Used to POST data to NCBI blast

git-svn-id: svn+ssh://svn.internal.sanger.ac.uk/repos/svn/pathsoft/artemis/trunk@12258 ee4ac58c-ac51-4696-9907-e4b3aa274f04

uk/ac/sanger/artemis/components/RunBlastAtNCBI.java

+/* RunBlastAtNCBI
+ *
+ * created: 2009
+ *
+ * This file is part of Artemis
+ *
+ * Copyright(C) 2009  Genome Research Limited
+ *
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation; either version 2
+ * of the License, or(at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program; if not, write to the Free Software
+ * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA  02111-1307, USA.
+ *
+ **/
+package uk.ac.sanger.artemis.components;
+
+import java.awt.GridBagConstraints;
+import java.awt.GridBagLayout;
+import java.io.BufferedReader;
+import java.io.InputStreamReader;
+import java.io.OutputStreamWriter;
+import java.io.UnsupportedEncodingException;
+import java.net.URL;
+import java.net.URLConnection;
+import java.net.URLEncoder;
+
+import javax.swing.JComboBox;
+import javax.swing.JLabel;
+import javax.swing.JOptionPane;
+import javax.swing.JPanel;
+import javax.swing.JTextField;
+
+import uk.ac.sanger.artemis.editor.BrowserControl;
+
+/**
+ * Used to POST data to the NCBI qBLAST web services.
+ */
+class RunBlastAtNCBI extends Thread
+{
+  private String data;
+
+  public RunBlastAtNCBI(final String data)
+  {
+    this.data = data;
+  }
+  
+  public void run()
+  {
+    try
+    {
+      // Send data
+      URL url = new URL("http://www.ncbi.nlm.nih.gov/blast/Blast.cgi");
+      URLConnection conn = url.openConnection();
+      conn.setDoOutput(true);
+      OutputStreamWriter wr = new OutputStreamWriter(conn.getOutputStream());
+      wr.write(data);
+      wr.flush();
+
+      // Get the response
+      BufferedReader rd = new BufferedReader(new InputStreamReader(conn
+          .getInputStream()));
+      String urlResults = url + "?RID=";
+      String line;
+      String eta = "10";
+      while ((line = rd.readLine()) != null)
+      {
+        int index;
+        if ((index = line.indexOf("RID =")) > -1)
+        {
+          line = line.substring(index + 5).trim();
+          urlResults = urlResults.concat(line);
+          if (line.equals(""))
+          {
+            JOptionPane.showMessageDialog(null, line, "Blast search error",
+                JOptionPane.INFORMATION_MESSAGE);
+            return;
+          }
+        }
+        else if ((index = line.indexOf("RTOE =")) > -1)
+          eta = line.substring(index + 6).trim();
+      }
+      wr.close();
+      rd.close();
+
+      int waitTime = Integer.parseInt(eta);
+      ProgressBarFrame progress = new ProgressBarFrame(waitTime, "BLAST");
+      Thread.sleep(waitTime * 1000);
+      BrowserControl.displayURL(urlResults + "&CMD=Get");
+      progress.dispose();
+    }
+    catch (Exception e)
+    {
+      e.printStackTrace();
+    }
+  }
+  
+  /**
+   * Utility for appending key - value pairs to the data used to POST
+   * @param data
+   * @param key
+   * @param value
+   * @return
+   * @throws UnsupportedEncodingException
+   */
+  private static String addData(String data, String key, String value) 
+          throws UnsupportedEncodingException
+  {
+    data += "&" +URLEncoder.encode(key, "UTF-8") + "=" + URLEncoder.encode(value, "UTF-8");
+    return data;
+  }
+  
+  /**
+   * Allow the user to define the blast options.
+   * @param programName
+   * @param residues
+   * @return
+   */
+  public static String setData(String programName, String residues)
+  {
+    GridBagLayout layout = new GridBagLayout();
+    GridBagConstraints c = new GridBagConstraints();
+    JPanel dataPanel = new JPanel(layout);
+    int rows = 0;
+    
+    c.gridx = 0;
+    c.gridy = rows;
+    c.anchor = GridBagConstraints.EAST;
+    JTextField textField = new JTextField("nr",14);
+    dataPanel.add(new JLabel("NCBI Database"), c);
+    c.gridx = 1;
+    dataPanel.add(textField, c);
+    
+    c.gridx = 0;
+    c.gridy = ++rows;
+    JTextField hitField = new JTextField("500",14);
+    dataPanel.add(new JLabel("Number of hits to keep"), c);
+    c.gridx = 1;
+    dataPanel.add(hitField, c);
+    
+    // Gap open and gap close costs
+    // Space separated float values
+    // ''5 2'' for nuc-nuc, ''11 1'' for proteins, non-affine for megablast
+    c.gridx = 0;
+    c.gridy = ++rows;
+    JTextField gapOpenField = new JTextField((programName.equals("blastn")) ? "5": "11",14);
+    dataPanel.add(new JLabel("Gap open cost"), c);
+    c.gridx = 1;
+    dataPanel.add(gapOpenField, c);
+    
+    c.gridx = 0;
+    c.gridy = ++rows;
+    JTextField gapCloseField = new JTextField((programName.equals("blastn")) ? "2": "1",14);
+    dataPanel.add(new JLabel("Gap close cost"), c);
+    c.gridx = 1;
+    dataPanel.add(gapCloseField, c);
+
+    c.gridx = 0;
+    c.gridy = ++rows;
+    JTextField expectField = new JTextField("10.0",14);
+    dataPanel.add(new JLabel("Expect value"), c);
+    c.gridx = 1;
+    dataPanel.add(expectField, c);
+    
+    c.gridx = 0;
+    c.gridy = ++rows;
+    JComboBox filterField = new JComboBox(new String[]{ 
+        "None", "Low Complexity", "Human Repeats", "Masked" });
+    dataPanel.add(new JLabel("Filter"), c);
+    c.gridx = 1;
+    c.anchor = GridBagConstraints.WEST;
+    dataPanel.add(filterField, c);
+    
+    
+    c.gridx = 0;
+    c.gridy = ++rows;
+    
+    String serviceOptions[];
+    if(programName.equals("blastn"))
+      serviceOptions = new String[]{"plain", "megablast"};
+    else
+      serviceOptions = new String[]{"plain"}; // psi blast support?
+    
+    JComboBox serviceField = new JComboBox(serviceOptions);
+    c.anchor = GridBagConstraints.EAST;
+    dataPanel.add(new JLabel("Blast service"), c);
+    c.gridx = 1;
+    c.anchor = GridBagConstraints.WEST;
+    dataPanel.add(serviceField, c);
+    
+    int status = JOptionPane.showConfirmDialog(null, dataPanel, 
+        "Options for "+programName, JOptionPane.OK_CANCEL_OPTION);
+    
+    if(status != JOptionPane.OK_OPTION)
+      return null;
+
+    try
+    {
+      String data = URLEncoder.encode("CMD", "UTF-8") + "=" + 
+             URLEncoder.encode("Put", "UTF-8");
+      data = addData(data, "QUERY", residues);
+      data = addData(data, "DATABASE", textField.getText());
+      data = addData(data, "HITLIST_SIZE", hitField.getText());
+      if(getFilterOption(filterField) != null)
+        data = addData(data, "FILTER", getFilterOption(filterField));
+      data = addData(data, "EXPECT", expectField.getText());
+      data = addData(data, "FORMAT_TYPE", "HTML");
+      data = addData(data, "PROGRAM", programName);
+      data = addData(data, "CLIENT", "web");
+      data = addData(data, "SERVICE", (String) serviceField.getSelectedItem());
+      
+      if(((String) serviceField.getSelectedItem()).equals("megablast"))
+        data = addData(data, "MEGABLAST", "yes");
+      else
+        data = addData(data, "GAPCOSTS", gapOpenField.getText()+" "+gapCloseField.getText());
+      
+      return data;
+    }
+    catch (UnsupportedEncodingException e)
+    {
+      e.printStackTrace();
+    }
+    return null;
+  }
+  
+  /**
+   * Blast filter options.
+   * @param filterField
+   * @return
+   */
+  private static String getFilterOption(JComboBox filterField)
+  {
+    String sel = (String) filterField.getSelectedItem();
+    if(sel.equals("None"))
+      return null;
+    else if(sel.equals("Low Complexity"))
+      return "L";
+    else if(sel.equals("Human Repeats"))
+      return "R";
+    else
+      return "m";
+  }
+  
+  public static void main(String args[])
+  {
+    String data =
+      //BlastAtNCBI.setData("blastp", "ATHIEDLHNITSNQLYETYRTEKLSTSQLLLDSTVXTIDKNLSQHDQVLREDRLR");
+      RunBlastAtNCBI.setData("blastn", "aggctgttttccacagatttcacagtattggttcaaatggtcaaaaattgttttaaccagt");
+    RunBlastAtNCBI blast= new RunBlastAtNCBI(data);
+    blast.start();
+  }
+}
\ No newline at end of file