Skip to content
Snippets Groups Projects
SequenceViewer.java 4.65 KiB
Newer Older
  • Learn to ignore specific revisions
  • tjc's avatar
    tjc committed
    /* SequenceViewer.java
     *
     * created: Sat Dec 19 1998
     *
     * This file is part of Artemis
     *
     * Copyright (C) 1998,1999,2000  Genome Research Limited
     *
     * This program is free software; you can redistribute it and/or
     * modify it under the terms of the GNU General Public License
     * as published by the Free Software Foundation; either version 2
     * of the License, or (at your option) any later version.
     *
     * This program is distributed in the hope that it will be useful,
     * but WITHOUT ANY WARRANTY; without even the implied warranty of
     * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
     * GNU General Public License for more details.
     *
     * You should have received a copy of the GNU General Public License
     * along with this program; if not, write to the Free Software
     * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA  02111-1307, USA.
     *
     * $Header: //tmp/pathsoft/artemis/uk/ac/sanger/artemis/components/SequenceViewer.java,v 1.1 2004-06-09 09:47:47 tjc Exp $
     */
    
    package uk.ac.sanger.artemis.components;
    
    import java.io.StringWriter;
    import java.io.PrintWriter;
    
    /**
     *  This component provides a viewer for dna or amino acid sequences.  The
     *  units are numbered automatically, given a view like this:
     *  <pre>
     *  ATGATGATGATGATATGCATGATCG
     *           10        20
     *  </pre>
     *  @author Kim Rutherford
     *  @version $Id: SequenceViewer.java,v 1.1 2004-06-09 09:47:47 tjc Exp $
     **/
    
    public class SequenceViewer extends FileViewer {
      /**
       *  Create a new SequenceViewer component.
       *  @param title The name to attach to the new JFrame.
       *  @param include_numbers If true then the sequence will be numbered
       *    (every second line of the display will be numbers rather than
       *    sequence).
       **/
      public SequenceViewer (final String title,
                             final boolean include_numbers) {
        super (title);
    
        this.include_numbers = include_numbers;
      }
    
      /**
       *  Set the sequence to display.
       *  @param comment_line A comment to put on the first line.  This may be
       *    null in which case there is no comment line.  This String should not
       *    be "\n" terminated.
       *  @param sequence The sequence to display.  This may be null in which case
       *    there is no comment line.  This String should not be "\n" terminated.
       **/
      public void setSequence (final String comment_line, final String sequence) {
        this.comment_line = comment_line;
        this.sequence = sequence;
    
        setView ();
      }
    
      /**
       *  Set the sequence to display with no comment line.
       *  @param sequence The sequence to display.  This may be null in which case
       *    there is no comment line.  This String should not be "\n" terminated.
       **/
      public void setSequence (final String sequence) {
        this.comment_line = null;
        this.sequence = sequence;
    
        setView ();
      }
    
      /**
       *  Write the sequence and comment_line in the view.
       **/
      private void setView () {
        final StringWriter string_writer = new StringWriter ();
    
        final PrintWriter writer = new PrintWriter (string_writer);
    
        if (comment_line != null) {
          writer.println (comment_line);
        }
    
        String rest_of_sequence = sequence;
    
        final int UNITS_PER_LINE = 60;
    
        int line_count = 0;
    
        while (rest_of_sequence != null) {
          final String this_line;
    
          if (rest_of_sequence.length () < UNITS_PER_LINE) {
            this_line = rest_of_sequence;
            rest_of_sequence = null;
          } else {
            this_line = rest_of_sequence.substring (0, UNITS_PER_LINE);
            rest_of_sequence = rest_of_sequence.substring (UNITS_PER_LINE);
          }
    
    
          writer.println (this_line);
    
          if (include_numbers) {
            final int COUNT_INTERVAL = 10;
    
            for (int i = 1 ;
                 i <= this_line.length () / COUNT_INTERVAL;
                 ++i) {
              final int this_unit_count =
                i * COUNT_INTERVAL + line_count * UNITS_PER_LINE;
    
              final int number_of_spaces =
                COUNT_INTERVAL - String.valueOf (this_unit_count).length ();
    
              for (int space_index = 0 ;
                   space_index < number_of_spaces ;
                   ++space_index) {
                writer.print (' ');
              }
    
              writer.print (this_unit_count);
            }
    
            writer.println ();
          }
    
          ++line_count;
        }
    
        writer.flush ();
    
        setText (string_writer.toString ());
      }
    
      /**
       *  The sequence to display.
       **/
      private String sequence = "";
    
      /**
       *  A comment to put on the first line.  If null don't display any comment.
       **/
      private String comment_line = null;
    
      /**
       *  If true then the amino acids will be numbered (every second line of the
       *  display will be numbers rather than sequence).
       **/
      private final boolean include_numbers;
    }