+ final EntryGroup entry_group;
+}
+
+
diff --git a/uk/ac/sanger/artemis/components/Selector.java b/uk/ac/sanger/artemis/components/Selector.java
new file mode 100644
index 000000000..d9dcd942b
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/Selector.java
@@ -0,0 +1,885 @@
+/* Selector.java
+ *
+ * created: Tue Apr 11 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000,2001,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/Selector.java,v 1.1 2004-06-09 09:47:46 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.AminoAcidSequence;
+
+import uk.ac.sanger.artemis.io.EntryInformation;
+import uk.ac.sanger.artemis.util.StringVector;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * This component allows the user to set the selection by filtering the
+ * features in an EntryGroup on key and contents.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: Selector.java,v 1.1 2004-06-09 09:47:46 tjc Exp $
+ **/
+
+public class Selector extends JFrame
+ implements EntryGroupChangeListener {
+ /**
+ * Create a new Selector that van set the given Selection.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param entry_group The component will choose features from this
+ * EntryGroup.
+ * @param goto_event_source The object the we will call gotoBase () on.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public Selector (final Selection selection,
+ final GotoEventSource goto_event_source,
+ final EntryGroup entry_group,
+ final BasePlotGroup base_plot_group) {
+ super ("Artemis Feature Selector");
+
+ this.selection = selection;
+ this.entry_group = entry_group;
+
+ final Font default_font = Options.getOptions ().getFont ();
+
+ setFont (default_font);
+
+ GridBagLayout gridbag = new GridBagLayout();
+ getContentPane ().setLayout (gridbag);
+
+ GridBagConstraints c = new GridBagConstraints();
+
+ c.fill = GridBagConstraints.HORIZONTAL;
+ c.anchor = GridBagConstraints.WEST;
+ c.weighty = 0;
+ c.gridwidth = GridBagConstraints.REMAINDER;
+
+ final JLabel top_label = new JLabel ("Select by:");
+ gridbag.setConstraints (top_label, c);
+ getContentPane ().add (top_label);
+
+
+ by_key_button = new JCheckBox ("Key: ", false);
+ final JPanel by_key_panel = new JPanel ();
+ by_key_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ by_key_panel.add (by_key_button);
+ c.gridwidth = 2;
+ gridbag.setConstraints (by_key_panel, c);
+ getContentPane ().add (by_key_panel);
+
+ final EntryInformation default_entry_information =
+ Options.getArtemisEntryInformation ();
+
+ key_selector = new KeyChoice (default_entry_information);
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (key_selector, c);
+ getContentPane ().add (key_selector);
+
+ key_selector.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent _) {
+ by_key_button.setSelected (true);
+ }
+ });
+
+ by_key_button.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent e) {
+ if (!by_key_button.isSelected ()) {
+ by_qualifier_button.setSelected (false);
+ }
+ }
+ });
+
+
+ by_qualifier_button = new JCheckBox ("Qualifier: ", false);
+ final JPanel by_qualifier_panel = new JPanel ();
+ by_qualifier_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ by_qualifier_panel.add (by_qualifier_button);
+ c.gridwidth = 2;
+ gridbag.setConstraints (by_qualifier_panel, c);
+ getContentPane ().add (by_qualifier_panel);
+
+ qualifier_selector = new QualifierChoice (default_entry_information,
+ key_selector.getSelectedItem (),
+ null);
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (qualifier_selector, c);
+ getContentPane ().add (qualifier_selector);
+
+ qualifier_selector.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent _) {
+ by_qualifier_button.setSelected (true);
+ by_key_button.setSelected (true);
+ }
+ });
+
+ key_selector.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent _) {
+ qualifier_selector.setKey (key_selector.getSelectedItem ());
+ }
+ });
+
+ by_qualifier_button.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent e) {
+ if (by_qualifier_button.isSelected ()) {
+ if (!by_key_button.isSelected ()) {
+ by_key_button.setSelected (true);
+ }
+ }
+ }
+ });
+
+
+ final JLabel qualifier_text_label =
+ new JLabel (" Containing this text: ");
+ c.gridwidth = 2;
+ gridbag.setConstraints (qualifier_text_label, c);
+ getContentPane ().add (qualifier_text_label);
+
+ qualifier_text = new JTextField ("", 18);
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (qualifier_text, c);
+ getContentPane ().add (qualifier_text);
+
+
+ ignore_case_checkbox = new JCheckBox ("Ignore Case", true);
+
+ final JPanel ignore_case_panel = new JPanel ();
+
+ ignore_case_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ ignore_case_panel.add (ignore_case_checkbox);
+
+ c.gridwidth = 2;
+ gridbag.setConstraints (ignore_case_panel, c);
+ getContentPane ().add (ignore_case_panel);
+
+
+ partial_match_checkbox = new JCheckBox ("Allow Partial Match", true);
+
+ final JPanel partial_match_panel = new JPanel ();
+
+ partial_match_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ partial_match_panel.add (partial_match_checkbox);
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (partial_match_panel, c);
+ getContentPane ().add (partial_match_panel);
+
+
+ match_any_word_checkbox = new JCheckBox ("Match Any Word", false);
+
+ final JPanel match_any_word_panel = new JPanel ();
+
+ match_any_word_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ match_any_word_panel.add (match_any_word_checkbox);
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (match_any_word_panel, c);
+ getContentPane ().add (match_any_word_panel);
+
+
+ {
+ // leave a blank line to give the user a visual clue
+ final JLabel blank_label = new JLabel ("");
+
+ gridbag.setConstraints (blank_label, c);
+ getContentPane ().add (blank_label);
+
+ final JLabel and_label = new JLabel ("And:");
+
+ gridbag.setConstraints (and_label, c);
+ getContentPane ().add (and_label);
+ }
+
+
+ less_than_bases_button = new JCheckBox ("Up to: ", false);
+ final JPanel less_than_bases_panel = new JPanel ();
+ less_than_bases_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ less_than_bases_panel.add (less_than_bases_button);
+ c.gridwidth = 3;
+ gridbag.setConstraints (less_than_bases_panel, c);
+ getContentPane ().add (less_than_bases_panel);
+
+ less_than_bases_text = new JTextField ("", 18);
+
+ gridbag.setConstraints (less_than_bases_text, c);
+ getContentPane ().add (less_than_bases_text);
+
+ final JLabel less_than_bases_label = new JLabel (" bases long");
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (less_than_bases_label, c);
+ getContentPane ().add (less_than_bases_label);
+
+ {
+ // leave a blank line to give the user a visual clue
+ final JLabel blank_label = new JLabel ("");
+
+ gridbag.setConstraints (blank_label, c);
+ getContentPane ().add (blank_label);
+
+ final JLabel and_label = new JLabel ("And:");
+
+ gridbag.setConstraints (and_label, c);
+ getContentPane ().add (and_label);
+ }
+
+
+ greater_than_bases_button = new JCheckBox ("At least: ", false);
+ final JPanel greater_than_bases_panel = new JPanel ();
+ greater_than_bases_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ greater_than_bases_panel.add (greater_than_bases_button);
+ c.gridwidth = 2;
+ gridbag.setConstraints (greater_than_bases_panel, c);
+ getContentPane ().add (greater_than_bases_panel);
+
+ greater_than_bases_text = new JTextField ("", 18);
+
+ gridbag.setConstraints (greater_than_bases_text, c);
+ getContentPane ().add (greater_than_bases_text);
+
+ final JLabel greater_than_bases_label = new JLabel (" bases long");
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (greater_than_bases_label, c);
+ getContentPane ().add (greater_than_bases_label);
+
+ {
+ // leave a blank line to give the user a visual clue
+ final JLabel blank_label = new JLabel ("");
+
+ gridbag.setConstraints (blank_label, c);
+ getContentPane ().add (blank_label);
+
+ final JLabel and_label = new JLabel ("And:");
+
+ gridbag.setConstraints (and_label, c);
+ getContentPane ().add (and_label);
+ }
+
+ less_than_exons_button = new JCheckBox ("Up to: ", false);
+ final JPanel less_than_exons_panel = new JPanel ();
+ less_than_exons_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ less_than_exons_panel.add (less_than_exons_button);
+ c.gridwidth = 3;
+ gridbag.setConstraints (less_than_exons_panel, c);
+ getContentPane ().add (less_than_exons_panel);
+
+ less_than_exons_text = new JTextField ("", 18);
+
+ gridbag.setConstraints (less_than_exons_text, c);
+ getContentPane ().add (less_than_exons_text);
+
+ final JLabel less_than_exons_label = new JLabel (" exons long");
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (less_than_exons_label, c);
+ getContentPane ().add (less_than_exons_label);
+
+ {
+ // leave a blank line to give the user a visual clue
+ final JLabel blank_label = new JLabel ("");
+
+ gridbag.setConstraints (blank_label, c);
+ getContentPane ().add (blank_label);
+
+ final JLabel and_label = new JLabel ("And:");
+
+ gridbag.setConstraints (and_label, c);
+ getContentPane ().add (and_label);
+ }
+
+
+ greater_than_exons_button = new JCheckBox ("At least: ", false);
+ final JPanel greater_than_exons_panel = new JPanel ();
+ greater_than_exons_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ greater_than_exons_panel.add (greater_than_exons_button);
+ c.gridwidth = 2;
+ gridbag.setConstraints (greater_than_exons_panel, c);
+ getContentPane ().add (greater_than_exons_panel);
+
+ greater_than_exons_text = new JTextField ("", 18);
+
+ gridbag.setConstraints (greater_than_exons_text, c);
+ getContentPane ().add (greater_than_exons_text);
+
+ final JLabel greater_than_exons_label = new JLabel (" exons long");
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (greater_than_exons_label, c);
+ getContentPane ().add (greater_than_exons_label);
+
+ {
+ // leave a blank line to give the user a visual clue
+ final JLabel blank_label = new JLabel ("");
+
+ gridbag.setConstraints (blank_label, c);
+ getContentPane ().add (blank_label);
+
+ final JLabel and_label = new JLabel ("And by:");
+
+ gridbag.setConstraints (and_label, c);
+ getContentPane ().add (and_label);
+ }
+
+
+ by_motif_button = new JCheckBox ("Amino acid motif: ", false);
+ final JPanel by_motif_panel = new JPanel ();
+ by_motif_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+ by_motif_panel.add (by_motif_button);
+ c.gridwidth = 2;
+ gridbag.setConstraints (by_motif_panel, c);
+ getContentPane ().add (by_motif_panel);
+
+ motif_text = new JTextField ("", 18);
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (motif_text, c);
+ getContentPane ().add (motif_text);
+
+ {
+ // leave a blank line to give the user a visual clue
+ final JLabel blank_label = new JLabel ("");
+
+ gridbag.setConstraints (blank_label, c);
+ getContentPane ().add (blank_label);
+ }
+
+ final JPanel strand_panel = new JPanel ();
+
+ strand_panel.setLayout (new FlowLayout (FlowLayout.LEFT));
+
+ forward_strand_checkbox = new JCheckBox ("Forward Strand Features", true);
+ strand_panel.add (forward_strand_checkbox);
+ forward_strand_checkbox.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent _) {
+ if (!forward_strand_checkbox.isSelected () &&
+ !reverse_strand_checkbox.isSelected ()) {
+ // make sure one of the strand is always selected
+ reverse_strand_checkbox.setSelected (true);
+ }
+ }
+ });
+
+
+ reverse_strand_checkbox = new JCheckBox ("Reverse Strand Features", true);
+ strand_panel.add (reverse_strand_checkbox);
+ reverse_strand_checkbox.addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent _) {
+ if (!reverse_strand_checkbox.isSelected () &&
+ !forward_strand_checkbox.isSelected ()) {
+ // make sure one of the strand is always selected
+ forward_strand_checkbox.setSelected (true);
+ }
+ }
+ });
+
+
+ c.gridwidth = GridBagConstraints.REMAINDER;
+ gridbag.setConstraints (strand_panel, c);
+ getContentPane ().add (strand_panel);
+
+
+
+
+
+ final JButton select_button = new JButton ("Select");
+
+ select_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ selection.set (getSelected ());
+ }
+ });
+
+ final JButton view_button = new JButton ("View");
+
+ view_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ final FeaturePredicate predicate =
+ new FeatureFromVectorPredicate (getSelected ());
+
+ String title = "All features";
+
+ if (by_key_button.isSelected ()) {
+ title += " with key \"" + key_selector.getSelectedItem () + "\"";
+ }
+
+ if (by_qualifier_button.isSelected ()) {
+ if (qualifier_text.getText ().trim ().length () > 0) {
+ title +=
+ " with qualifier \"" + qualifier_selector.getSelectedItem () +
+ "\" containing text \"" + qualifier_text.getText () + "\"";
+ } else {
+ title +=
+ " with qualifier \"" +
+ qualifier_selector.getSelectedItem () + "\"";
+ }
+ }
+
+ if (forward_strand_checkbox.isSelected () &&
+ !reverse_strand_checkbox.isSelected ()) {
+ title += " on the forward strand";
+ }
+
+ if (!forward_strand_checkbox.isSelected () &&
+ reverse_strand_checkbox.isSelected ()) {
+ title += " on the reverse strand";
+ }
+
+ if (by_motif_button.isSelected ()) {
+ title +=
+ " with motif: " + motif_text.getText ().trim ().toUpperCase ();
+ }
+
+ if (less_than_bases_button.isSelected ()) {
+ title +=
+ " at most " + less_than_bases_text.getText ().trim () +
+ " bases long";
+ }
+
+ if (greater_than_bases_button.isSelected ()) {
+ title +=
+ " at least " + greater_than_bases_text.getText ().trim () +
+ " bases long";
+ }
+
+ if (less_than_exons_button.isSelected ()) {
+ title +=
+ " at most " + less_than_exons_text.getText ().trim () +
+ " exons long";
+ }
+
+ if (greater_than_exons_button.isSelected ()) {
+ title +=
+ " at least " + greater_than_exons_text.getText ().trim () +
+ " exons long";
+ }
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, predicate, title);
+
+ final FeatureListFrame feature_list_frame =
+ new FeatureListFrame (title,
+ getSelection (),
+ goto_event_source, filtered_entry_group,
+ base_plot_group);
+
+ feature_list_frame.setVisible (true);
+ }
+ });
+
+
+ final JButton close_button = new JButton ("Close");
+
+ close_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ Selector.this.dispose ();
+ }
+ });
+
+ final FlowLayout flow_layout =
+ new FlowLayout (FlowLayout.CENTER, 15, 5);
+
+ final JPanel bottom_button_panel = new JPanel (flow_layout);
+
+ bottom_button_panel.add (select_button);
+ bottom_button_panel.add (view_button);
+ bottom_button_panel.add (close_button);
+
+ gridbag.setConstraints (bottom_button_panel, c);
+ getContentPane ().add (bottom_button_panel);
+
+ addWindowListener (new WindowAdapter () {
+ public void windowClosing (WindowEvent event) {
+ getEntryGroup ().removeEntryGroupChangeListener (Selector.this);
+ Selector.this.dispose ();
+ }
+ });
+
+ getEntryGroup ().addEntryGroupChangeListener (this);
+
+ pack ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+
+ setVisible (true);
+ }
+
+ /**
+ * Implementation of the EntryGroupChangeListener interface. We listen to
+ * EntryGroupChange events so that we can get rid of the Navigator when the
+ * EntryGroup is no longer in use (for example when the EntryEdit is
+ * closed).
+ **/
+ public void entryGroupChanged (final EntryGroupChangeEvent event) {
+ switch (event.getType ()) {
+ case EntryGroupChangeEvent.DONE_GONE:
+ getEntryGroup ().removeEntryGroupChangeListener (this);
+ dispose ();
+ break;
+ }
+ }
+
+ /**
+ * Return those features that match the current setting of the Selector.
+ **/
+ private FeatureVector getSelected () {
+ final FeaturePredicate key_and_qualifier_predicate;
+ final FeaturePredicate motif_predicate;
+
+ if (by_key_button.isSelected ()) {
+ if (by_qualifier_button.isSelected ()) {
+ final String search_text = qualifier_text.getText ().trim ();
+ final String qualifier_name =
+ (String) qualifier_selector.getSelectedItem ();
+
+ if (search_text.length () == 0) {
+ key_and_qualifier_predicate =
+ new FeatureKeyQualifierPredicate (key_selector.getSelectedItem (),
+ qualifier_name,
+ true);
+ } else {
+ if (match_any_word_checkbox.isSelected ()) {
+ final FeaturePredicateVector temp_predicates =
+ new FeaturePredicateVector ();
+
+ final StringVector words =
+ StringVector.getStrings (search_text, " \t\n");
+
+ for (int i = 0 ; i < words.size () ; ++i) {
+ final String this_word = words.elementAt (i);
+ final FeaturePredicate new_predicate =
+ new FeatureKeyQualifierPredicate (key_selector.getSelectedItem (),
+ qualifier_name,
+ this_word,
+ partial_match_checkbox.isSelected (),
+ ignore_case_checkbox.isSelected ());
+
+ temp_predicates.add (new_predicate);
+ }
+
+ key_and_qualifier_predicate =
+ new FeaturePredicateConjunction (temp_predicates,
+ FeaturePredicateConjunction.OR);
+ } else {
+ key_and_qualifier_predicate =
+ new FeatureKeyQualifierPredicate (key_selector.getSelectedItem (),
+ qualifier_name,
+ search_text,
+ partial_match_checkbox.isSelected (),
+ ignore_case_checkbox.isSelected ());
+
+ }
+ }
+ } else {
+ final String search_text = qualifier_text.getText ().trim ();
+ if (search_text.length () == 0) {
+ key_and_qualifier_predicate =
+ new FeatureKeyPredicate (key_selector.getSelectedItem ());
+ } else {
+ if (match_any_word_checkbox.isSelected ()) {
+ final FeaturePredicateVector temp_predicates =
+ new FeaturePredicateVector ();
+
+ final StringVector words =
+ StringVector.getStrings (search_text, " \t\n");
+
+
+ for (int i = 0 ; i < words.size () ; ++i) {
+ final String this_word = words.elementAt (i);
+ final FeaturePredicate new_predicate =
+ new FeatureKeyQualifierPredicate (key_selector.getSelectedItem (),
+ null, // match any qialifier
+ this_word,
+ partial_match_checkbox.isSelected (),
+ ignore_case_checkbox.isSelected ());
+ temp_predicates.add (new_predicate);
+ }
+
+ key_and_qualifier_predicate =
+ new FeaturePredicateConjunction (temp_predicates,
+ FeaturePredicateConjunction.OR);
+ } else {
+ key_and_qualifier_predicate =
+ new FeatureKeyQualifierPredicate (key_selector.getSelectedItem (),
+ null, // match any qialifier
+ search_text,
+ partial_match_checkbox.isSelected (),
+ ignore_case_checkbox.isSelected ());
+ }
+ }
+ }
+ } else {
+ key_and_qualifier_predicate = null;
+ }
+
+ if (by_motif_button.isSelected ()) {
+ final AminoAcidSequence amino_acid_sequence =
+ new AminoAcidSequence (motif_text.getText ().trim ());
+
+ motif_predicate =
+ new FeaturePatternPredicate (amino_acid_sequence);
+ } else {
+ motif_predicate = null;
+ }
+
+ FeaturePredicate less_than_bases_predicate = null;
+
+ if (less_than_bases_button.isSelected () &&
+ less_than_bases_text.getText ().trim ().length () > 0) {
+ try {
+ final int less_than_bases_int =
+ Integer.valueOf (less_than_bases_text.getText ().trim ()).intValue ();
+
+ less_than_bases_predicate = new FeaturePredicate () {
+ public boolean testPredicate (final Feature feature) {
+ if (feature.getBaseCount () <= less_than_bases_int) {
+ return true;
+ } else {
+ return false;
+ }
+ }
+ };
+ } catch (NumberFormatException e) {
+ new MessageDialog (this,
+ "warning this is not a number: " +
+ less_than_bases_text.getText ());
+ less_than_bases_predicate = null;
+ }
+ } else {
+ less_than_bases_predicate = null;
+ }
+
+ FeaturePredicate greater_than_bases_predicate = null;
+
+ if (greater_than_bases_button.isSelected () &&
+ greater_than_bases_text.getText ().trim ().length () > 0) {
+ try {
+ final int greater_than_bases_int =
+ Integer.valueOf (greater_than_bases_text.getText ().trim ()).intValue ();
+
+ greater_than_bases_predicate = new FeaturePredicate () {
+ public boolean testPredicate (final Feature feature) {
+ if (feature.getBaseCount () >= greater_than_bases_int) {
+ return true;
+ } else {
+ return false;
+ }
+ }
+ };
+ } catch (NumberFormatException e) {
+ new MessageDialog (this,
+ "warning this is not a number: " +
+ greater_than_bases_text.getText ());
+ greater_than_bases_predicate = null;
+ }
+ } else {
+ greater_than_bases_predicate = null;
+ }
+
+ FeaturePredicate less_than_exons_predicate = null;
+
+ if (less_than_exons_button.isSelected () &&
+ less_than_exons_text.getText ().trim ().length () > 0) {
+ try {
+ final int less_than_exons_int =
+ Integer.valueOf (less_than_exons_text.getText ().trim ()).intValue ();
+
+ less_than_exons_predicate = new FeaturePredicate () {
+ public boolean testPredicate (final Feature feature) {
+ if (feature.getSegments ().size () <= less_than_exons_int) {
+ return true;
+ } else {
+ return false;
+ }
+ }
+ };
+ } catch (NumberFormatException e) {
+ new MessageDialog (this,
+ "warning this is not a number: " +
+ less_than_exons_text.getText ());
+ less_than_exons_predicate = null;
+ }
+ } else {
+ less_than_exons_predicate = null;
+ }
+
+ FeaturePredicate greater_than_exons_predicate = null;
+
+ if (greater_than_exons_button.isSelected () &&
+ greater_than_exons_text.getText ().trim ().length () > 0) {
+ try {
+ final int greater_than_exons_int =
+ Integer.valueOf (greater_than_exons_text.getText ().trim ()).intValue ();
+
+ greater_than_exons_predicate = new FeaturePredicate () {
+ public boolean testPredicate (final Feature feature) {
+ if (feature.getSegments ().size () >= greater_than_exons_int) {
+ return true;
+ } else {
+ return false;
+ }
+ }
+ };
+ } catch (NumberFormatException e) {
+ new MessageDialog (this,
+ "warning this is not a number: " +
+ greater_than_exons_text.getText ());
+ greater_than_exons_predicate = null;
+ }
+ } else {
+ greater_than_exons_predicate = null;
+ }
+
+ FeaturePredicate predicate = null;
+
+ if (!by_key_button.isSelected () && !by_motif_button.isSelected ()) {
+ // default to selecting all features
+ predicate = new FeaturePredicate () {
+ public boolean testPredicate (final Feature feature) {
+ return true;
+ }
+ };
+ } else {
+ if (motif_predicate != null && key_and_qualifier_predicate != null) {
+ predicate =
+ new FeaturePredicateConjunction (key_and_qualifier_predicate,
+ motif_predicate,
+ FeaturePredicateConjunction.AND);
+ } else {
+ if (motif_predicate != null) {
+ predicate = motif_predicate;
+ } else {
+ predicate = key_and_qualifier_predicate;
+ }
+ }
+ }
+
+ if (less_than_bases_predicate != null) {
+ predicate =
+ new FeaturePredicateConjunction (predicate,
+ less_than_bases_predicate,
+ FeaturePredicateConjunction.AND);
+ }
+
+ if (greater_than_bases_predicate != null) {
+ predicate =
+ new FeaturePredicateConjunction (predicate,
+ greater_than_bases_predicate,
+ FeaturePredicateConjunction.AND);
+ }
+
+ if (less_than_exons_predicate != null) {
+ predicate =
+ new FeaturePredicateConjunction (predicate,
+ less_than_exons_predicate,
+ FeaturePredicateConjunction.AND);
+ }
+
+ if (greater_than_exons_predicate != null) {
+ predicate =
+ new FeaturePredicateConjunction (predicate,
+ greater_than_exons_predicate,
+ FeaturePredicateConjunction.AND);
+ }
+
+ final FeatureEnumeration test_enumerator = entry_group.features ();
+
+ final FeatureVector return_features = new FeatureVector ();
+
+ while (test_enumerator.hasMoreFeatures ()) {
+ final Feature this_feature = test_enumerator.nextFeature ();
+
+ if (predicate.testPredicate (this_feature)) {
+ if (this_feature.isForwardFeature ()) {
+ if (forward_strand_checkbox.isSelected ()) {
+ return_features.add (this_feature);
+ }
+ } else {
+ if (reverse_strand_checkbox.isSelected ()) {
+ return_features.add (this_feature);
+ }
+ }
+ }
+ }
+
+ return return_features;
+ }
+
+ /**
+ * Return the Selection object that was passed to the constructor.
+ **/
+ private Selection getSelection () {
+ return selection;
+ }
+
+ /**
+ * Return the EntryGroup object that was passed to the constructor.
+ **/
+ private EntryGroup getEntryGroup () {
+ return entry_group;
+ }
+
+ private JCheckBox by_key_button;
+ private JCheckBox by_qualifier_button;
+ private JCheckBox by_motif_button;
+ private JCheckBox less_than_bases_button;
+ private JCheckBox greater_than_bases_button;
+ private JCheckBox less_than_exons_button;
+ private JCheckBox greater_than_exons_button;
+ private JCheckBox ignore_case_checkbox;
+ private JCheckBox match_any_word_checkbox;
+ private JCheckBox forward_strand_checkbox;
+ private JCheckBox reverse_strand_checkbox;
+ private KeyChoice key_selector;
+ private QualifierChoice qualifier_selector;
+ private JTextField qualifier_text;
+ private JTextField motif_text;
+ private JTextField less_than_bases_text;
+ private JTextField greater_than_bases_text;
+ private JTextField less_than_exons_text;
+ private JTextField greater_than_exons_text;
+
+ /**
+ * If checked the search text is allowed to match a substring of a
+ * qualifier value.
+ **/
+ final JCheckBox partial_match_checkbox;
+
+ /**
+ * The EntryGroup object that was passed to the constructor.
+ **/
+ final EntryGroup entry_group;
+
+ /**
+ * This is the Selection that was passed to the constructor.
+ **/
+ final private Selection selection;
+}
diff --git a/uk/ac/sanger/artemis/components/SequenceViewer.java b/uk/ac/sanger/artemis/components/SequenceViewer.java
new file mode 100644
index 000000000..7015f7e98
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/SequenceViewer.java
@@ -0,0 +1,165 @@
+/* SequenceViewer.java
+ *
+ * created: Sat Dec 19 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/SequenceViewer.java,v 1.1 2004-06-09 09:47:47 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import java.io.StringWriter;
+import java.io.PrintWriter;
+
+/**
+ * This component provides a viewer for dna or amino acid sequences. The
+ * units are numbered automatically, given a view like this:
+ * <pre>
+ * ATGATGATGATGATATGCATGATCG
+ * 10 20
+ * </pre>
+ * @author Kim Rutherford
+ * @version $Id: SequenceViewer.java,v 1.1 2004-06-09 09:47:47 tjc Exp $
+ **/
+
+public class SequenceViewer extends FileViewer {
+ /**
+ * Create a new SequenceViewer component.
+ * @param title The name to attach to the new JFrame.
+ * @param include_numbers If true then the sequence will be numbered
+ * (every second line of the display will be numbers rather than
+ * sequence).
+ **/
+ public SequenceViewer (final String title,
+ final boolean include_numbers) {
+ super (title);
+
+ this.include_numbers = include_numbers;
+ }
+
+ /**
+ * Set the sequence to display.
+ * @param comment_line A comment to put on the first line. This may be
+ * null in which case there is no comment line. This String should not
+ * be "\n" terminated.
+ * @param sequence The sequence to display. This may be null in which case
+ * there is no comment line. This String should not be "\n" terminated.
+ **/
+ public void setSequence (final String comment_line, final String sequence) {
+ this.comment_line = comment_line;
+ this.sequence = sequence;
+
+ setView ();
+ }
+
+ /**
+ * Set the sequence to display with no comment line.
+ * @param sequence The sequence to display. This may be null in which case
+ * there is no comment line. This String should not be "\n" terminated.
+ **/
+ public void setSequence (final String sequence) {
+ this.comment_line = null;
+ this.sequence = sequence;
+
+ setView ();
+ }
+
+ /**
+ * Write the sequence and comment_line in the view.
+ **/
+ private void setView () {
+ final StringWriter string_writer = new StringWriter ();
+
+ final PrintWriter writer = new PrintWriter (string_writer);
+
+ if (comment_line != null) {
+ writer.println (comment_line);
+ }
+
+ String rest_of_sequence = sequence;
+
+ final int UNITS_PER_LINE = 60;
+
+ int line_count = 0;
+
+ while (rest_of_sequence != null) {
+ final String this_line;
+
+ if (rest_of_sequence.length () < UNITS_PER_LINE) {
+ this_line = rest_of_sequence;
+ rest_of_sequence = null;
+ } else {
+ this_line = rest_of_sequence.substring (0, UNITS_PER_LINE);
+ rest_of_sequence = rest_of_sequence.substring (UNITS_PER_LINE);
+ }
+
+
+ writer.println (this_line);
+
+ if (include_numbers) {
+ final int COUNT_INTERVAL = 10;
+
+ for (int i = 1 ;
+ i <= this_line.length () / COUNT_INTERVAL;
+ ++i) {
+ final int this_unit_count =
+ i * COUNT_INTERVAL + line_count * UNITS_PER_LINE;
+
+ final int number_of_spaces =
+ COUNT_INTERVAL - String.valueOf (this_unit_count).length ();
+
+ for (int space_index = 0 ;
+ space_index < number_of_spaces ;
+ ++space_index) {
+ writer.print (' ');
+ }
+
+ writer.print (this_unit_count);
+ }
+
+ writer.println ();
+ }
+
+ ++line_count;
+ }
+
+ writer.flush ();
+
+ setText (string_writer.toString ());
+ }
+
+ /**
+ * The sequence to display.
+ **/
+ private String sequence = "";
+
+ /**
+ * A comment to put on the first line. If null don't display any comment.
+ **/
+ private String comment_line = null;
+
+ /**
+ * If true then the amino acids will be numbered (every second line of the
+ * display will be numbers rather than sequence).
+ **/
+ private final boolean include_numbers;
+}
+
+
diff --git a/uk/ac/sanger/artemis/components/Splash.java b/uk/ac/sanger/artemis/components/Splash.java
new file mode 100644
index 000000000..7e67f4194
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/Splash.java
@@ -0,0 +1,526 @@
+/* Splash.java
+ *
+ * created: Wed May 10 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/Splash.java,v 1.1 2004-06-09 09:47:48 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.Options;
+import uk.ac.sanger.artemis.EntrySourceVector;
+import uk.ac.sanger.artemis.Logger;
+import uk.ac.sanger.artemis.util.InputStreamProgressListener;
+import uk.ac.sanger.artemis.util.InputStreamProgressEvent;
+
+import java.awt.*;
+import java.awt.event.*;
+import javax.swing.*;
+import javax.swing.border.Border;
+
+/**
+ * Base class that creates a generic "Splash Screen"
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: Splash.java,v 1.1 2004-06-09 09:47:48 tjc Exp $
+ **/
+
+abstract public class Splash extends JFrame
+{
+
+ /**
+ * Do any necessary cleanup then exit.
+ **/
+ abstract protected void exit();
+
+ /**
+ * A label for status and error messages.
+ **/
+ final private JLabel status_line = new JLabel("");
+
+ /**
+ * The program name that was passed to the constructor.
+ **/
+ private String program_name;
+
+ /**
+ * The program version that was passed to the constructor.
+ **/
+ private String program_version;
+
+ /**
+ * The JComponent to draw the main splash screen into
+ **/
+ private JComponent helix_canvas;
+
+ /**
+ * JMenu bar for the main window.
+ **/
+ private JMenuBar menu_bar;
+
+ protected JMenu file_menu;
+
+ protected JMenu options_menu;
+
+ /**
+ * Create a new JFrame for a Splash screen.
+ * @param program_name The full name of the program.
+ * @param program_title The name to use in the title.
+ * @param program_version The version string.
+ **/
+ public Splash(final String program_name,
+ final String program_title,
+ final String program_version)
+ {
+ super(program_title + " " + program_version);
+
+ this.program_name = program_name;
+ this.program_version = program_version;
+
+ addWindowListener(new WindowAdapter()
+ {
+ public void windowClosing(WindowEvent event)
+ {
+ exit();
+ }
+ });
+
+ final javax.swing.LookAndFeel look_and_feel =
+ javax.swing.UIManager.getLookAndFeel();
+
+ final javax.swing.plaf.FontUIResource font_ui_resource =
+ Options.getOptions().getFontUIResource();
+
+ java.util.Enumeration keys = UIManager.getDefaults().keys();
+ while(keys.hasMoreElements())
+ {
+ Object key = keys.nextElement();
+ Object value = UIManager.get(key);
+ if(value instanceof javax.swing.plaf.FontUIResource)
+ UIManager.put(key, font_ui_resource);
+ }
+
+ getContentPane().setLayout(new BorderLayout());
+
+ makeAllMenus();
+
+ helix_canvas = makeHelixCanvas();
+
+ status_line.setFont(Options.getOptions().getFont());
+
+ final FontMetrics fm =
+ this.getFontMetrics(status_line.getFont());
+
+ final int font_height = fm.getHeight()+10;
+
+ status_line.setMinimumSize(new Dimension(100, font_height));
+ status_line.setPreferredSize(new Dimension(100, font_height));
+
+ Border loweredbevel = BorderFactory.createLoweredBevelBorder();
+ Border raisedbevel = BorderFactory.createRaisedBevelBorder();
+ Border compound = BorderFactory.createCompoundBorder(raisedbevel,loweredbevel);
+ status_line.setBorder(compound);
+
+ getContentPane().add(helix_canvas, "Center");
+ getContentPane().add(status_line, "South");
+
+ ClassLoader cl = this.getClass().getClassLoader();
+ ImageIcon icon = new ImageIcon(cl.getResource("images/icon.gif"));
+
+ if(icon != null)
+ {
+ final Image icon_image = icon.getImage();
+ MediaTracker tracker = new MediaTracker(this);
+ tracker.addImage(icon_image, 0);
+
+ try
+ {
+ tracker.waitForAll();
+ setIconImage(icon_image);
+ }
+ catch(InterruptedException e)
+ {
+ // ignore and continue
+ }
+ }
+
+ pack();
+
+ final int x = 460;
+ final int y = 250;
+
+ setSize(x, y);
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation(new Point((screen.width - getSize().width) / 2,
+ (screen.height - getSize().height) / 2));
+ }
+
+ /**
+ * Return a JComponent object that will display a helix and a short
+ * copyright notice.
+ **/
+ private JComponent makeHelixCanvas()
+ {
+ return new JPanel() {
+ public void update(Graphics g)
+ {
+ paint(g);
+ }
+
+ // return the program name and the program mode in one String
+ private String getNameString()
+ {
+ if(Options.getOptions().isEukaryoticMode())
+ return program_name + " [Eukaryotic mode]";
+ else
+ return program_name + " [Prokaryotic mode]";
+ }
+
+ /**
+ * Draws the splash screen text.
+ **/
+ public int textPaint(final Graphics g)
+ {
+ FontMetrics fm = this.getFontMetrics(g.getFont());
+ final int font_height = fm.getHeight() + 3;
+ g.setColor(Color.black);
+ final int left_margin = 5;
+
+ g.drawString(program_name,
+ helix_width + left_margin, font_height);
+ g.drawString(program_version,
+ helix_width + left_margin, font_height * 2);
+ if(Options.getOptions().isEukaryoticMode())
+ g.drawString("[Eukaryotic mode]",
+ helix_width + left_margin, font_height * 3);
+ else
+ g.drawString("[Prokaryotic mode]",
+ helix_width + left_margin, font_height * 3);
+ g.drawString("Copyright 1998 - 2003",
+ helix_width + left_margin, font_height * 9 / 2);
+ g.drawString("Genome Research Limited",
+ helix_width + left_margin, font_height * 11 / 2);
+
+ return font_height;
+ }
+
+ public void paint(final Graphics g)
+ {
+ final boolean simple_splash_screen =
+ Options.getOptions().getPropertyTruthValue("simple_splash_screen");
+
+ g.setColor(Color.white);
+
+ g.fillRect(0, 0, this.getSize().width, this.getSize().height);
+
+ if(simple_splash_screen) {
+ // java SIGILL bug work-around
+ textPaint(g);
+ return;
+ }
+
+ if(helix == null)
+ {
+// Toolkit toolkit = Toolkit.getDefaultToolkit();
+// final URL helix_url = Splash.class.getResource("/uk.ac.sanger.artemis/helix.gif");
+// helix = toolkit.getImage(helix_url);
+
+ ClassLoader cl = this.getClass().getClassLoader();
+ ImageIcon helix_icon = new ImageIcon(cl.getResource("images/helix.gif"));
+ helix = helix_icon.getImage();
+
+// final URL sanger_url =
+// Splash.class.getResource("/uk.ac.sanger.artemis/sanger-centre.gif");
+// sanger = toolkit.getImage(sanger_url);
+ ImageIcon sanger_icon = new ImageIcon(cl.getResource("images/sanger-centre.gif"));
+ sanger = sanger_icon.getImage();
+
+ tracker = new MediaTracker(this);
+ tracker.addImage(helix, 0);
+ tracker.addImage(sanger, 1);
+
+ try
+ {
+ tracker.waitForAll();
+ helix_height = helix.getHeight(this);
+ helix_width = helix.getWidth(this);
+ sanger_height = sanger.getHeight(this);
+ }
+ catch(InterruptedException e)
+ {
+ return;
+ }
+ }
+
+ for(int i=0; i*helix_height<=this.getSize().height; ++i)
+ g.drawImage(helix,
+ 0,
+ i * helix_height, this);
+
+ final int font_height = textPaint(g);
+
+ int sanger_position = this.getSize().height - sanger_height;
+
+ if(sanger_position > font_height * 5.5)
+ g.drawImage(sanger,
+ helix_width + 5,
+ sanger_position, this);
+ }
+
+ MediaTracker tracker = null;
+
+ /**
+ * The image of the Sanger DNA logo. This is set in paint().
+ **/
+ private Image helix = null;
+
+ /**
+ * The image of the Sanger logo. This is set in paint().
+ **/
+ private Image sanger = null;
+
+ /**
+ * The height of the Sanger logo. This is set in paint().
+ **/
+ private int sanger_height;
+
+ /**
+ * The height of the Sanger DNA logo. This is set in paint().
+ **/
+ private int helix_height;
+
+ /**
+ * The width of the Sanger DNA logo. This is set in paint().
+ **/
+ private int helix_width;
+ };
+ }
+
+ /**
+ * Return the reference of the Label used as a status line.
+ **/
+ public JLabel getStatusLabel()
+ {
+ return status_line;
+ }
+
+ /**
+ * The possible sources for reading Entry objects.
+ **/
+ public EntrySourceVector getEntrySources(final JFrame frame)
+ {
+ return Utilities.getEntrySources(frame, stream_progress_listener);
+ }
+
+ /**
+ * Return an InputStreamProgressListener which updates the error label with
+ * the current number of chars read while reading
+ **/
+ public InputStreamProgressListener getInputStreamProgressListener()
+ {
+ return stream_progress_listener;
+ }
+
+ /**
+ * Force the options files to be re-read and the EntryEdit components to be
+ * redisplayed.
+ **/
+ private void resetOptions()
+ {
+ Options.getOptions().reset();
+ }
+
+ /**
+ * Make all the menus and menu items for the main window. Also sets up
+ * suitable ActionListener objects for each item.
+ */
+ private void makeAllMenus()
+ {
+ menu_bar = new JMenuBar();
+ file_menu = new JMenu("File");
+ options_menu = new JMenu("Options");
+
+ menu_bar.add(file_menu);
+ menu_bar.add(options_menu);
+
+ setJMenuBar(menu_bar);
+
+ ActionListener menu_listener = null;
+
+ menu_listener = new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ resetOptions();
+ }
+ };
+ makeMenuItem(options_menu, "Re-read Options", menu_listener);
+
+ final JCheckBoxMenuItem enable_direct_edit_item =
+ new JCheckBoxMenuItem("Enable Direct Editing");
+ enable_direct_edit_item.setState(Options.getOptions().canDirectEdit());
+ enable_direct_edit_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent event)
+ {
+ final boolean item_state = enable_direct_edit_item.getState();
+ Options.getOptions().setDirectEdit(item_state);
+ }
+ });
+ options_menu.add(enable_direct_edit_item);
+
+ final JCheckBoxMenuItem enable_euk_mode_item = new JCheckBoxMenuItem(
+ "Eukaryotic Mode");
+ enable_euk_mode_item.setState(Options.getOptions().isEukaryoticMode());
+ enable_euk_mode_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent event)
+ {
+ final boolean item_state = enable_euk_mode_item.getState();
+ Options.getOptions().setEukaryoticMode(item_state);
+
+ helix_canvas.repaint();
+ }
+ });
+ options_menu.add(enable_euk_mode_item);
+
+ final JCheckBoxMenuItem highlight_active_entry_item =
+ new JCheckBoxMenuItem("Highlight Active Entry");
+ final boolean highlight_active_entry_state =
+ Options.getOptions().highlightActiveEntryFlag();
+ highlight_active_entry_item.setState(highlight_active_entry_state);
+ highlight_active_entry_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent event)
+ {
+ final boolean item_state = highlight_active_entry_item.getState();
+ Options.getOptions().setHighlightActiveEntryFlag(item_state);
+ }
+ });
+ options_menu.add(highlight_active_entry_item);
+
+ if(Options.getOptions().getPropertyTruthValue("sanger_options") &&
+ Options.getOptions().getProperty("black_belt_mode") != null)
+ {
+ final JCheckBoxMenuItem black_belt_mode_item =
+ new JCheckBoxMenuItem("Black Belt Mode");
+ final boolean state =
+ Options.getOptions().isBlackBeltMode();
+ black_belt_mode_item.setState(state);
+ black_belt_mode_item.addItemListener(new ItemListener()
+ {
+ public void itemStateChanged(ItemEvent event)
+ {
+ final boolean item_state = black_belt_mode_item.getState();
+ if(item_state)
+ Options.getOptions().put("black_belt_mode", "true");
+ else
+ Options.getOptions().put("black_belt_mode", "false");
+ }
+ });
+ options_menu.add(black_belt_mode_item);
+ }
+
+ if(Options.isUnixHost())
+ {
+ options_menu.addSeparator();
+
+ menu_listener = new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ showLog();
+ }
+ };
+ makeMenuItem(options_menu, "Show Log Window", menu_listener);
+
+ menu_listener = new ActionListener()
+ {
+ public void actionPerformed(ActionEvent event)
+ {
+ logger.setVisible(false);
+ }
+ };
+ makeMenuItem(options_menu, "Hide Log Window", menu_listener);
+ }
+ }
+
+ /**
+ * Make a new menu item in the given menu, with its label given the
+ * String and add the given ActionListener to it.
+ */
+ protected static void makeMenuItem(JMenu menu, String name,
+ ActionListener listener)
+ {
+ JMenuItem new_item = new JMenuItem(name);
+ menu.add(new_item);
+ new_item.addActionListener(listener);
+ if(name.equals("Open ..."))
+ new_item.setAccelerator(KeyStroke.getKeyStroke
+ (KeyEvent.VK_O, InputEvent.CTRL_MASK));
+ }
+
+ /**
+ * Return a Logger for warnings/errors/messages.
+ **/
+ public static Logger getLogger()
+ {
+ return logger;
+ }
+
+ /**
+ * Return the JComponent that the Splash screen is drawing on.
+ **/
+ public JComponent getCanvas()
+ {
+ return helix_canvas;
+ }
+
+ /**
+ * Make the LogViewer visible.
+ **/
+ public static void showLog()
+ {
+ logger.setVisible(true);
+ }
+
+ /**
+ * The Logger that is returned by getLogger().
+ **/
+ private final static LogViewer logger = new LogViewer();
+
+ /**
+ * An InputStreamProgressListener used to update the error label with the
+ * current number of chars read.
+ **/
+ private final InputStreamProgressListener stream_progress_listener =
+ new InputStreamProgressListener() {
+ public void progressMade(final InputStreamProgressEvent event)
+ {
+ final int char_count = event.getCharCount();
+ if(char_count == -1)
+ getStatusLabel().setText("");
+ else
+ getStatusLabel().setText("chars read so far: " + char_count);
+ }
+ };
+}
diff --git a/uk/ac/sanger/artemis/components/StickyFileChooser.java b/uk/ac/sanger/artemis/components/StickyFileChooser.java
new file mode 100644
index 000000000..ed43f18a7
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/StickyFileChooser.java
@@ -0,0 +1,99 @@
+/* StickyFileChooser.java
+ *
+ * created: Mon Sep 1 2003
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2003 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/StickyFileChooser.java,v 1.1 2004-06-09 09:47:49 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.Options;
+
+import java.io.File;
+import javax.swing.JFileChooser;
+import javax.swing.JFrame;
+import javax.swing.filechooser.FileSystemView;
+
+/**
+ * A JFileChooser that remembers which directory it is in for next time.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: StickyFileChooser.java,v 1.1 2004-06-09 09:47:49 tjc Exp $
+ **/
+
+public class StickyFileChooser extends JFileChooser
+{
+
+ /**
+ * Used to remember the directory the JFileChooser was in when the user
+ * pressed OK. This is used as the starting directory next time.
+ **/
+ private static File last_directory = null;
+
+ /**
+ * Create a new StickyFileChooser and set the current directory to what is
+ * was after the last call to StickyFileChooser.showOpenDialog() or
+ * StickyFileChooser.showSaveDialog().
+ **/
+ public StickyFileChooser()
+ {
+ super();
+
+ if (last_directory == null)
+ {
+ if (Options.getOptions ().getProperty ("default_directory") != null)
+ {
+ final String default_directory =
+ Options.getOptions().getProperty("default_directory");
+ setCurrentDirectory (new File (default_directory));
+ }
+ else
+ {
+ if (last_directory == null)
+ last_directory = new File (System.getProperty ("user.dir"));
+ }
+ }
+
+ setCurrentDirectory(last_directory);
+ setSize(620, 460);
+ }
+
+ /**
+ * Calls super.showOpenDialog() then remembers the current directory.
+ **/
+ public int showOpenDialog(JFrame owner)
+ {
+ int status = super.showOpenDialog(owner);
+ last_directory = getCurrentDirectory ();
+ return status;
+ }
+
+ /**
+ * Calls super.showSaveDialog() then remembers the current directory.
+ **/
+ public int showSaveDialog(JFrame owner)
+ {
+ int status = super.showSaveDialog (owner);
+ last_directory = getCurrentDirectory ();
+ return status;
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/SwingWorker.java b/uk/ac/sanger/artemis/components/SwingWorker.java
new file mode 100644
index 000000000..6d03d4dcb
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/SwingWorker.java
@@ -0,0 +1,150 @@
+/********************************************************************
+*
+* This library is free software; you can redistribute it and/or
+* modify it under the terms of the GNU Library General Public
+* License as published by the Free Software Foundation; either
+* version 2 of the License, or (at your option) any later version.
+*
+* This library is distributed in the hope that it will be useful,
+* but WITHOUT ANY WARRANTY; without even the implied warranty of
+* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+* Library General Public License for more details.
+*
+* You should have received a copy of the GNU Library General Public
+* License along with this library; if not, write to the
+* Free Software Foundation, Inc., 59 Temple Place - Suite 330,
+* Boston, MA 02111-1307, USA.
+********************************************************************/
+
+package uk.ac.sanger.artemis.components;
+
+import javax.swing.SwingUtilities;
+
+/**
+* This is the 3rd version of SwingWorker (also known as
+* SwingWorker 3), an abstract class that you subclass to
+* perform GUI-related work in a dedicated thread. For
+* instructions on using this class, see:
+*
+* http://java.sun.com/docs/books/tutorial/uiswing/misc/threads.html
+*
+* Note that the API changed slightly in the 3rd version:
+* You must now invoke start() on the SwingWorker after
+* creating it.
+*/
+public abstract class SwingWorker {
+ private Object value; // see getValue(), setValue()
+ private Thread thread;
+
+ /**
+ * Class to maintain reference to current worker thread
+ * under separate synchronization control.
+ */
+ private static class ThreadVar {
+ private Thread thread;
+ ThreadVar(Thread t) { thread = t; }
+ synchronized Thread get() { return thread; }
+ synchronized void clear() { thread = null; }
+ }
+
+ private ThreadVar threadVar;
+
+ /**
+ * Get the value produced by the worker thread, or null if it
+ * hasn't been constructed yet.
+ */
+ protected synchronized Object getValue() {
+ return value;
+ }
+
+ /**
+ * Set the value produced by worker thread
+ */
+ private synchronized void setValue(Object x) {
+ value = x;
+ }
+
+ /**
+ * Compute the value to be returned by the <code>get</code> method.
+ */
+ public abstract Object construct();
+
+ /**
+ * Called on the event dispatching thread (not on the worker thread)
+ * after the <code>construct</code> method has returned.
+ */
+ public void finished() {
+ }
+
+ /**
+ * A new method that interrupts the worker thread. Call this method
+ * to force the worker to stop what it's doing.
+ */
+ public void interrupt() {
+ Thread t = threadVar.get();
+ if (t != null) {
+ t.interrupt();
+ }
+ threadVar.clear();
+ }
+
+ /**
+ * Return the value created by the <code>construct</code> method.
+ * Returns null if either the constructing thread or the current
+ * thread was interrupted before a value was produced.
+ *
+ * @return the value created by the <code>construct</code> method
+ */
+ public Object get() {
+ while (true) {
+ Thread t = threadVar.get();
+ if (t == null) {
+ return getValue();
+ }
+ try {
+ t.join();
+ }
+ catch (InterruptedException e) {
+ Thread.currentThread().interrupt(); // propagate
+ return null;
+ }
+ }
+ }
+
+
+ /**
+ * Start a thread that will call the <code>construct</code> method
+ * and then exit.
+ */
+ public SwingWorker() {
+ final Runnable doFinished = new Runnable() {
+ public void run() { finished(); }
+ };
+
+ Runnable doConstruct = new Runnable() {
+ public void run() {
+ try {
+ setValue(construct());
+ }
+ finally {
+ threadVar.clear();
+ }
+
+ SwingUtilities.invokeLater(doFinished);
+ }
+ };
+
+ Thread t = new Thread(doConstruct);
+ threadVar = new ThreadVar(t);
+ }
+
+ /**
+ * Start the worker thread.
+ */
+ public void start() {
+ Thread t = threadVar.get();
+ if (t != null) {
+ t.start();
+ }
+ }
+}
diff --git a/uk/ac/sanger/artemis/components/TaskViewerFrame.java b/uk/ac/sanger/artemis/components/TaskViewerFrame.java
new file mode 100644
index 000000000..ecf04bce2
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/TaskViewerFrame.java
@@ -0,0 +1,88 @@
+/* TaskViewerFrame.java
+ *
+ * created: Mon Aug 18 2003
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 2003 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/TaskViewerFrame.java,v 1.1 2004-06-09 09:47:51 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.jcon.gui.TaskViewer;
+
+import java.awt.*;
+import java.awt.event.*;
+import javax.swing.*;
+
+/**
+ * TaskViewerFrame class
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: TaskViewerFrame.java,v 1.1 2004-06-09 09:47:51 tjc Exp $
+ **/
+
+public class TaskViewerFrame extends JFrame
+{
+
+ /** TaskViewer that was created in the constructor. */
+ private TaskViewer tv = null;
+
+
+ /**
+ * Create a new TaskViewerFrame to monitor the tasks with the given ids.
+ **/
+ public TaskViewerFrame(final int [] ids)
+ {
+ try
+ {
+ tv = new TaskViewer(ids);
+ }
+ catch(Exception e)
+ {
+ dispose();
+ new MessageDialog(this, "Exception when viewing tasks: " +
+ e.getMessage());
+ return;
+ }
+
+ final JPanel panel = new JPanel();
+ getContentPane().add(panel);
+ panel.setLayout(new BorderLayout());
+ panel.add(tv, "Center");
+
+ final JButton close_button = new JButton("Close");
+ close_button.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ dispose();
+ }
+ });
+
+ panel.add(close_button, "South");
+ pack();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+
+ setLocation(new Point((screen.width - getSize().width) / 2,
+ (screen.height - getSize().height) / 2));
+ }
+
+}
diff --git a/uk/ac/sanger/artemis/components/TextDialog.java b/uk/ac/sanger/artemis/components/TextDialog.java
new file mode 100644
index 000000000..f263cb425
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/TextDialog.java
@@ -0,0 +1,119 @@
+/* TextDialog.java
+ *
+ * created: Mon Jan 11 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/TextDialog.java,v 1.1 2004-06-09 09:47:52 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.util.Vector;
+
+import javax.swing.*;
+
+/**
+ * A popup TextField JDialog with an OK and a Cancel button.
+ *
+ * @author Kim Rutherford
+ * @version $Id: TextDialog.java,v 1.1 2004-06-09 09:47:52 tjc Exp $
+ **/
+
+public class TextDialog extends JDialog {
+ /**
+ * Create a new TextDialog component with the given prompt. Other
+ * components can listen for TextDialogEvent object.
+ * @param parent The parent window.
+ * @param prompt A message that is displayed in the component beside the
+ * TextArea that the user types into. This String is also used as the
+ * JFrame title.
+ * @param width The width of the new TextField.
+ * @param initial_text The initial text to put in the TextField.
+ **/
+ public TextDialog (final JFrame parent,
+ final String prompt,
+ final int width,
+ final String initial_text) {
+ super (parent, prompt, true);
+
+ getContentPane ().add (new JLabel (prompt), "North");
+
+ final JPanel panel = new JPanel ();
+
+ panel.add (ok_button);
+ ok_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ text = text_field.getText ();
+ TextDialog.this.dispose ();
+ }
+ });
+
+ panel.add (cancel_button);
+ cancel_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ text = null;
+ TextDialog.this.dispose ();
+ }
+ });
+
+ getContentPane ().add (panel, "South");
+
+ text_field = new JTextField (initial_text, width);
+
+ text_field.addKeyListener (new KeyAdapter () {
+ public void keyTyped(final KeyEvent e) {
+ if (e.getKeyChar () == '\n') {
+ text = text_field.getText ();
+ TextDialog.this.dispose ();
+ }
+ }
+ });
+
+ getContentPane ().add (text_field, "Center");
+
+ pack ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+ }
+
+ /**
+ * Wait for a user action then return the text if the user hit OK or null
+ * if the user hit Cancel.
+ **/
+ public String getText () {
+ setVisible (true);
+
+ return text;
+ }
+
+ private final JButton ok_button = new JButton ("OK");
+ private final JButton cancel_button = new JButton ("Cancel");
+ private JTextField text_field = null;
+
+ /**
+ * Set to null if and only if the user cancels the dialog, otherwise
+ * contains the text that the user entered.
+ **/
+ private String text = null;
+}
diff --git a/uk/ac/sanger/artemis/components/TextFieldSink.java b/uk/ac/sanger/artemis/components/TextFieldSink.java
new file mode 100644
index 000000000..61ba9d4b8
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/TextFieldSink.java
@@ -0,0 +1,142 @@
+/********************************************************************
+*
+* This library is free software; you can redistribute it and/or
+* modify it under the terms of the GNU Library General Public
+* License as published by the Free Software Foundation; either
+* version 2 of the License, or (at your option) any later version.
+*
+* This library is distributed in the hope that it will be useful,
+* but WITHOUT ANY WARRANTY; without even the implied warranty of
+* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+* Library General Public License for more details.
+*
+* You should have received a copy of the GNU Library General Public
+* License along with this library; if not, write to the
+* Free Software Foundation, Inc., 59 Temple Place - Suite 330,
+* Boston, MA 02111-1307, USA.
+*
+* Copyright (C) Genome Research Limited
+*
+********************************************************************/
+
+package uk.ac.sanger.artemis.components;
+
+import java.awt.datatransfer.*;
+import javax.swing.*;
+import javax.swing.event.*;
+import java.awt.event.*;
+import javax.swing.border.*;
+import java.awt.dnd.*;
+import java.awt.*;
+import java.io.*;
+
+
+/**
+*
+* Extends JTextField to enable pasting & drag and drop into it.
+*
+*/
+public class TextFieldSink extends JTextField implements DropTargetListener
+{
+
+ public TextFieldSink(String text, int columns)
+ {
+ super(text, columns);
+ //pasting
+ addMouseListener(new MouseAdapter()
+ {
+ public void mouseClicked(MouseEvent e)
+ {
+ if(e.getClickCount() == 2)
+ {
+ pasteText();
+ e.consume();
+ };
+ }
+ });
+
+ setDropTarget(new DropTarget(this,this));
+ }
+
+ public TextFieldSink()
+ {
+ this("",0);
+ }
+
+ public void pasteText()
+ {
+ Clipboard c = this.getToolkit().getSystemClipboard();
+
+ Transferable t = c.getContents(this);
+ if(t==null)
+ {
+ this.getToolkit().beep();
+ return;
+ }
+ try
+ {
+ if(t.isDataFlavorSupported(DataFlavor.stringFlavor))
+ {
+ String s = (String) t.getTransferData(DataFlavor.stringFlavor);
+ this.replaceSelection(s);
+ }
+ else
+ this.getToolkit().beep();
+ }
+ catch (UnsupportedFlavorException ex) { this.getToolkit().beep(); }
+ catch (IOException ex) { this.getToolkit().beep(); }
+
+ }
+
+ protected static Border dropBorder = new BevelBorder(BevelBorder.LOWERED);
+ protected static Border endBorder =
+ BorderFactory.createLineBorder(Color.black);
+
+ public void dragEnter(DropTargetDragEvent e)
+ {
+ if(e.isDataFlavorSupported(DataFlavor.stringFlavor))
+ {
+ e.acceptDrag(DnDConstants.ACTION_COPY_OR_MOVE);
+ this.setBorder(dropBorder);
+ }
+ }
+
+ public void dragExit(DropTargetEvent e)
+ {
+ this.setBorder(null);
+ }
+
+ public void drop(DropTargetDropEvent e)
+ {
+ this.setBorder(endBorder);
+ Transferable t = e.getTransferable();
+ if(t.isDataFlavorSupported(DataFlavor.stringFlavor))
+ {
+ e.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
+ try
+ {
+ String dropS = (String)t.getTransferData(DataFlavor.stringFlavor);
+ this.replaceSelection(dropS);
+ e.dropComplete(true);
+ }
+ catch (Exception ex) {}
+ }
+ else
+ {
+ e.rejectDrop();
+ return;
+ }
+ return;
+ }
+
+ public void dragOver(DropTargetDragEvent e)
+ {
+ if(e.isDataFlavorSupported(DataFlavor.stringFlavor))
+ e.acceptDrag(DnDConstants.ACTION_COPY_OR_MOVE);
+ }
+ public void dropActionChanged(DropTargetDragEvent e) {}
+}
+
+
+
+
diff --git a/uk/ac/sanger/artemis/components/TextRequester.java b/uk/ac/sanger/artemis/components/TextRequester.java
new file mode 100644
index 000000000..ddf3bc6e8
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/TextRequester.java
@@ -0,0 +1,158 @@
+/* TextRequester.java
+ *
+ * created: Mon Jan 11 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/TextRequester.java,v 1.1 2004-06-09 09:47:54 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.Options;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.util.Vector;
+
+import javax.swing.*;
+
+/**
+ * A popup JTextField with an OK and a Cancel button.
+ *
+ * @author Kim Rutherford
+ * @version $Id: TextRequester.java,v 1.1 2004-06-09 09:47:54 tjc Exp $
+ **/
+
+public class TextRequester extends JFrame {
+ /**
+ * Create a new TextRequester component with the given prompt. Other
+ * components can listen for TextRequesterEvent object.
+ * @param prompt A message that is displayed in the component beside the
+ * TextArea that the user types into. This String is also used as the
+ * JFrame title.
+ * @param width The width of the JTextField in the new requester.
+ * @param initial_text The initial text to put in the JTextField.
+ **/
+ public TextRequester (final String prompt,
+ final int width,
+ final String initial_text) {
+ super (prompt);
+
+ getContentPane ().add (new JLabel (prompt), "North");
+
+ final JPanel panel = new JPanel ();
+
+ panel.add (ok_button);
+ ok_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ performOK ();
+ }
+ });
+
+ panel.add (cancel_button);
+ cancel_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ performCancel ();
+ }
+ });
+
+ getContentPane ().add (panel, "South");
+
+ text_field = new JTextField (initial_text, width);
+
+ text_field.addKeyListener (new KeyAdapter () {
+ public void keyTyped(final KeyEvent e) {
+ if (e.getKeyChar () == '\n') {
+ performOK ();
+ }
+ }
+ });
+
+ getContentPane ().add (text_field, "Center");
+
+ pack ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+ }
+
+ /**
+ * Add the given object as a listen for TextRequester events from this
+ * TextRequester.
+ **/
+ public void addTextRequesterListener (final TextRequesterListener l) {
+ listeners.addElement (l);
+ }
+
+ /**
+ * Return the text the is currently displayed in this requester.
+ **/
+ protected String getText () {
+ return text_field.getText ();
+ }
+
+ /**
+ * Send a TextRequesterEvent of type OK to all the listeners.
+ **/
+ protected void performOK () {
+ final TextRequesterEvent new_event =
+ new TextRequesterEvent (this, getText (), TextRequesterEvent.OK);
+
+ sendEvent (new_event);
+
+ TextRequester.this.dispose ();
+ }
+
+ /**
+ * Send a TextRequesterEvent of type CANCEL to all the listeners.
+ **/
+ protected void performCancel () {
+ final TextRequesterEvent new_event =
+ new TextRequesterEvent (this, getText (), TextRequesterEvent.CANCEL);
+
+ sendEvent (new_event);
+
+ TextRequester.this.dispose ();
+ }
+
+ /**
+ * Send the given TextRequesterEvent to all the object that are listening
+ * for the event.
+ **/
+ private void sendEvent (final TextRequesterEvent event) {
+ for (int i = 0 ; i < listeners.size () ; ++i) {
+ final TextRequesterListener listener =
+ ((TextRequesterListener) listeners.elementAt (i));
+
+ listener.actionPerformed (event);
+ }
+ }
+
+ private final JButton ok_button = new JButton ("OK");
+ private final JButton cancel_button = new JButton ("Cancel");
+ private JTextField text_field = null;
+
+ /**
+ * This contains the objects that are listening for TextRequester events
+ * from this TextRequester.
+ **/
+ private Vector listeners = new Vector ();
+}
diff --git a/uk/ac/sanger/artemis/components/TextRequesterEvent.java b/uk/ac/sanger/artemis/components/TextRequesterEvent.java
new file mode 100644
index 000000000..b1e3951d0
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/TextRequesterEvent.java
@@ -0,0 +1,87 @@
+/* TextRequesterEvent.java
+ *
+ * created: Wed Jan 13 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/TextRequesterEvent.java,v 1.1 2004-06-09 09:47:55 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+/**
+ * This event is sent when the user presses OK or Cancel in a TextRequester
+ * component.
+ *
+ * @author Kim Rutherford
+ * @version $Id: TextRequesterEvent.java,v 1.1 2004-06-09 09:47:55 tjc Exp $
+ **/
+
+public class TextRequesterEvent extends java.util.EventObject {
+ /**
+ * Event type - This event was generated by pressing the OK button.
+ **/
+ final public static int OK = 1;
+
+ /**
+ * Event type - This event was generated by pressing the CANCEL button.
+ **/
+ final public static int CANCEL = 2;
+
+ /**
+ * Create a new TextRequesterEvent object.
+ * @param source The TextRequester that generated the event.
+ * @param requester_text The contents of the TextField in the TextRequester.
+ * @param type The type of event.
+ **/
+ public TextRequesterEvent (final TextRequester source,
+ final String requester_text,
+ final int type) {
+ super (source);
+ this.requester_text = requester_text;
+ this.type = type;
+ }
+
+ /**
+ * Return the type of this event as passed to the constructor.
+ **/
+ public int getType () {
+ return type;
+ }
+
+ /**
+ * Return the TextRequester contents String that was passed to the
+ * constructor.
+ **/
+ public String getRequesterText () {
+ return requester_text;
+ }
+
+ /**
+ * This is the type of this event, as passed to the constructor
+ **/
+ private int type;
+
+ /**
+ * The TextRequester contents String that was passed to the constructor.
+ **/
+ private String requester_text;
+}
+
+
diff --git a/uk/ac/sanger/artemis/components/TextRequesterListener.java b/uk/ac/sanger/artemis/components/TextRequesterListener.java
new file mode 100644
index 000000000..0b70582f9
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/TextRequesterListener.java
@@ -0,0 +1,44 @@
+/* TextRequesterListener.java
+ *
+ * created: Sun Jan 17 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/TextRequesterListener.java,v 1.1 2004-06-09 09:47:56 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+/**
+ * This interface is implemented by those classes that need to listen for
+ * TextRequesterEvents.
+ *
+ * @author Kim Rutherford
+ * @version $Id: TextRequesterListener.java,v 1.1 2004-06-09 09:47:56 tjc Exp $
+ **/
+
+public interface TextRequesterListener {
+ /**
+ * Invoked when the user presses the OK or Cancel button on a TextRequester
+ * component.
+ **/
+ void actionPerformed (final TextRequesterEvent event);
+}
+
+
diff --git a/uk/ac/sanger/artemis/components/Utilities.java b/uk/ac/sanger/artemis/components/Utilities.java
new file mode 100644
index 000000000..b5d90710c
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/Utilities.java
@@ -0,0 +1,144 @@
+/* Utilities.java
+ *
+ * created: Tue Sep 18 2001
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 2001 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/Utilities.java,v 1.1 2004-06-09 09:47:57 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.util.InputStreamProgressListener;
+import uk.ac.sanger.artemis.EntrySourceVector;
+import uk.ac.sanger.artemis.Options;
+
+import java.awt.*;
+import java.net.MalformedURLException;
+import javax.swing.*;
+
+/**
+ * Utilities methods used by the uk.ac.sanger.artemis.components package.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: Utilities.java,v 1.1 2004-06-09 09:47:57 tjc Exp $
+ **/
+
+public class Utilities
+{
+ /**
+ * Return the JFrame that contains the given component.
+ **/
+ public static JFrame getComponentFrame(final JComponent component)
+ {
+ if(component.getTopLevelAncestor() instanceof JFrame)
+ return(JFrame) component.getTopLevelAncestor();
+ else
+ return null;
+ }
+
+ /**
+ * Move the given JFrame to the centre of the screen.
+ **/
+ public static void centreFrame(final JFrame frame)
+ {
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+
+ final int x_position =(screen.width - frame.getSize().width) / 2;
+ int y_position =(screen.height - frame.getSize().height) / 2;
+
+ if(y_position < 10)
+ y_position = 10;
+
+ frame.setLocation(new Point(x_position, y_position));
+ }
+
+ /**
+ * Find the parent Frame of the given component and re-centre it on the
+ * screen.
+ **/
+ public static void centreOwningFrame(final JComponent component)
+ {
+ final JFrame frame = getComponentFrame(component);
+ centreFrame(frame);
+ }
+
+ /**
+ * Returns a Vector containing the possible Entry sources for this
+ * application.
+ * @param frame The component that is creating the EntrySource objects.
+ * (Used for requesters.)
+ * @param listener InputStreamProgressEvent objects will be sent to this
+ * listener as progress on reading is made.
+ **/
+ public static EntrySourceVector getEntrySources(final JFrame frame,
+ final InputStreamProgressListener listener)
+ {
+ final EntrySourceVector return_vector = new EntrySourceVector();
+
+ return_vector.add(new FileDialogEntrySource(frame, listener));
+ return_vector.add(new DbfetchEntrySource(frame));
+
+ // return_vector.add(new BioJavaEntrySource());
+
+ // this doesn't work on a v1.2 system so it is taken out with perl when
+ // necessary
+ // CORBA_START_MARKER
+
+ // The location of the IOR for the corba server at EMBL. Can be
+ // overridden using the options file.
+ final String embl_ior_url =
+ Options.getOptions().getProperty("embl_ior_url");
+
+ if(embl_ior_url != null)
+ {
+ try
+ {
+ return_vector.add(new EMBLCorbaEntrySource(frame, embl_ior_url));
+ }
+ catch(MalformedURLException e)
+ {
+ new MessageDialog(frame, "the url given for the embl database is " +
+ "badly formatted: " + e.getMessage());
+ }
+ }
+
+ // The location of the IOR for the pathogens group read-write corba
+ // server.
+ final String db_ior_url =
+ Options.getOptions().getProperty("db_ior_url");
+
+ if(db_ior_url != null)
+ {
+ try
+ {
+ return_vector.add(new WritableEMBLCorbaEntrySource(frame,
+ db_ior_url));
+ }
+ catch(MalformedURLException e)
+ {
+ new MessageDialog(frame, "the url given for the embl database is " +
+ "badly formatted: " + e.getMessage());
+ }
+ }
+ // CORBA_END_MARKER
+
+ return return_vector;
+ }
+}
diff --git a/uk/ac/sanger/artemis/components/ViewMenu.java b/uk/ac/sanger/artemis/components/ViewMenu.java
new file mode 100644
index 000000000..f39c5c918
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/ViewMenu.java
@@ -0,0 +1,1430 @@
+/* ViewMenu.java
+ *
+ * created: Tue Dec 29 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000,2002 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/ViewMenu.java,v 1.1 2004-06-09 09:47:58 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+import uk.ac.sanger.artemis.plot.*;
+
+import uk.ac.sanger.artemis.util.*;
+import uk.ac.sanger.artemis.io.InvalidRelationException;
+import uk.ac.sanger.artemis.io.Key;
+import uk.ac.sanger.artemis.io.InvalidKeyException;
+import uk.ac.sanger.artemis.io.Range;
+
+import java.io.*;
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * A popup menu with viewing commands.
+ *
+ * @author Kim Rutherford
+ * @version $Id: ViewMenu.java,v 1.1 2004-06-09 09:47:58 tjc Exp $
+ **/
+
+public class ViewMenu extends SelectionMenu {
+ /**
+ * Create a new ViewMenu object.
+ * @param frame The JFrame that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param entry_group The EntryGroup object where new features/entries will
+ * be added.
+ * @param goto_event_source The object that we will call makeBaseVisible ()
+ * on.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ * @param menu_name The name of the new menu.
+ **/
+ public ViewMenu (final JFrame frame,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final EntryGroup entry_group,
+ final BasePlotGroup base_plot_group,
+ final String menu_name) {
+ super (frame, menu_name, selection);
+
+ this.entry_group = entry_group;
+ this.selection = selection;
+ this.goto_event_source = goto_event_source;
+
+ this.base_plot_group = base_plot_group;
+
+ plot_features_item = new JMenuItem ("Show Feature Plots");
+ plot_features_item.setAccelerator (PLOT_FEATURES_KEY);
+ plot_features_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ plotSelectedFeatures (getParentFrame (), getSelection ());
+ }
+ });
+
+ view_feature_item = new JMenuItem ("View Selected Features");
+ view_feature_item.setAccelerator (VIEW_FEATURES_KEY);
+ view_feature_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ viewSelectedFeatures (getParentFrame (), getSelection ());
+ }
+ });
+
+ view_selection_item = new JMenuItem ("View Selection");
+ view_selection_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ new SelectionViewer (getSelection (), entry_group);
+ }
+ });
+
+ feature_info_item = new JMenuItem ("Show Feature Statistics");
+ feature_info_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ viewSelectedFeatureInfo ();
+ }
+ });
+
+ view_bases_item = new JMenuItem ("View Bases Of Selection");
+ view_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ viewSelectedBases (true);
+ }
+ });
+
+ view_bases_as_fasta_item =
+ new JMenuItem ("View Bases Of Selection As FASTA");
+ view_bases_as_fasta_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ viewSelectedBases (false);
+ }
+ });
+
+ view_aa_item = new JMenuItem ("View Amino Acids Of Selection");
+ view_aa_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ viewSelectedAminoAcids (true);
+ }
+ });
+
+ view_aa_as_fasta_item =
+ new JMenuItem ("View Amino Acids Of Selection As FASTA");
+ view_aa_as_fasta_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ viewSelectedAminoAcids (false);
+ }
+ });
+
+ overview_item = new JMenuItem ("Show Overview");
+ overview_item.setAccelerator (OVERVIEW_KEY);
+ overview_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ new EntryGroupInfoDisplay (getParentFrame (), entry_group);
+ }
+ });
+
+ forward_overview_item = new JMenuItem ("Show Forward Strand Overview");
+ forward_overview_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ new EntryGroupInfoDisplay (getParentFrame (), entry_group,
+ EntryGroupInfoDisplay.FORWARD);
+ }
+ });
+
+ reverse_overview_item = new JMenuItem ("Show Reverse Strand Overview");
+ reverse_overview_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ new EntryGroupInfoDisplay (getParentFrame (), entry_group,
+ EntryGroupInfoDisplay.REVERSE);
+ }
+ });
+
+ view_cds_item = new JMenuItem ("Show CDS Genes And Products");
+ view_cds_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ final FeaturePredicate feature_predicate =
+ new FeatureKeyPredicate (Key.CDS);
+
+ final String filter_name =
+ "CDS features (filtered from: " +
+ getParentFrame ().getTitle () + ")";
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, feature_predicate, filter_name);
+
+ final FeatureListFrame feature_list_frame =
+ new FeatureListFrame (filter_name,
+ selection, goto_event_source,
+ filtered_entry_group,
+ base_plot_group);
+
+ feature_list_frame.getFeatureList ().setShowGenes (true);
+ feature_list_frame.getFeatureList ().setShowProducts (true);
+
+ feature_list_frame.setVisible (true);
+ }
+ });
+
+ JMenu search_results_menu = null;
+
+ search_results_menu = new JMenu ("Search Results");
+
+ final boolean sanger_options =
+ Options.getOptions ().getPropertyTruthValue ("sanger_options");
+
+ final ExternalProgramVector external_programs =
+ Options.getOptions ().getExternalPrograms ();
+
+ final StringVector external_program_names = new StringVector ();
+
+ for (int i = 0 ; i < external_programs.size () ; ++i) {
+ final ExternalProgram external_program =
+ external_programs.elementAt (i);
+
+ final String new_name = external_program.getName ();
+
+ if (!external_program_names.contains (new_name)) {
+ external_program_names.add (new_name);
+ }
+ }
+
+ for (int i = 0 ; i < external_program_names.size () ; ++i) {
+ final String external_program_name =
+ external_program_names.elementAt (i);
+
+ final JMenuItem new_menu =
+ makeSearchResultsMenu (external_program_name, false, sanger_options);
+ search_results_menu.add (new_menu);
+ }
+
+ if (sanger_options) {
+ search_results_menu.addSeparator ();
+
+ for (int i = 0 ; i < external_program_names.size () ; ++i) {
+ final String external_program_name =
+ external_program_names.elementAt (i);
+
+ final JMenuItem new_menu =
+ makeSearchResultsMenu (external_program_name, true, sanger_options);
+ search_results_menu.add (new_menu);
+ }
+ }
+
+ final int MAX_FILTER_FEATURE_COUNT = 10000;
+
+ final JMenu feature_filters_menu = new JMenu ("Feature Filters");
+
+ final JMenuItem bad_start_codons_item =
+ new JMenuItem ("Suspicious Start Codons ...");
+ bad_start_codons_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ if (checkEntryGroupSize (MAX_FILTER_FEATURE_COUNT)) {
+ showBadStartCodons (getParentFrame (),
+ selection, entry_group, goto_event_source,
+ base_plot_group);
+ }
+ }
+ });
+
+ final JMenuItem bad_stop_codons_item =
+ new JMenuItem ("Suspicious Stop Codons ...");
+ bad_stop_codons_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ if (checkEntryGroupSize (MAX_FILTER_FEATURE_COUNT)) {
+ showBadStopCodons (getParentFrame (),
+ selection, entry_group, goto_event_source,
+ base_plot_group);
+ }
+ }
+ });
+
+ final JMenuItem stop_codons_in_translation =
+ new JMenuItem ("Stop Codons In Translation ...");
+ stop_codons_in_translation.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ if (checkEntryGroupSize (MAX_FILTER_FEATURE_COUNT)) {
+ showStopsInTranslation (getParentFrame (),
+ selection, entry_group, goto_event_source,
+ base_plot_group);
+ }
+ }
+ });
+
+ final JMenuItem bad_feature_keys_item =
+ new JMenuItem ("Non EMBL Keys ...");
+ bad_feature_keys_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ if (checkEntryGroupSize (MAX_FILTER_FEATURE_COUNT)) {
+ showNonEMBLKeys (getParentFrame (),
+ selection, entry_group, goto_event_source,
+ base_plot_group);
+ }
+ }
+ });
+
+ final JMenuItem duplicated_keys_item =
+ new JMenuItem ("Duplicated Features ...");
+ duplicated_keys_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ if (checkEntryGroupSize (MAX_FILTER_FEATURE_COUNT)) {
+ showDuplicatedFeatures (getParentFrame (),
+ selection, entry_group, goto_event_source,
+ base_plot_group);
+ }
+ }
+ });
+
+ final JMenuItem overlapping_cds_features_item =
+ new JMenuItem ("Overlapping CDS Features ...");
+ overlapping_cds_features_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ if (checkEntryGroupSize (MAX_FILTER_FEATURE_COUNT)) {
+ showOverlappingCDSs (getParentFrame (),
+ selection, entry_group, goto_event_source,
+ base_plot_group);
+ }
+ }
+ });
+
+ final JMenuItem same_stop_cds_features_item =
+ new JMenuItem ("CDSs Sharing Stop Codons ...");
+ same_stop_cds_features_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ if (checkEntryGroupSize (MAX_FILTER_FEATURE_COUNT)) {
+ showFeaturesWithSameStopCodons (getParentFrame (),
+ selection, entry_group,
+ goto_event_source,
+ base_plot_group);
+ }
+ }
+ });
+
+ final JMenuItem missing_qualifier_features_item =
+ new JMenuItem ("Features Missing Required Qualifiers ...");
+ missing_qualifier_features_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ if (checkEntryGroupSize (MAX_FILTER_FEATURE_COUNT)) {
+ showMissingQualifierFeatures (getParentFrame (),
+ selection,
+ entry_group, goto_event_source,
+ base_plot_group);
+ }
+ }
+ });
+
+ final JMenuItem filter_by_key_item =
+ new JMenuItem ("Filter By Key ...");
+ filter_by_key_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ if (checkEntryGroupSize (MAX_FILTER_FEATURE_COUNT)) {
+ showFilterByKey (getParentFrame (),
+ selection, entry_group, goto_event_source,
+ base_plot_group);
+ }
+ }
+ });
+
+ final JMenuItem filter_by_selection_item =
+ new JMenuItem ("Selected Features ...");
+ filter_by_selection_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ showFilterBySelection (getParentFrame (),
+ selection, entry_group, goto_event_source,
+ base_plot_group);
+ }
+ });
+
+ feature_filters_menu.add (bad_start_codons_item);
+ feature_filters_menu.add (bad_stop_codons_item);
+ feature_filters_menu.add (stop_codons_in_translation);
+ feature_filters_menu.add (bad_feature_keys_item);
+ feature_filters_menu.add (duplicated_keys_item);
+ feature_filters_menu.add (overlapping_cds_features_item);
+ feature_filters_menu.add (same_stop_cds_features_item);
+ feature_filters_menu.add (missing_qualifier_features_item);
+ feature_filters_menu.addSeparator ();
+ feature_filters_menu.add (filter_by_key_item);
+ feature_filters_menu.add (filter_by_selection_item);
+
+ add (view_feature_item);
+ add (view_selection_item);
+ addSeparator ();
+ if (search_results_menu != null) {
+ add (search_results_menu);
+ }
+ add (view_cds_item);
+ add (feature_filters_menu);
+ addSeparator ();
+ add (overview_item);
+ add (forward_overview_item);
+ add (reverse_overview_item);
+ addSeparator ();
+ add (view_bases_item);
+ add (view_bases_as_fasta_item);
+ add (view_aa_item);
+ add (view_aa_as_fasta_item);
+ addSeparator ();
+ add (feature_info_item);
+ add (plot_features_item);
+ }
+
+ /**
+ * Create a new ViewMenu object.
+ * @param entry_edit The EntryEdit that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param entry_group The EntryGroup object where new features/entries will
+ * be added.
+ * @param goto_event_source The object that we will call makeBaseVisible ()
+ * on.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public ViewMenu (final JFrame frame,
+ final Selection selection,
+ final GotoEventSource goto_event_source,
+ final EntryGroup entry_group,
+ final BasePlotGroup base_plot_group) {
+ this (frame, selection, goto_event_source, entry_group,
+ base_plot_group, "View");
+ }
+
+ /**
+ * The shortcut for Show Feature Plots.
+ **/
+ final static KeyStroke PLOT_FEATURES_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_W, InputEvent.CTRL_MASK);
+
+ final static public int PLOT_FEATURES_KEY_CODE = KeyEvent.VK_W;
+
+ /**
+ * The shortcut for View Selected Features.
+ **/
+ final static KeyStroke VIEW_FEATURES_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_V, InputEvent.CTRL_MASK);
+
+ final static public int VIEW_FEATURES_KEY_CODE = KeyEvent.VK_V;
+
+ /**
+ * The shortcut for Show Overview.
+ **/
+ final static KeyStroke OVERVIEW_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_O, InputEvent.CTRL_MASK);
+
+ final static public int OVERVIEW_KEY_CODE = KeyEvent.VK_O;
+
+ /**
+ * The shortcut for View FASTA in browser.
+ **/
+ final static KeyStroke FASTA_IN_BROWSER_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_F, InputEvent.CTRL_MASK);
+
+ final static public int FASTA_IN_BROWSER_KEY_CODE = KeyEvent.VK_F;
+
+ /**
+ * The shortcut for View FASTA.
+ **/
+ final static KeyStroke VIEW_FASTA_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_R, InputEvent.CTRL_MASK);
+
+ final static public int VIEW_FASTA_KEY_CODE = KeyEvent.VK_R;
+
+ /**
+ * The shortcut for View BLASTP in browser.
+ **/
+ final static KeyStroke BLASTP_IN_BROWSER_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_B, InputEvent.CTRL_MASK);
+
+ final static public int BLASTP_IN_BROWSER_KEY_CODE = KeyEvent.VK_B;
+
+ /**
+ * The shortcut for View BLASTP.
+ **/
+ final static KeyStroke VIEW_BLASTP_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_BACK_QUOTE , InputEvent.CTRL_MASK);
+
+ final static public int VIEW_BLASTP_KEY_CODE = KeyEvent.VK_BACK_QUOTE;
+
+ /**
+ * The shortcut for View HTH.
+ **/
+ final static KeyStroke VIEW_HTH_KEY =
+ KeyStroke.getKeyStroke (KeyEvent.VK_H, InputEvent.CTRL_MASK);
+
+ final static public int VIEW_HTH_KEY_CODE = KeyEvent.VK_H;
+
+ /**
+ * Make a JMenuItem for viewing the results of running the given program.
+ * @param send_to_browser if true the results should be sent straight to
+ * the web browser rather than using a SearchResultViewer object.
+ * @param sanger_options true if the sanger_options is set to true in the
+ * options file.
+ **/
+ private JMenuItem makeSearchResultsMenu (final String program_name,
+ final boolean send_to_browser,
+ final boolean sanger_options) {
+ final String new_menu_name;
+
+ if (send_to_browser) {
+ new_menu_name = program_name + " results (in browser)";
+ } else {
+ new_menu_name = program_name + " results";
+ }
+
+ final JMenuItem new_menu;
+
+ if ((sanger_options && send_to_browser || !sanger_options)
+ && program_name.equals ("fasta")) {
+ new_menu = new JMenuItem (new_menu_name);
+ new_menu.setAccelerator (FASTA_IN_BROWSER_KEY);
+ } else {
+ if ((sanger_options && send_to_browser || !sanger_options)
+ && program_name.equals ("blastp")) {
+ new_menu = new JMenuItem (new_menu_name);
+ new_menu.setAccelerator (BLASTP_IN_BROWSER_KEY);
+ } else {
+ if (program_name.equals ("fasta")) {
+ new_menu = new JMenuItem (new_menu_name);
+ new_menu.setAccelerator (VIEW_FASTA_KEY);
+ } else {
+ if (program_name.equals ("blastp")) {
+ new_menu = new JMenuItem (new_menu_name);
+ new_menu.setAccelerator (VIEW_BLASTP_KEY);
+ } else {
+ if (program_name.equals ("hth")) {
+ new_menu = new JMenuItem (new_menu_name);
+ new_menu.setAccelerator (VIEW_HTH_KEY);
+ } else {
+ new_menu = new JMenuItem (new_menu_name);
+ }
+ }
+ }
+ }
+ }
+
+ new_menu.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ viewExternalResults (getParentFrame (), getSelection (),
+ program_name, send_to_browser);
+ }
+ });
+
+ return new_menu;
+ }
+
+ /**
+ * Popup a FeatureListFrame containing the non-pseudo CDS features that
+ * have invalid start codons.
+ * @param parent_frame The parent JFrame.
+ * @param selection The Selection to pass to the FeatureList.
+ * @param entry_group The EntryGroup to pass to the FilteredEntryGroup.
+ * @param goto_source The GotoEventSource to pass to the FeatureList.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public static void showBadStartCodons (final JFrame parent_frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final GotoEventSource goto_source,
+ final BasePlotGroup
+ base_plot_group) {
+ final FeatureKeyQualifierPredicate cds_predicate =
+ new FeatureKeyQualifierPredicate (Key.CDS, "pseudo", false);
+
+ final FeaturePredicate feature_predicate =
+ new FeaturePredicate () {
+ public boolean testPredicate (final Feature feature) {
+ if (!cds_predicate.testPredicate (feature)) {
+ return false;
+ }
+
+ if (feature.hasValidStartCodon ()) {
+ return false;
+ } else {
+ return true;
+ }
+ }
+ };
+
+ final String filter_name =
+ "CDS features with suspicious start codons (filtered from: " +
+ parent_frame.getTitle () + ")";
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, feature_predicate, filter_name);
+
+ final FeatureListFrame feature_list_frame =
+ new FeatureListFrame (filter_name,
+ selection, goto_source, filtered_entry_group,
+ base_plot_group);
+
+ feature_list_frame.setVisible (true);
+ }
+
+ /**
+ * Popup a FeatureListFrame containing the non-pseudo CDS features that
+ * have invalid stop codons.
+ * @param parent_frame The parent JFrame.
+ * @param selection The Selection to pass to the FeatureList.
+ * @param entry_group The EntryGroup to pass to the FilteredEntryGroup.
+ * @param goto_source The GotoEventSource to pass to the FeatureList.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public static void showBadStopCodons (final JFrame parent_frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final GotoEventSource goto_source,
+ final BasePlotGroup
+ base_plot_group) {
+ final FeatureKeyQualifierPredicate cds_predicate =
+ new FeatureKeyQualifierPredicate (Key.CDS, "pseudo", false);
+
+ final FeaturePredicate feature_predicate =
+ new FeaturePredicate () {
+ public boolean testPredicate (final Feature feature) {
+ if (!cds_predicate.testPredicate (feature)) {
+ return false;
+ }
+
+ if (feature.hasValidStopCodon ()) {
+ return false;
+ } else {
+ return true;
+ }
+ }
+ };
+
+ final String filter_name =
+ "CDS features with suspicious stop codons (filtered from: " +
+ parent_frame.getTitle () + ")";
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, feature_predicate, filter_name);
+
+ final FeatureListFrame feature_list_frame =
+ new FeatureListFrame (filter_name,
+ selection, goto_source, filtered_entry_group,
+ base_plot_group);
+
+ feature_list_frame.setVisible (true);
+ }
+
+ /**
+ * Popup a FeatureListFrame containing the non-pseudo CDS features that
+ * contain a stop codon in the translation.
+ * @param parent_frame The parent Frame.
+ * @param selection The Selection to pass to the FeatureList.
+ * @param entry_group The EntryGroup to pass to the FilteredEntryGroup.
+ * @param goto_source The GotoEventSource to pass to the FeatureList.
+ * @param base_plot_group The BasePlotGroup associated with this Menu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public static void showStopsInTranslation (final Frame parent_frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final GotoEventSource goto_source,
+ final BasePlotGroup
+ base_plot_group) {
+ final FeatureKeyQualifierPredicate cds_predicate =
+ new FeatureKeyQualifierPredicate (Key.CDS, "pseudo", false);
+
+ final FeaturePredicate feature_predicate =
+ new FeaturePredicate () {
+ public boolean testPredicate (final Feature feature) {
+ if (!cds_predicate.testPredicate (feature)) {
+ return false;
+ }
+
+ final AminoAcidSequence amino_acids = feature.getTranslation ();
+
+ if (amino_acids.containsStopCodon ()) {
+ return true;
+ } else {
+ return false;
+ }
+ }
+ };
+
+ final String filter_name =
+ "CDS features with stop codon(s) in translation (filtered from: " +
+ parent_frame.getTitle () + ")";
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, feature_predicate, filter_name);
+
+ final FeatureListFrame feature_list_frame =
+ new FeatureListFrame (filter_name,
+ selection, goto_source, filtered_entry_group,
+ base_plot_group);
+
+ feature_list_frame.setVisible (true);
+ }
+
+ /**
+ * Popup a FeatureListFrame containing the features that have non-EMBL keys.
+ * @param parent_frame The parent JFrame.
+ * @param selection The Selection to pass to the FeatureList.
+ * @param entry_group The EntryGroup to pass to the FilteredEntryGroup.
+ * @param goto_source The GotoEventSource to pass to the FeatureList.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public static void showNonEMBLKeys (final JFrame parent_frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final GotoEventSource goto_source,
+ final BasePlotGroup
+ base_plot_group) {
+ final FeaturePredicate feature_predicate =
+ new FeaturePredicate () {
+ public boolean testPredicate (final Feature feature) {
+ if (feature.hasValidEMBLKey ()) {
+ return false;
+ } else {
+ return true;
+ }
+ }
+ };
+
+ final String filter_name =
+ "features with a non-EMBL key (filtered from: " +
+ parent_frame.getTitle () + ")";
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, feature_predicate, filter_name);
+
+ final FeatureListFrame feature_list_frame =
+ new FeatureListFrame (filter_name,
+ selection, goto_source, filtered_entry_group,
+ base_plot_group);
+
+ feature_list_frame.setVisible (true);
+ }
+
+
+ /**
+ * Popup a FeatureListFrame containing the features that have the same key
+ * and location as another features (ie. duplicates).
+ * @param parent_frame The parent JFrame.
+ * @param selection The Selection to pass to the FeatureList.
+ * @param entry_group The EntryGroup to pass to the FilteredEntryGroup.
+ * @param goto_source The GotoEventSource to pass to the FeatureList.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public static void showDuplicatedFeatures (final JFrame parent_frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final GotoEventSource goto_source,
+ final BasePlotGroup
+ base_plot_group) {
+ final FeaturePredicate feature_predicate =
+ new FeaturePredicate () {
+ public boolean testPredicate (final Feature feature) {
+ final Entry feature_entry = feature.getEntry ();
+
+ final int feature_index = feature_entry.indexOf (feature);
+
+ if (feature_index + 1 == feature_entry.getFeatureCount ()) {
+ // last in the Entry
+ return false;
+ }
+
+ final Feature next_feature =
+ feature_entry.getFeature (feature_index + 1);
+
+ if (feature.getKey ().equals (next_feature.getKey ()) &&
+ feature.getLocation ().equals (next_feature.getLocation ())) {
+ return true;
+ } else {
+ return false;
+ }
+ }
+ };
+
+ final String filter_name =
+ "duplicated Features (filtered from: " +
+ parent_frame.getTitle () + ")";
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, feature_predicate, filter_name);
+
+ final FeatureListFrame feature_list_frame =
+ new FeatureListFrame (filter_name,
+ selection, goto_source, filtered_entry_group,
+ base_plot_group);
+
+ feature_list_frame.setVisible (true);
+ }
+
+ /**
+ * Popup a FeatureListFrame containing those CDS features that overlap with
+ * the next feature.
+ * @param parent_frame The parent JFrame.
+ * @param selection The Selection to pass to the FeatureList.
+ * @param entry_group The EntryGroup to pass to the FilteredEntryGroup.
+ * @param goto_source The GotoEventSource to pass to the FeatureList.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public static void showOverlappingCDSs (final JFrame parent_frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final GotoEventSource goto_source,
+ final BasePlotGroup
+ base_plot_group) {
+ final FeatureKeyPredicate cds_predicate =
+ new FeatureKeyPredicate (Key.CDS);
+
+ final FeaturePredicate feature_predicate =
+ new FeaturePredicate () {
+ public boolean testPredicate (final Feature test_feature) {
+ if (!cds_predicate.testPredicate (test_feature)) {
+ return false;
+ }
+
+ final Range feature_range = test_feature.getMaxRawRange ();
+
+ final FeatureVector overlapping_features;
+
+ try {
+ overlapping_features =
+ entry_group.getFeaturesInRange (feature_range);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+
+ for (int i = 0 ; i < overlapping_features.size () ; ++i) {
+ final Feature current_feature = overlapping_features.elementAt (i);
+
+ if (current_feature != test_feature &&
+ cds_predicate.testPredicate (current_feature)) {
+ return true;
+ }
+ }
+
+ return false;
+ }
+ };
+
+ final String filter_name =
+ "overlapping CDS features (filtered from: " +
+ parent_frame.getTitle () + ")";
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, feature_predicate, filter_name);
+
+ final FeatureListFrame feature_list_frame =
+ new FeatureListFrame (filter_name,
+ selection, goto_source, filtered_entry_group,
+ base_plot_group);
+
+ feature_list_frame.setVisible (true);
+ }
+
+ /**
+ * Popup a FeatureListFrame containing those CDS features that overlap with
+ * the next feature.
+ * @param parent_frame The parent JFrame.
+ * @param selection The Selection to pass to the FeatureList.
+ * @param entry_group The EntryGroup to pass to the FilteredEntryGroup.
+ * @param goto_source The GotoEventSource to pass to the FeatureList.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public static void
+ showFeaturesWithSameStopCodons (final JFrame parent_frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final GotoEventSource goto_source,
+ final BasePlotGroup base_plot_group) {
+ final FeatureKeyPredicate cds_predicate =
+ new FeatureKeyPredicate (Key.CDS);
+
+ final FeaturePredicate feature_predicate =
+ new FeaturePredicate () {
+ public boolean testPredicate (final Feature test_feature) {
+ if (!cds_predicate.testPredicate (test_feature)) {
+ return false;
+ }
+
+ final Range feature_range = test_feature.getMaxRawRange ();
+
+ final FeatureVector overlapping_features;
+
+ try {
+ overlapping_features =
+ entry_group.getFeaturesInRange (feature_range);
+ } catch (OutOfRangeException e) {
+ throw new Error ("internal error - unexpected exception: " + e);
+ }
+
+ for (int i = 0 ; i < overlapping_features.size () ; ++i) {
+ final Feature current_feature = overlapping_features.elementAt (i);
+
+ if (current_feature == test_feature) {
+ continue;
+ }
+
+ if (current_feature != test_feature &&
+ cds_predicate.testPredicate (current_feature) &&
+ (current_feature.getLastBase () ==
+ test_feature.getLastBase ()) &&
+ (current_feature.getSegments ().lastElement ().getFrameID () ==
+ test_feature.getSegments ().lastElement ().getFrameID ())) {
+ return true;
+ }
+ }
+
+ return false;
+ }
+ };
+
+ final String filter_name =
+ "CDS features with the same stop codon as another (filtered from: " +
+ parent_frame.getTitle () + ")";
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, feature_predicate, filter_name);
+
+ final FeatureListFrame feature_list_frame =
+ new FeatureListFrame (filter_name,
+ selection, goto_source, filtered_entry_group,
+ base_plot_group);
+
+ feature_list_frame.setVisible (true);
+ }
+
+ /**
+ * Popup a FeatureListFrame containing the features that are missing
+ * required EMBL qualifiers.
+ * @param parent_frame The parent JFrame.
+ * @param selection The Selection to pass to the FeatureList.
+ * @param entry_group The EntryGroup to pass to the FilteredEntryGroup.
+ * @param goto_source The GotoEventSource to pass to the FeatureList.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public static void showMissingQualifierFeatures (final JFrame parent_frame,
+ final Selection selection,
+ final EntryGroup
+ entry_group,
+ final GotoEventSource
+ goto_source,
+ final BasePlotGroup
+ base_plot_group) {
+ final FeaturePredicate feature_predicate =
+ new FeaturePredicate () {
+ public boolean testPredicate (final Feature feature) {
+ if (feature.hasRequiredQualifiers ()) {
+ return false;
+ } else {
+ return true;
+ }
+ }
+ };
+
+ final String filter_name =
+ "features that are missing a required EMBL " +
+ "qualifier (filtered from: " +
+ parent_frame.getTitle () + ")";
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, feature_predicate, filter_name);
+
+ final FeatureListFrame feature_list_frame =
+ new FeatureListFrame (filter_name,
+ selection, goto_source, filtered_entry_group,
+ base_plot_group);
+
+ feature_list_frame.setVisible (true);
+ }
+
+ /**
+ * Popup a FeatureListFrame containing only those features that have the
+ * key choosen by the user.
+ * @param parent_frame The parent JFrame.
+ * @param selection The Selection to pass to the FeatureList.
+ * @param entry_group The EntryGroup to pass to the FilteredEntryGroup.
+ * @param goto_source The GotoEventSource to pass to the FeatureList.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public static void showFilterByKey (final JFrame parent_frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final GotoEventSource goto_source,
+ final BasePlotGroup base_plot_group) {
+ final KeyChooser key_chooser;
+
+ key_chooser = new KeyChooser (Options.getArtemisEntryInformation (),
+ new Key ("misc_feature"));
+
+ key_chooser.getKeyChoice ().addItemListener (new ItemListener () {
+ public void itemStateChanged (ItemEvent e) {
+ if (e.getStateChange () == ItemEvent.SELECTED) {
+ showFilterByKeyHelper (parent_frame,
+ key_chooser.getKeyChoice ().getSelectedItem (),
+ selection, entry_group, goto_source,
+ base_plot_group);
+ key_chooser.setVisible (false);
+ key_chooser.dispose ();
+ }
+ }
+ });
+
+ key_chooser.getOKButton ().addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent _) {
+ showFilterByKeyHelper (parent_frame,
+ key_chooser.getKeyChoice ().getSelectedItem (),
+ selection, entry_group, goto_source,
+ base_plot_group);
+ key_chooser.setVisible (false);
+ key_chooser.dispose ();
+ }
+ });
+
+ key_chooser.setVisible (true);
+ }
+
+ /**
+ * Popup a FeatureListFrame containing only those features that have the
+ * key choosen by the user.
+ * @param parent_frame The parent JFrame.
+ * @param key The key to use in the filter.
+ * @param selection The Selection to pass to the FeatureList.
+ * @param entry_group The EntryGroup to pass to the FilteredEntryGroup.
+ * @param goto_source The GotoEventSource to pass to the FeatureList.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public static void showFilterByKeyHelper (final JFrame parent_frame,
+ final Key key,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final GotoEventSource
+ goto_source,
+ final BasePlotGroup
+ base_plot_group) {
+ final String filter_name =
+ "features with key: " + key + " (filtered from: " +
+ parent_frame.getTitle () + ")";
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group,
+ new FeatureKeyPredicate (key), filter_name);
+
+ final FeatureListFrame feature_list_frame =
+ new FeatureListFrame (filter_name,
+ selection, goto_source, filtered_entry_group,
+ base_plot_group);
+
+ feature_list_frame.setVisible (true);
+ }
+
+ /**
+ * Popup a FeatureListFrame containing only those features that are
+ * currently in the Selection.
+ * @param parent_frame The parent JFrame.
+ * @param selection The Selection to pass to the FeatureList and to use to
+ * filter the entry_group.
+ * @param entry_group The EntryGroup to pass to the FilteredEntryGroup.
+ * @param goto_source The GotoEventSource to pass to the FeatureList.
+ * @param base_plot_group The BasePlotGroup associated with this JMenu -
+ * needed to call getCodonUsageAlgorithm()
+ **/
+ public static void showFilterBySelection (final JFrame parent_frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final GotoEventSource
+ goto_source,
+ final BasePlotGroup
+ base_plot_group) {
+ final FeaturePredicate predicate =
+ new FeatureFromVectorPredicate (selection.getAllFeatures ());
+
+ final String filter_name =
+ "features from the selection (filtered from: " +
+ parent_frame.getTitle () + ")";
+
+ final FilteredEntryGroup filtered_entry_group =
+ new FilteredEntryGroup (entry_group, predicate, filter_name);
+
+ final FeatureListFrame feature_list_frame =
+ new FeatureListFrame (filter_name,
+ selection, goto_source, filtered_entry_group,
+ base_plot_group);
+
+ feature_list_frame.setVisible (true);
+ }
+
+ /**
+ * viewSelectedFeatures(), plotSelectedFeatures() etc. will only show this
+ * many features.
+ **/
+ private static final int MAXIMUM_SELECTED_FEATURES = 25;
+
+ /**
+ * Open a view window for each of the selected features. The viewer will
+ * listen for feature change events and update itself.
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The Selection containing the features to merge.
+ **/
+ static void viewSelectedFeatures (final JFrame frame,
+ final Selection selection) {
+ final FeatureVector features_to_view = selection.getAllFeatures ();
+
+ if (features_to_view.size () > MAXIMUM_SELECTED_FEATURES) {
+ new MessageDialog (frame, "warning: only viewing the first " +
+ MAXIMUM_SELECTED_FEATURES + " selected features");
+ }
+
+ for (int i = 0 ;
+ i < features_to_view.size () && i < MAXIMUM_SELECTED_FEATURES ;
+ ++i) {
+ final Feature selection_feature = features_to_view.elementAt (i);
+
+ new FeatureViewer (selection_feature);
+ }
+ }
+
+ /**
+ * Open an plot viewing window for each of the selected features. The plot
+ * viewer will listen for feature change events and update itself.
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The Selection containing the features to plot.
+ **/
+ static void plotSelectedFeatures (final JFrame frame,
+ final Selection selection) {
+ final FeatureVector features_to_plot = selection.getAllFeatures ();
+
+ if (features_to_plot.size () > MAXIMUM_SELECTED_FEATURES) {
+ new MessageDialog (frame, "warning: only showing plots for the first " +
+ MAXIMUM_SELECTED_FEATURES + " selected features");
+ }
+
+ for (int i = 0 ;
+ i < features_to_plot.size () && i < MAXIMUM_SELECTED_FEATURES ;
+ ++i) {
+ final Feature selection_feature = features_to_plot.elementAt (i);
+
+ new FeaturePlotGroup (selection_feature);
+ }
+ }
+
+ /**
+ * Show the output file from an external program (like fasta) for the
+ * selected Feature objects. The name of the file to read is stored in a
+ * feature qualifier. The qualifier used is the program name plus "_file".
+ * @param frame The JFrame to use for MessageDialog components.
+ * @param selection The Selection containing the features to merge.
+ * @param send_to_browser if true the results should be sent straight to
+ * the web browser rather than using a SearchResultViewer object.
+ **/
+ static void viewExternalResults (final JFrame frame,
+ final Selection selection,
+ final String program_name,
+ final boolean send_to_browser) {
+ final FeatureVector features_to_view = selection.getAllFeatures ();
+
+ if (features_to_view.size () > MAXIMUM_SELECTED_FEATURES) {
+ new MessageDialog (frame, "warning: only viewing results from " +
+ "the first " + MAXIMUM_SELECTED_FEATURES +
+ " selected features");
+ }
+
+ for (int i = 0 ;
+ i < features_to_view.size () && i < MAXIMUM_SELECTED_FEATURES ;
+ ++i) {
+ final Feature this_feature = features_to_view.elementAt (i);
+
+ String qualifier_value;
+
+ try {
+ qualifier_value =
+ this_feature.getValueOfQualifier (program_name + "_file");
+ } catch (InvalidRelationException e) {
+ qualifier_value = null;
+ }
+
+ String file_name = qualifier_value;
+
+ if (file_name == null || file_name.length () == 0) {
+ new MessageDialog (frame,
+ "Message",
+ "No " + program_name + " results for " +
+ this_feature.getIDString ());
+
+ continue;
+ }
+
+ // remove the program name string (if any) from the qualifier, so that
+ // we can try to read the file with and without the prefix.
+ if (file_name.startsWith (program_name + File.separatorChar)) {
+ file_name = file_name.substring (program_name.length () + 1);
+ }
+
+ Document root_document = this_feature.getEntry ().getRootDocument ();
+
+ if (root_document == null) {
+ root_document = new FileDocument (new File ("."));
+ }
+
+ try {
+ Document document = null;
+
+ // try the current directory with the program name added:
+ // ./fasta/abc.seq.00001.out
+ final File dir_name = new File (program_name);
+
+ final Document [] possible_documents =
+ new Document [] {
+ root_document.append (program_name).append (file_name),
+ root_document.append (file_name),
+ new FileDocument (new File (file_name)),
+ new FileDocument (dir_name).append (file_name),
+ };
+
+ for (int possible_document_index = 0 ;
+ possible_document_index < possible_documents.length ;
+ ++possible_document_index) {
+
+ final Document this_document =
+ possible_documents[possible_document_index];
+
+ if (this_document.readable ()) {
+ document = this_document;
+ break;
+ } else {
+ final File gzip_file =
+ new File (this_document.toString () + ".gz");
+ final Document gzip_document =
+ new FileDocument (gzip_file);
+
+ if (gzip_document.readable ()) {
+ document = gzip_document;
+ break;
+ }
+ }
+ }
+
+ if (document == null) {
+ final String message_string =
+ "No " + program_name + " results for " +
+ this_feature.getIDString () + " (file not found: " +
+ qualifier_value + ")";
+
+ new MessageDialog (frame, message_string);
+
+ continue;
+ }
+
+ if (send_to_browser) {
+ SearchResultViewer.sendToBrowser (document.toString ());
+ } else {
+ new SearchResultViewer (program_name + " results for " +
+ this_feature.getIDString () + " from " +
+ document,
+ document);
+ }
+ } catch (ExternalProgramException e) {
+ new MessageDialog (frame,
+ "error while open results file: " + e);
+ } catch (IOException e) {
+ new MessageDialog (frame,
+ "error while open results file: " + e);
+ }
+ }
+ }
+
+ /**
+ * Open a FeatureInfo component for each of the selected features. The
+ * new component will listen for feature change events and update itself.
+ **/
+ private void viewSelectedFeatureInfo () {
+ final FeatureVector features_to_view = getSelection ().getAllFeatures ();
+
+ if (features_to_view.size () > MAXIMUM_SELECTED_FEATURES) {
+ new MessageDialog (getParentFrame (),
+ "warning: only viewing the statistics for " +
+ "the first " + MAXIMUM_SELECTED_FEATURES +
+ " selected features");
+ }
+
+ for (int i = 0 ;
+ i < features_to_view.size () && i < MAXIMUM_SELECTED_FEATURES ;
+ ++i) {
+ final Feature selection_feature = features_to_view.elementAt (i);
+
+ new FeatureInfo (selection_feature,
+ base_plot_group.getCodonUsageAlgorithm ());
+ }
+ }
+
+ /**
+ * View the bases of the selected features. This creates a
+ * FeatureBaseViewer for each feature.
+ * @param include_numbers If true then the sequence will be numbered
+ * (every second line of the display will be numbers rather than
+ * sequence).
+ **/
+ private void viewSelectedBases (final boolean include_numbers) {
+ if (getSelection ().isEmpty ()) {
+ new MessageDialog (getParentFrame (), "Nothing selected");
+ return;
+ }
+
+ final MarkerRange range = selection.getMarkerRange ();
+
+ if (range == null) {
+ final FeatureVector features_to_view = getSelection ().getAllFeatures ();
+
+ if (features_to_view.size () > MAXIMUM_SELECTED_FEATURES) {
+ new MessageDialog (getParentFrame (),
+ "waning: only viewing bases for " +
+ "the first " + MAXIMUM_SELECTED_FEATURES +
+ " selected features");
+ }
+
+ for (int i = 0 ;
+ i < features_to_view.size () && i < MAXIMUM_SELECTED_FEATURES ;
+ ++i) {
+ final Feature this_feature = features_to_view.elementAt (i);
+
+ new FeatureBaseViewer (this_feature, include_numbers);
+ }
+ } else {
+ final SequenceViewer sequence_viewer =
+ new SequenceViewer ("Selected bases", include_numbers);
+
+ final String bases = getSelection ().getSelectionText ();
+ sequence_viewer.setSequence (null, bases);
+ }
+ }
+
+ /**
+ * View the bases of the selected CDS features. This creates a
+ * FeatureBaseViewer for each CDS feature.
+ * @param include_numbers If true then the amino acids will be numbered
+ * (every second line of the display will be numbers rather than
+ * sequence).
+ **/
+ private void viewSelectedAminoAcids (final boolean include_numbers) {
+ if (getSelection ().isEmpty ()) {
+ new MessageDialog (getParentFrame (), "Nothing selected");
+ return;
+ }
+
+ final MarkerRange range = selection.getMarkerRange ();
+
+ if (range == null) {
+ final FeatureVector features_to_view = getSelection ().getAllFeatures ();
+
+ if (features_to_view.size () > MAXIMUM_SELECTED_FEATURES) {
+ new MessageDialog (getParentFrame (),
+ "warning: only viewing amino acids for " +
+ "the first " + MAXIMUM_SELECTED_FEATURES +
+ " selected features");
+ }
+
+ for (int i = 0 ;
+ i < features_to_view.size () && i < MAXIMUM_SELECTED_FEATURES ;
+ ++i) {
+ final Feature this_feature = features_to_view.elementAt (i);
+
+ new FeatureAminoAcidViewer (this_feature, include_numbers);
+ }
+ } else {
+ final SequenceViewer sequence_viewer =
+ new SequenceViewer ("Selected bases (translated)", include_numbers);
+
+ final String bases = getSelection ().getSelectionText ();
+
+ final AminoAcidSequence amino_acids =
+ AminoAcidSequence.getTranslation (bases, true);
+
+ sequence_viewer.setSequence (null, amino_acids.toString ());
+ }
+ }
+
+ /**
+ * Check that the number of features in the EntryGroup is less than the
+ * given number. If it is less return true. If not then popup a
+ * YesNoDialog asking for confirmation and return true if and only if the
+ * user chooses yes.
+ **/
+ private boolean checkEntryGroupSize (final int max_size) {
+ final int feature_count = getEntryGroup ().getAllFeaturesCount ();
+
+ if (feature_count < max_size) {
+ return true;
+ } else {
+ final YesNoDialog dialog =
+ new YesNoDialog (getParentFrame (),
+ "there are " + feature_count + " features in the " +
+ "active entries - continue?");
+
+ return dialog.getResult ();
+ }
+ }
+
+ /**
+ * Return the EntryGroup that was passed to the constructor.
+ **/
+ private EntryGroup getEntryGroup () {
+ return entry_group;
+ }
+
+ private JMenuItem feature_info_item = null;
+ private JMenuItem plot_features_item = null;
+ private JMenuItem view_feature_item = null;
+ private JMenuItem view_selection_item = null;
+ private JMenuItem view_fasta_item = null;
+ private JMenuItem view_bases_item = null;
+ private JMenuItem view_bases_as_fasta_item = null;
+ private JMenuItem view_aa_item = null;
+ private JMenuItem view_aa_as_fasta_item = null;
+ private JMenuItem overview_item = null;
+ private JMenuItem forward_overview_item = null;
+ private JMenuItem reverse_overview_item = null;
+ private JMenuItem view_cds_item = null;
+
+ /**
+ * The EntryGroup that was passed to the constructor.
+ **/
+ private EntryGroup entry_group = null;
+
+ /**
+ * The Selection that was passed to the constructor.
+ **/
+ private Selection selection = null;
+
+ /**
+ * The GotoEventSource that was passed to the constructor.
+ **/
+ private GotoEventSource goto_event_source = null;
+
+ private BasePlotGroup base_plot_group;
+}
diff --git a/uk/ac/sanger/artemis/components/WritableEMBLCorbaEntrySource.java b/uk/ac/sanger/artemis/components/WritableEMBLCorbaEntrySource.java
new file mode 100644
index 000000000..87ff712d3
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/WritableEMBLCorbaEntrySource.java
@@ -0,0 +1,226 @@
+/* WritableEMBLCorbaEntrySource.java
+ *
+ * created: Mon Jun 12 2000
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 2000,2002x Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/WritableEMBLCorbaEntrySource.java,v 1.1 2004-06-09 09:47:59 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import uk.ac.sanger.artemis.util.*;
+import uk.ac.sanger.artemis.io.LocationParseException;
+import uk.ac.sanger.artemis.io.InvalidKeyException;
+
+import nsdb.ServerInfo;
+import nsdb.EntryStats;
+import nsdb.EmblSeq;
+import nsdb.EmblPackage.Superceded;
+import type.NoResult;
+
+import java.io.*;
+import java.awt.*;
+import java.net.*;
+
+import javax.swing.*;
+
+/**
+ * This is an EntrySource that can get writable Entry objects from an EMBL
+ * CORBA server.
+ *
+ * @author Kim Rutherford <kmr@sanger.ac.uk>
+ * @version $Id: WritableEMBLCorbaEntrySource.java,v 1.1 2004-06-09 09:47:59 tjc Exp $
+ **/
+
+public class WritableEMBLCorbaEntrySource extends EMBLCorbaEntrySource {
+ /**
+ * Create a new WritableEMBLCorbaEntrySource from the given String.
+ * @param frame The component that created this EntrySource. (Used for
+ * requesters.)
+ * @param ior_url_string A String containing the URL of the IOR for the
+ * server.
+ **/
+ public WritableEMBLCorbaEntrySource (final JFrame frame,
+ final String ior_url_string)
+ throws MalformedURLException {
+ super (frame, ior_url_string);
+ }
+
+ /**
+ * Get an Entry object from the Ensembl CORBA server.
+ * @param bases The Bases object to pass to the Entry constructor.
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading.
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ **/
+ public Entry getEntry (final Bases bases, final boolean show_progress)
+ throws OutOfRangeException, IOException {
+ return makeCorbaDialog (bases, false);
+ }
+
+ /**
+ * Get an Entry object from the Ensembl CORBA server.
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ * @exception NoSequenceException Thrown if the entry that we read has no
+ * sequence.
+ * @param show_progress If true a InputStreamProgressDialog will be shown
+ * while loading.
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ **/
+ public Entry getEntry (final boolean show_progress)
+ throws OutOfRangeException, NoSequenceException, IOException {
+ return makeCorbaDialog (null, false);
+ }
+
+ /**
+ * Create a TextRequester, wait for the user to type an accession number
+ * and then read that entry from the EMBL CORBA server.
+ * @param bases If this is null a new Bases object will be created for the
+ * Entry once it has been read from the server. If not null then it will
+ * be passed to the Entry constructor.
+ * @param read_only true if and only if a read-only Entry should be created
+ * (some are always read only).
+ * @return null if and only if the user cancels the read or if the read
+ * fails.
+ * @exception OutOfRangeException Thrown if one of the features in
+ * the Entry is out of range of the Bases object.
+ **/
+ protected Entry makeCorbaDialog (final Bases bases,
+ final boolean read_only)
+ throws OutOfRangeException, IOException {
+ final org.omg.CORBA.ORB orb =
+ org.omg.CORBA.ORB.init (new String [0], new java.util.Properties());
+
+ final nsdb.Embl corba_handle = getServerHandle ();
+
+ final nsdb.EmblWriter embl_writer =
+ nsdb.EmblWriterHelper.narrow (corba_handle);
+
+ if (embl_writer == null) {
+ final String message = "Server reference is not an EmblWriter: " +
+ corba_handle;
+ new MessageDialog (getFrame (), message);
+ return null;
+ }
+
+ final ListDialog list_dialog =
+ new ListDialog (getFrame (), "Select an entry");
+
+ final ServerInfo stats = embl_writer.getServerInfo ();
+
+ final EntryStats [] entry_stats_list = stats.entry_stats_list;
+ final EntryStats [] file_stats_list = stats.file_stats_list;
+
+ list_dialog.getList ().setModel (new AbstractListModel () {
+ public int getSize () {
+ return entry_stats_list.length + file_stats_list.length;
+ }
+ public Object getElementAt (int i) {
+ if (i < entry_stats_list.length) {
+ return makeListString (entry_stats_list[i], false);
+ } else {
+ return makeListString (file_stats_list[i-entry_stats_list.length],
+ true);
+ }
+ }
+ });
+
+ // returns when user hits ok or cancel
+ final String selected_entry_string =
+ (String) list_dialog.getSelectedValue ();
+
+ if (selected_entry_string == null) {
+ // user hit cancel
+ return null;
+ }
+
+ final int end_of_entry_name = selected_entry_string.indexOf (" ");
+
+ final String corba_id =
+ selected_entry_string.substring (0, end_of_entry_name);
+
+ if (corba_id.length () > 0) {
+ final MessageDialog message_frame =
+ new MessageDialog (getFrame (),
+ "reading entry - please wait", false);
+
+ try {
+ return makeFromCorbaID (bases, corba_id, read_only);
+ } finally {
+ message_frame.dispose ();
+ }
+ } else {
+ return null;
+ }
+ }
+
+ /**
+ * Make a ListDialog then let the user choose an entry.
+ **/
+ private String makeListString (final EntryStats this_entry_stats,
+ final boolean is_file_entry) {
+ final StringBuffer buffer = new StringBuffer ();
+
+ buffer.append (this_entry_stats.name).append (" ");
+
+ for (int j = 0 ; j < (30 - this_entry_stats.name.length ()) ; ++j) {
+ buffer.append (" ");
+ }
+
+ final long last_change_time = this_entry_stats.last_change_time;
+
+ if (is_file_entry) {
+ buffer.append ("(file)");
+ } else {
+ if (last_change_time > 0) {
+ buffer.append (new java.util.Date (last_change_time * 1000L));
+ } else {
+ buffer.append ("(not saved)");
+ }
+ }
+
+ return buffer.toString ();
+ }
+
+ /**
+ * Return the name of this source (for display to the user in menus).
+ **/
+ public String getSourceName () {
+ return "Database";
+ }
+
+ /**
+ * Returns true if and only if this EntrySource always returns "full"
+ * entries. ie. entries that contain features and sequence. Entries that
+ * are read from a file may contain just features so in this class this
+ * method returns false.
+ **/
+ public boolean isFullEntrySource () {
+ return false;
+ }
+}
diff --git a/uk/ac/sanger/artemis/components/WriteMenu.java b/uk/ac/sanger/artemis/components/WriteMenu.java
new file mode 100644
index 000000000..32c5a7402
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/WriteMenu.java
@@ -0,0 +1,852 @@
+/* WriteMenu.java
+ *
+ * created: Mon Jan 11 1999
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/WriteMenu.java,v 1.1 2004-06-09 09:48:00 tjc Exp $
+ **/
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.*;
+import uk.ac.sanger.artemis.sequence.*;
+
+import uk.ac.sanger.artemis.io.Sequence;
+import uk.ac.sanger.artemis.io.StreamSequence;
+import uk.ac.sanger.artemis.io.FastaStreamSequence;
+import uk.ac.sanger.artemis.io.RawStreamSequence;
+import uk.ac.sanger.artemis.io.EmblStreamSequence;
+import uk.ac.sanger.artemis.io.GenbankStreamSequence;
+import uk.ac.sanger.artemis.io.StreamSequenceFactory;
+
+import java.awt.*;
+import java.awt.event.*;
+import java.io.*;
+
+import javax.swing.*;
+
+/**
+ * A menu of commands for writing out protein and bases.
+ *
+ * @author Kim Rutherford
+ * @version $Id: WriteMenu.java,v 1.1 2004-06-09 09:48:00 tjc Exp $
+ **/
+
+public class WriteMenu extends SelectionMenu {
+ /**
+ * Create a new WriteMenu component.
+ * @param frame The JFrame that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param entry_group The EntryGroup object to use when writing a sequence.
+ * @param menu_name The name of the new menu.
+ **/
+ public WriteMenu (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group,
+ final String menu_name) {
+ super (frame, menu_name, selection);
+
+ this.entry_group = entry_group;
+
+ final JMenuItem aa_item = new JMenuItem ("Amino Acids Of Selected Features");
+ aa_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeAminoAcids ();
+ }
+ });
+
+ add (aa_item);
+
+ final JMenuItem pir_item =
+ new JMenuItem ("PIR Database Of Selected Features");
+ pir_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writePIRDataBase ();
+ }
+ });
+
+ add (pir_item);
+
+ addSeparator ();
+
+ final JMenu bases_menu = new JMenu ("Bases Of Selection");
+
+ final JMenuItem raw_bases_item = new JMenuItem ("Raw Format");
+ raw_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeBasesOfSelection (StreamSequenceFactory.RAW_FORMAT);
+ }
+ });
+
+ bases_menu.add (raw_bases_item);
+
+ final JMenuItem fasta_bases_item = new JMenuItem ("FASTA Format");
+ fasta_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeBasesOfSelection (StreamSequenceFactory.FASTA_FORMAT);
+ }
+ });
+
+ bases_menu.add (fasta_bases_item);
+
+ final JMenuItem embl_bases_item = new JMenuItem ("EMBL Format");
+ embl_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeBasesOfSelection (StreamSequenceFactory.EMBL_FORMAT);
+ }
+ });
+
+ bases_menu.add (embl_bases_item);
+
+ final JMenuItem genbank_bases_item = new JMenuItem ("Genbank Format");
+ genbank_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeBasesOfSelection (StreamSequenceFactory.GENBANK_FORMAT);
+ }
+ });
+
+ bases_menu.add (genbank_bases_item);
+
+ add (bases_menu);
+
+ final JMenu upstream_bases_menu =
+ new JMenu ("Upstream Bases Of Selected Features");
+
+ final JMenuItem raw_upstream_bases_item = new JMenuItem ("Raw Format");
+ raw_upstream_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeUpstreamBases (StreamSequenceFactory.RAW_FORMAT);
+ }
+ });
+
+ upstream_bases_menu.add (raw_upstream_bases_item);
+
+ final JMenuItem fasta_upstream_bases_item = new JMenuItem ("FASTA Format");
+ fasta_upstream_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeUpstreamBases (StreamSequenceFactory.FASTA_FORMAT);
+ }
+ });
+
+ upstream_bases_menu.add (fasta_upstream_bases_item);
+
+ final JMenuItem embl_upstream_bases_item = new JMenuItem ("EMBL Format");
+ embl_upstream_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeUpstreamBases (StreamSequenceFactory.EMBL_FORMAT);
+ }
+ });
+
+ upstream_bases_menu.add (embl_upstream_bases_item);
+
+ final JMenuItem genbank_upstream_bases_item = new JMenuItem ("Genbank Format");
+ genbank_upstream_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeUpstreamBases (StreamSequenceFactory.GENBANK_FORMAT);
+ }
+ });
+
+ upstream_bases_menu.add (genbank_upstream_bases_item);
+
+ add (upstream_bases_menu);
+
+ final JMenu downstream_bases_menu =
+ new JMenu ("Downstream Bases Of Selected Features");
+
+ final JMenuItem raw_downstream_bases_item = new JMenuItem ("Raw Format");
+ raw_downstream_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeDownstreamBases (StreamSequenceFactory.RAW_FORMAT);
+ }
+ });
+
+ downstream_bases_menu.add (raw_downstream_bases_item);
+
+ final JMenuItem fasta_downstream_bases_item = new JMenuItem ("FASTA Format");
+ fasta_downstream_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeDownstreamBases (StreamSequenceFactory.FASTA_FORMAT);
+ }
+ });
+
+ downstream_bases_menu.add (fasta_downstream_bases_item);
+
+ final JMenuItem embl_downstream_bases_item = new JMenuItem ("EMBL Format");
+ embl_downstream_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeDownstreamBases (StreamSequenceFactory.EMBL_FORMAT);
+ }
+ });
+
+ downstream_bases_menu.add (embl_downstream_bases_item);
+
+ final JMenuItem genbank_downstream_bases_item =
+ new JMenuItem ("Genbank Format");
+ genbank_downstream_bases_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeDownstreamBases (StreamSequenceFactory.GENBANK_FORMAT);
+ }
+ });
+
+ downstream_bases_menu.add (genbank_downstream_bases_item);
+
+ add (downstream_bases_menu);
+
+ addSeparator ();
+
+ final JMenu write_all_bases_menu = new JMenu ("Write All Bases");
+
+ final JMenuItem write_raw_item = new JMenuItem ("Raw Format");
+ write_raw_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeAllSequence (StreamSequenceFactory.RAW_FORMAT);
+ }
+ });
+
+ write_all_bases_menu.add (write_raw_item);
+
+ final JMenuItem write_fasta_item = new JMenuItem ("FASTA Format");
+ write_fasta_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeAllSequence (StreamSequenceFactory.FASTA_FORMAT);
+ }
+ });
+
+ write_all_bases_menu.add (write_fasta_item);
+
+ final JMenuItem write_embl_item = new JMenuItem ("EMBL Format");
+ write_embl_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeAllSequence (StreamSequenceFactory.EMBL_FORMAT);
+ }
+ });
+
+ write_all_bases_menu.add (write_embl_item);
+
+ final JMenuItem write_genbank_item = new JMenuItem ("Genbank Format");
+ write_genbank_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeAllSequence (StreamSequenceFactory.GENBANK_FORMAT);
+ }
+ });
+
+ write_all_bases_menu.add (write_genbank_item);
+
+ add (write_all_bases_menu);
+
+ addSeparator ();
+
+ final JMenuItem codon_usage_item =
+ new JMenuItem ("Write Codon Usage of Selected Features");
+ codon_usage_item.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent event) {
+ writeCodonUsage ();
+ }
+ });
+
+ add (codon_usage_item);
+ }
+
+ /**
+ * Create a new WriteMenu component.
+ * @param frame The JFrame that owns this JMenu.
+ * @param selection The Selection that the commands in the menu will
+ * operate on.
+ * @param entry_group The EntryGroup object to use when writing a sequence.
+ **/
+ public WriteMenu (final JFrame frame,
+ final Selection selection,
+ final EntryGroup entry_group) {
+ this (frame, selection, entry_group, "Write");
+ }
+
+ /**
+ * Write a PIR database of the selected features to a file choosen by the
+ * user.
+ **/
+ private void writePIRDataBase () {
+ if (! checkForSelectionFeatures ()) {
+ return;
+ }
+
+ final File write_file =
+ getWriteFile ("Select a PIR output file name ...", "cosmid.pir");
+
+ if (write_file == null) {
+ return;
+ }
+
+ try {
+ final FileWriter writer = new FileWriter (write_file);
+
+ final FeatureVector features_to_write =
+ getSelection ().getAllFeatures ();
+
+ for (int i = 0 ; i < features_to_write.size () ; ++i) {
+ final Feature selection_feature = features_to_write.elementAt (i);
+
+ selection_feature.writePIROfFeature (writer);
+ }
+
+ writer.close ();
+ } catch (IOException e) {
+ new MessageDialog (getParentFrame (),
+ "error while writing: " + e.getMessage ());
+ }
+ }
+
+ /**
+ * Write the amino acid symbols of the selected features to a file choosen
+ * by the user.
+ **/
+ private void writeAminoAcids () {
+ if (! checkForSelectionFeatures ()) {
+ return;
+ }
+
+ final File write_file =
+ getWriteFile ("Select an output file name..", "amino_acids");
+
+ if (write_file == null) {
+ return;
+ }
+
+ try {
+ final FileWriter writer = new FileWriter (write_file);
+
+ final FeatureVector features_to_write =
+ getSelection ().getAllFeatures ();
+
+ for (int i = 0 ; i < features_to_write.size () ; ++i) {
+ final Feature selection_feature = features_to_write.elementAt (i);
+
+ selection_feature.writeAminoAcidsOfFeature (writer);
+ }
+
+ writer.close ();
+ } catch (IOException e) {
+ new MessageDialog (getParentFrame (),
+ "error while writing: " + e.getMessage ());
+ }
+ }
+
+ /**
+ * Write the bases of the selection to a file choosen by the user.
+ * @param output_type One of EMBL_FORMAT, RAW_FORMAT etc.
+ **/
+ private void writeBasesOfSelection (final int output_type) {
+ final MarkerRange marker_range = getSelection ().getMarkerRange ();
+
+ if (marker_range == null) {
+ writeFeatureBases (output_type);
+ } else {
+ final String selection_bases = Strand.markerRangeBases (marker_range);
+
+ writeBases (selection_bases,
+ "selected bases",
+ getSequenceFileName (output_type),
+ output_type);
+ }
+ }
+
+ /**
+ * Write the bases of the selected features to a file choosen by the user
+ * or show a message and return immediately if there are no selected
+ * features.
+ * @param sequence The sequence to be written.
+ * @param header The header line that will be used on those output formats
+ * that need it.
+ * @param default_output_filename The filename that is passed to
+ * getWriteFile ()
+ * @param output_type One of EMBL_FORMAT, RAW_FORMAT etc.
+ **/
+ private void writeBases (final String sequence,
+ final String header,
+ final String default_output_filename,
+ final int output_type) {
+ final File write_file =
+ getWriteFile ("Select an output file name ...", default_output_filename);
+
+ if (write_file == null) {
+ return;
+ }
+
+ try {
+ final FileWriter writer = new FileWriter (write_file);
+
+ final StreamSequence stream_sequence;
+
+ switch (output_type) {
+ case StreamSequenceFactory.FASTA_FORMAT:
+ stream_sequence =
+ new FastaStreamSequence (sequence, header);
+ break;
+
+ case StreamSequenceFactory.EMBL_FORMAT:
+ stream_sequence =
+ new EmblStreamSequence (sequence);
+ break;
+
+ case StreamSequenceFactory.GENBANK_FORMAT:
+ stream_sequence =
+ new GenbankStreamSequence (sequence);
+ break;
+
+ case StreamSequenceFactory.RAW_FORMAT:
+ default:
+ stream_sequence =
+ new RawStreamSequence (sequence);
+ break;
+ }
+
+ stream_sequence.writeToStream (writer);
+
+ writer.close ();
+ } catch (IOException e) {
+ new MessageDialog (getParentFrame (),
+ "error while writing: " + e.getMessage ());
+ }
+ }
+
+ /**
+ * Write the bases of the selected features to a file choosen by the user
+ * or show a message and return immediately if there are no selected
+ * features.
+ * @param output_type One of EMBL_FORMAT, RAW_FORMAT etc.
+ **/
+ private void writeFeatureBases (final int output_type) {
+ if (! checkForSelectionFeatures ()) {
+ return;
+ }
+
+ final File write_file =
+ getWriteFile ("Select an output file name ...", "bases");
+
+ if (write_file == null) {
+ return;
+ }
+
+ try {
+ final FileWriter writer = new FileWriter (write_file);
+
+ final FeatureVector features_to_write =
+ getSelection ().getAllFeatures ();
+
+ for (int i = 0 ; i < features_to_write.size () ; ++i) {
+ final Feature selection_feature = features_to_write.elementAt (i);
+
+ final StringBuffer header_buffer = new StringBuffer ();
+
+ header_buffer.append (selection_feature.getSystematicName ());
+ header_buffer.append (" ");
+ header_buffer.append (selection_feature.getIDString ());
+ header_buffer.append (" ");
+
+ final String product = selection_feature.getProductString ();
+
+ if (product == null) {
+ header_buffer.append ("undefined product");
+ } else {
+ header_buffer.append (product);
+ }
+
+ header_buffer.append (" ").append (selection_feature.getWriteRange ());
+
+ final StreamSequence stream_sequence =
+ getStreamSequence (selection_feature.getBases (),
+ header_buffer.toString (),
+ output_type);
+
+ stream_sequence.writeToStream (writer);
+ }
+
+ writer.close ();
+ } catch (IOException e) {
+ new MessageDialog (getParentFrame (),
+ "error while writing: " + e.getMessage ());
+ }
+ }
+
+ /**
+ * Return a StreamSequence object for the given sequence string and the
+ * given type.
+ * @param sequence A String containing the sequence.
+ * @param header The header line that will be used on those output formats
+ * that need it.
+ * @param output_type One of EMBL_FORMAT, RAW_FORMAT etc.
+ **/
+ private StreamSequence getStreamSequence (final String sequence,
+ final String header,
+ final int output_type) {
+
+ switch (output_type) {
+ case StreamSequenceFactory.FASTA_FORMAT:
+ return new FastaStreamSequence (sequence, header);
+
+ case StreamSequenceFactory.EMBL_FORMAT:
+ return new EmblStreamSequence (sequence);
+
+ case StreamSequenceFactory.GENBANK_FORMAT:
+ return new GenbankStreamSequence (sequence);
+
+ case StreamSequenceFactory.RAW_FORMAT:
+ default:
+ return new RawStreamSequence (sequence);
+ }
+ }
+
+ /**
+ * Write the upstream bases of the selected features to a file choosen by
+ * the user. The user can also choose the number of upstream base to
+ * write.
+ * @param output_type One of EMBL_FORMAT, RAW_FORMAT etc.
+ **/
+ private void writeUpstreamBases (final int output_type) {
+ if (! checkForSelectionFeatures ()) {
+ return;
+ }
+
+ final TextRequester text_requester =
+ new TextRequester ("write how many bases upstream of each feature?",
+ 18, "");
+
+ text_requester.addTextRequesterListener (new TextRequesterListener () {
+ public void actionPerformed (final TextRequesterEvent event) {
+ if (event.getType () == TextRequesterEvent.CANCEL) {
+ return;
+ }
+
+ final String base_count_string = event.getRequesterText ().trim ();
+
+ if (base_count_string.length () == 0) {
+ new MessageDialog (getParentFrame (), "no bases written");
+ return;
+ }
+
+ try {
+ final int base_count =
+ Integer.valueOf (base_count_string).intValue ();
+
+
+ final File write_file =
+ getWriteFile ("Select an output file name ...",
+ "upstream_" + getSequenceFileName (output_type));
+
+ if (write_file == null) {
+ return;
+ }
+
+ try {
+ final FileWriter writer = new FileWriter (write_file);
+
+ final FeatureVector features_to_write =
+ getSelection ().getAllFeatures ();
+
+ for (int i = 0 ; i < features_to_write.size () ; ++i) {
+ final Feature selection_feature =
+ features_to_write.elementAt (i);
+
+ final String sequence_string =
+ selection_feature.getUpstreamBases (base_count);
+
+
+ final String header_line =
+ selection_feature.getIDString () + " - " +
+ sequence_string.length () + " bases upstream";
+
+ final StreamSequence stream_sequence =
+ getStreamSequence (sequence_string,
+ header_line,
+ output_type);
+
+ stream_sequence.writeToStream (writer);
+ }
+
+ writer.close ();
+ } catch (IOException e) {
+ new MessageDialog (getParentFrame (),
+ "error while writing: " + e.getMessage ());
+ }
+ } catch (NumberFormatException e) {
+ new MessageDialog (getParentFrame (),
+ "this is not a number: " + base_count_string);
+ }
+ }
+ });
+
+ text_requester.show ();
+ }
+
+ /**
+ * Write the downstream bases of the selected features to a file choosen by
+ * the user. The user can also choose the number of downstream base to
+ * write.
+ * @param output_type One of EMBL_FORMAT, RAW_FORMAT etc.
+ **/
+ private void writeDownstreamBases (final int output_type) {
+ if (! checkForSelectionFeatures ()) {
+ return;
+ }
+
+ final TextRequester text_requester =
+ new TextRequester ("write how many bases downstream of each feature?",
+ 18, "");
+
+ text_requester.addTextRequesterListener (new TextRequesterListener () {
+ public void actionPerformed (final TextRequesterEvent event) {
+ if (event.getType () == TextRequesterEvent.CANCEL) {
+ return;
+ }
+
+ final String base_count_string = event.getRequesterText ().trim ();
+
+ if (base_count_string.length () == 0) {
+ new MessageDialog (getParentFrame (), "no bases written");
+ return;
+ }
+
+ try {
+ final int base_count =
+ Integer.valueOf (base_count_string).intValue ();
+
+ final File write_file =
+ getWriteFile ("Select an output file name ...",
+ "downstream_" + getSequenceFileName (output_type));
+
+ if (write_file == null) {
+ return;
+ }
+
+ try {
+ final FileWriter writer = new FileWriter (write_file);
+
+ final FeatureVector features_to_write =
+ getSelection ().getAllFeatures ();
+
+ for (int i = 0 ; i < features_to_write.size () ; ++i) {
+ final Feature selection_feature =
+ features_to_write.elementAt (i);
+
+ final String sequence_string =
+ selection_feature.getDownstreamBases (base_count);
+
+
+ final String header_line =
+ selection_feature.getIDString () + " - " +
+ sequence_string.length () + " bases downstream ";
+
+ final StreamSequence stream_sequence =
+ getStreamSequence (sequence_string,
+ header_line,
+ output_type);
+
+ stream_sequence.writeToStream (writer);
+ }
+
+ writer.close ();
+ } catch (IOException e) {
+ new MessageDialog (getParentFrame (),
+ "error while writing: " + e.getMessage ());
+ }
+ } catch (NumberFormatException e) {
+ new MessageDialog (getParentFrame (),
+ "this is not a number: " + base_count_string);
+ }
+ }
+ });
+
+ text_requester.show ();
+ }
+
+ /**
+ * Helper method for writeFeatureBases (), writeUpstreamBases () and
+ * writeDownstreamBases ().
+ * @return A string of the form "100:200 reverse" or "1:2222 forward".
+ **/
+ private static String getWriteRange (final Feature feature) {
+ return (feature.isForwardFeature () ?
+ feature.getFirstCodingBaseMarker ().getRawPosition () + ":" +
+ feature.getLastBaseMarker ().getRawPosition () +
+ " forward" :
+ feature.getLastBaseMarker ().getRawPosition () + ":" +
+ feature.getFirstCodingBaseMarker ().getRawPosition () +
+ " reverse");
+ }
+
+
+ /**
+ * Return a sensible file name to write sequence of the given type to.
+ * @param output_type One of EMBL_FORMAT, RAW_FORMAT etc.
+ **/
+ private String getSequenceFileName (final int output_type) {
+ switch (output_type) {
+ case StreamSequenceFactory.FASTA_FORMAT:
+ return "sequence.dna";
+
+ case StreamSequenceFactory.EMBL_FORMAT:
+ return "sequence.embl";
+
+ case StreamSequenceFactory.GENBANK_FORMAT:
+ return "sequence.genbank";
+
+ case StreamSequenceFactory.RAW_FORMAT:
+ default:
+ return "sequence.seq";
+ }
+ }
+
+ /**
+ * Write the bases from entry_group as raw sequence.
+ * @param output_type One of EMBL_FORMAT, RAW_FORMAT etc.
+ **/
+ private void writeAllSequence (final int output_type) {
+ final String file_name = getSequenceFileName (output_type);
+
+ writeBases (entry_group.getBases ().toString (),
+ "all_bases", file_name, output_type);
+ }
+
+ /**
+ * Popup a requester and ask for a file name to write to. If the file
+ * exists ask the user whether to overwrite.
+ * @param title The title of the new FileDialog JFrame.
+ * @param default_name The name to put in the FileDialog as a default.
+ **/
+ private File getWriteFile (final String title, final String default_name) {
+ final JFileChooser dialog = new StickyFileChooser ();
+
+ dialog.setDialogTitle (title);
+
+ dialog.setFileSelectionMode (JFileChooser.FILES_ONLY);
+
+ dialog.setSelectedFile (new File (default_name));
+ dialog.setDialogType (JFileChooser.SAVE_DIALOG);
+ final int status = dialog.showSaveDialog (getParentFrame ());
+
+ if (status != JFileChooser.APPROVE_OPTION) {
+ return null;
+ }
+
+ if (dialog.getSelectedFile () == null) {
+ return null;
+ } else {
+ final File write_file = dialog.getSelectedFile ();
+
+ if (write_file.exists ()) {
+ final YesNoDialog yes_no_dialog =
+ new YesNoDialog (getParentFrame (),
+ "this file exists: " + write_file +
+ " overwrite it?");
+
+ if (yes_no_dialog.getResult ()) {
+ // yes - continue
+ } else {
+ // no
+ return null;
+ }
+ }
+
+ return write_file;
+ }
+ }
+
+ /**
+ * Write a table of codon usage for the selected features to a file choosen
+ * by the user.
+ **/
+ private void writeCodonUsage () {
+ if (! checkForSelectionFeatures ()) {
+ return;
+ }
+
+ final File write_file =
+ getWriteFile ("Select a codon usage output file ...", "usage");
+
+ if (write_file == null) {
+ return;
+ }
+
+ try {
+ final PrintWriter writer = new PrintWriter (new FileWriter (write_file));
+
+ final int [] [] [] codon_counts = new int [4][4][4];
+
+ final FeatureVector features_to_write =
+ getSelection ().getAllFeatures ();
+
+ int codon_total = 0;
+
+ for (int i = 0 ; i < features_to_write.size () ; ++i) {
+ final Feature selection_feature = features_to_write.elementAt (i);
+
+ for (int base1 = 0 ; base1 < 4 ; ++base1) {
+ for (int base2 = 0 ; base2 < 4 ; ++base2) {
+ for (int base3 = 0 ; base3 < 4 ; ++base3) {
+ codon_counts[base1][base2][base3] +=
+ selection_feature.getCodonCount (base1, base2, base3);
+ }
+ }
+ }
+
+ codon_total += selection_feature.getTranslationBasesLength () / 3;
+ }
+
+ for (int base1 = 0 ; base1 < 4 ; ++base1) {
+ for (int base3 = 0 ; base3 < 4 ; ++base3) {
+ final StringBuffer buffer = new StringBuffer ();
+
+ for (int base2 = 0 ; base2 < 4 ; ++base2) {
+ buffer.append (Bases.letter_index[base1]);
+ buffer.append (Bases.letter_index[base2]);
+ buffer.append (Bases.letter_index[base3]);
+ buffer.append (' ');
+
+ final float per_thousand;
+
+ if (codon_total > 0) {
+ per_thousand =
+ 10000 * codon_counts[base1][base2][base3] / codon_total *
+ 1.0F / 10;
+ } else {
+ per_thousand = 0.0F;
+ }
+
+ buffer.append (per_thousand);
+ buffer.append ("( ").append (codon_counts[base1][base2][base3]);
+ buffer.append (") ");
+ }
+
+ writer.println (buffer.toString ());
+ }
+ }
+
+ writer.close ();
+ } catch (IOException e) {
+ new MessageDialog (getParentFrame (),
+ "error while writing: " + e.getMessage ());
+ }
+ }
+
+ /**
+ * The EntryGroup object that was passed to the constructor.
+ **/
+ private EntryGroup entry_group;
+}
diff --git a/uk/ac/sanger/artemis/components/YesNoDialog.java b/uk/ac/sanger/artemis/components/YesNoDialog.java
new file mode 100644
index 000000000..6b7386c88
--- /dev/null
+++ b/uk/ac/sanger/artemis/components/YesNoDialog.java
@@ -0,0 +1,115 @@
+/* YesNoDialog.java
+ *
+ * created: Sat Dec 12 1998
+ *
+ * This file is part of Artemis
+ *
+ * Copyright (C) 1998,1999,2000 Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+ *
+ * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/YesNoDialog.java,v 1.1 2004-06-09 09:48:01 tjc Exp $
+ */
+
+package uk.ac.sanger.artemis.components;
+
+import uk.ac.sanger.artemis.Options;
+
+import java.awt.*;
+import java.awt.event.*;
+
+import javax.swing.*;
+
+/**
+ * A popup dialog box that displays a message and then waits for the to press
+ * yes or no.
+ *
+ * @author Kim Rutherford
+ * @version $Id: YesNoDialog.java,v 1.1 2004-06-09 09:48:01 tjc Exp $
+ **/
+
+public class YesNoDialog extends JDialog {
+ /**
+ * Create a new YesNoDialog component. The constructor does not show ()
+ * the dialog, call getResult () to do that.
+ * @param parent The parent window.
+ * @param title The title of the new dialog JFrame.
+ * @param message The message to display in the JDialog.
+ **/
+ public YesNoDialog (JFrame parent, String title, String message) {
+ super (parent, message, true);
+
+ getContentPane ().add (new JLabel (message), "North");
+
+ final JPanel panel = new JPanel ();
+
+ panel.add (yes_button);
+ yes_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ button_result = true;
+ setVisible (false);
+ YesNoDialog.this.dispose ();
+ }
+ });
+
+ panel.add (no_button);
+ no_button.addActionListener (new ActionListener () {
+ public void actionPerformed (ActionEvent e) {
+ button_result = false;
+ setVisible (false);
+ YesNoDialog.this.dispose ();
+ }
+ });
+
+ getContentPane ().add (panel, "South");
+ pack ();
+
+ final Dimension screen = Toolkit.getDefaultToolkit().getScreenSize();
+ setLocation (new Point ((screen.width - getSize ().width) / 2,
+ (screen.height - getSize ().height) / 2));
+ }
+
+ /**
+ * Create a new YesNoDialog component. The constructor does not show ()
+ * the dialog, call getResult () to do that.
+ * @param parent The parent window.
+ * @param message The message to display in the JDialog and to uise as the
+ * title string.
+ **/
+ public YesNoDialog (JFrame parent, String message) {
+ this (parent, message, message);
+ }
+
+ /**
+ * This method calls show () on this object, and then waits for the user to
+ * press the Yes button or the No button.
+ * @return true is the user pressed Yes, false otherwise.
+ **/
+ public boolean getResult () {
+ setVisible (true);
+
+ return button_result;
+ }
+
+ final JButton yes_button = new JButton ("Yes");
+
+ final JButton no_button = new JButton ("No");
+
+ /**
+ * Set by the yes and no button action listeners and read by getResult ().
+ **/
+ boolean button_result;
+}
+
--
GitLab